1— shear strength of slab at column support
(free) Building code requirements for structural concrete and commentary pca notes on aci318 08
... concrete strength to nominal wall shear strength, see 21.9.4.1, Chapter 21 ratio of flexural stiffness of beam section to flexural stiffness of a width of slab bounded laterally by centerlines of adjacent ... to compute Vc in slabs and footings, Chapter 11 ratio of flexural stiffness of shearhead arm to that of the surrounding composite slab section, see 11.11.4.5, Chapter 11 ratio of long to short ... assumptions of the strength design method of this Code before application of any strength reduction factors See 9.3.1 Strength, nominal — Strength of a member or cross section calculated using...
- 1,508
- 13,139
- 1
Báo cáo y học: " Mechanism of HIV-1 Tat RNA translation and its activation by the Tat protein" ppsx
... for Tat1 and for Tat2:274→) AUGEcoRI sense 5' TATAATAGAATTCATGGAGCCAGTAGATCCTAGACTAGAG 3' (exon2: sense for Tat1:343 → and for Tat2:396 →) TatNcoI sense 5' TAATATACCATGGGGTCTCTCTGGTTAGACCAGATC ... for Tat1 and for Tat2:1→) TatSmaI rev 5' TATATACCCGGGAGTACAGGCAAAAAGCAGCTGCTTATATGC 3' (exon3: reverse for Tat1:← 1718 and for Tat2:← 1770) TatXbaI sense 5' ATATATTCTAGAGGTCTCTCTGGTTAGACCAGATC ... DNA (0.6 1g) : Ct pdualTat1 2(Tat)1 3(Tat1) Tatcod Tat2 2(Tat2) 3(Tat2) Figure Expression of 5' UTR mutants of Tat RNA in HeLa P4 cells Expression of 5' UTR mutants of Tat RNA in HeLa P4 cells...
- 18
- 240
- 0
Báo cáo y học: " Processing sites in the human immunodeficiency virus type 1 (HIV-1) Gag-Pro-Pol precursor are cleaved by the viral protease at different rates" ppt
... inactive protease (by PR D25A mutation of the catalytic aspartate) was generated by transcription and translation of pGPPfs-PR in a rabbit reticulocyte lysate Purified mature HIV-1 protease was added ... structure and translational pausing during expression The activity of the intrinsic protease was inactivated by a D25A substitution of the catalytic aspartate The location of the Gag NC/p1 [53] ... combination of two different gel systems allowed for the separation and analysis of the appearance of each product An initial species of 120 kDa (processing intermediate pi120) was rapidly generated...
- 6
- 353
- 0
Synthesis and photoluminescence property of silicon carbon nanowires synthesized by the thermal evaporation method
... Research Group of National Science Foundation of China (Grant no 50721003), the Foundation of the Ministry of Education of China for Returned Scholars (Grant no 2005383) and the National Basic ... nanowires (Fig 5b) The presence of peaks demonstrates that the nanowires are composed of Si, C and small amount of O It is found that the molecular ratio of Si/C/O of the nanowires is about 3:2:2, ... high purity of Ar (40 sccm) to eliminate O2 by means of rotary vacuum pump for many times Afterwards, the furnace was rapidly heated from room temperature to 1400 1C at a heating rate of 10 1C/min...
- 5
- 552
- 0
Báo cáo toán học: " Photoluminescence characteristics of Cd1-xMnxTe single crystals grown by the vertical Bridgman method" doc
... as L1) were systematically investigated as a function of temperature and of alloy composition The parameters that describe the temperature variation of the energy were evaluated by the semiempirical ... series of Mn concentrations The solid lines are the fits according to the Varshni relation (Equation 1) Figure Temperature dependence of the FWHM of L1 emission lines for a series of Mn concentrations ... relation From the temperature dependence of the full width at half maximum of the L1 emission line, the broadening factors Г(T) were determined from the fit to the data The activation energies of...
- 14
- 547
- 0
Báo cáo toán học: "A Multiple Integral Evaluation Inspired by the Multi-WZ Method" potx
... recurrence operator i=0 shift operator in n, and a k-tuple of rational functions(the certificate) [R1 , , Rk ] (Ri = Ri (n, m, y, x)) such that the recurrence-differential operator I k i ai(n)En ... O(mk ) calculations However, in both forms the evaluation of the right side of the integral is much faster (for specific m, n, and k) than the direct evaluation of the left side of our intergal ... sense of Wilf [W82] The present paper is an example of what Doron Zeilberger [Z98] calls WZ Theory, Chapter 1/2 Even though, at present, our proof, for general k, was human-generated, it seems that...
- 7
- 227
- 0
A numerical study of a permeable capsule under stokes flows by the immersed interface method
... formulation 18 2.2.2 Discretization of computational domain 24 2.2.3 Solving the equations of motion 25 2.2.4 Solving the transport equation 29 2.2.5 Summary of the main procedure on the calculation ... concentration values at these defined points are calculated by one-sided least squares interpolation of nearby grid-point concentration values with an error of O(h2) The interpolated concentration ... capsule-substrate adhesion in the presence of membrane permeability is simulated and the osmotic inflation of the initially adhered capsule is studied systematically as a function of solute concentration...
- 194
- 414
- 0
Damage progression in open hole tension composite laminates by the element failure method
... and Literature Review Table 1.2 Correlation of damage modes and material property degradation [Camanho and Matthews, 1999] Damage Modes Material Property Degradation Matrix tensile or shear cracking ... failure x List of Figures List of Figures Figure 1.1 Schematic representation of damage modes in fibrous composite materials Figure 1.2 The effect of SRC on the estimated ultimate load for ... composite laminates [A]i Column matrix of mechanical amplification factors at position i within the micromechanical block model {T}i Column vector of thermal amplification factors at position i within...
- 169
- 352
- 0
Impact of pH on Anaerobic Substrate Uptake by PAOs and GAOs in an EBPR Activated Sludge Process Analyzed by MAR-FISH
... Journal of Water and Environment Technology, Vol 7, No 4, 2009 Since the predomination of GAOs instead of PAOs leads to the deterioration of EBPR, it is essential to understand the mechanisms of the ... 9mL vessels with 2mL activated sludge mixed liquor treated above Tritium labeled sodium acetate together with natural sodium acetate was added at a final concentration of 20mg mgC･L-1 with radioactivity ... μCi･mL-1 For each pH, incubation was conducted in triplicate As control, activated sludge mixed liquor treated at 70oC for 10 was also incubated with the same substrate The activated sludge was collected...
- 9
- 457
- 0
Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx
... prolonged signal duration Thus, all of the experiments revealed that the association of hOR2AG1 with MUPP1 regulates signal duration To a certain extent, the impaired signal desensitization resembles ... olfactory adaptation [20] By phosphorylation of adenylyl cyclase in OSNs, CamKII provides an important mechanism for the attenuation of odorant-stimulated cAMP increases [31] Alternatively, because ... subset of cells, forming clusters at the cell surface (Fig 2A, B) Approximately 5% of transfected cells exhibited this translocation effect of MUPP1-GFP This apparently low proportion of cells...
- 12
- 543
- 0
Tài liệu Panda3D 1. 6 Game Engine Beginner''''s Guide by Dave Mathews doc
... with what you have learned You will also find a number of styles of text that distinguish between different kinds of information Here are some examples of these styles, and explanations of their ... programming is often abbreviated, is a design idea for organizing a program's code Instead of creating a long list of line after line of code that defines the entire program all at once, we break ... a class we are creating a type of object for our program to use, but to create an actual object of that type, we need to create an instance of the class An instance is just what its name implies,...
- 356
- 3,435
- 1
Tài liệu Báo cáo khoa học: Crystal structure of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase complexed with an analogue of 1,3-bisphospho-D-glyceric acid Selective inhibition by structure-based design docx
... first step of the enzymatic process by keeping its D conformation [26] Our observations suggest that the substrate analogue is probably located elsewhere on the pathway of the multistep catalysis, ... protamine sulfate for 15 at room temperature The lysate was centrifuged (10 000 g, 15 at °C), and the supernatant used for purification of recombinant enzyme by immobilized metalaffinity chromatography ... following the formation of NADH by GAPDH, using the substrate GAP at a saturating concentration of 0.8 mM (Km ¼ 150 lM) [43] For the reverse (gluconeogenic) reaction, in which NADH oxidation was followed,...
- 13
- 588
- 0
Tài liệu Báo cáo Y học: Phosphatidylinositol synthesis and exchange of the inositol head are catalysed by the single phosphatidylinositol synthase 1 from Arabidopsis docx
... that arises is the relevance of the exchange of polar head when de novo synthesis is studied We calculated that with a linear rate of synthesis of nmol PtdInsÆmin)1Æmg)1 (Fig 2), the concentration ... leads to an enhancement of inositol incorporation provided that the concentration of manganese is correspondingly increased to 7.5 mM to compensate the chelating effect of EDTA (unpublished results) ... the effect of the chelator on each reaction, each activity was normalized to that obtained at mM EDTA and plotted as a function of the free Mn2+ concentration (Fig 2B) The data show that synthesis...
- 6
- 551
- 0
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc
... stage of C elegans as a template with the following primers: M2-goa1-s, 5¢-CATTATAAGA ACATAGGCGCTACAAGGATGGGTTGTACCATGTC ACAGGAAG-3¢; M2-goa1-PstI-as, 5¢-CCAATGCATTGG TTCTGCAGTTAATACAAGCCGCATCCACGAAGA-3¢ ... N-terminus of M2 To prevent rapid degradation, the central part of the third intracellular loop of M2 was deleted [26] Asn at putative N-glycosylation sites near the N-terminus of M2 was mutated to ... presence of 0.2 mM atropine; solid line, in the absence of atropine atropine (Fig 3A), suggesting that carbamylcholine induced the substitution for GTPcS in GOA-1 The IC50 value of the displacement of...
- 9
- 400
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... (stored at )20 °C in water at a concentration of mM) were diluted in the assay buffer to the desired concentration just prior to the assay Results Molecular modelling The conformational properties of ... Fig (/ – w) maps of b-amino acids with indication of the conformational space common with that of a-amino acids The (/ ) w) maps corresponding to h-values of )60° and 60° are indicated for HGly ... values of Ca were determined in water, it is possible that Ca chemical shifts are sensitive to solvent variation, causing an underestimation of calculated CSDs These CSDHa and CSDCa variations...
- 11
- 860
- 0
Báo cáo khoa học: Interaction of gymnemic acid with cyclodextrins analyzed by isothermal titration calorimetry, NMR and dynamic light scattering doc
... enhancement, stabilization of labile drugs, control of volatility and sublimation, physical isolation of incompatible compounds, long-term protection of color, odor and flavor, and suppression of hemolysis ... and Pi indicate that there is little effect of buffer ionization on complex formation [19] The binding stoichiometry of GA to c-CD shows that the complex forms in an equimolar ratio of respective ... at least above the concentration of 2.0 mm, would form a water-soluble aggregate In the presence of c-CD, however, the GA signals became sharp (Fig 3A) These results indicate that the aggregated...
- 7
- 502
- 0
Báo cáo khoa học: Maturation of Pichia pastoris-derived recombinant pro-Der p 1 induced by deglycosylation and by the natural cysteine protease Der p 1 from house dust mite doc
... range between duplicates As autocatalytic cleavage was not achieved, enzymatically active natural Der p was evaluated as a tool to induce maturation of rpro-Der p Incubation of 125I-labeled rpro-Der ... can be at the basis of differences in post-translational processing The lack of induction of maturation of rpro-Der p after dialysis to pH 4.0 observed in our study contrasts with observations ... is glycosylated [18] In accordance with this, lack of detectable N-linked glycans on the mature natural allergen was implicated by the observation that Endo H treatment (cleaving off high-mannose...
- 9
- 416
- 0
Why (Special Agent) Johnny (Still) Can’t Encrypt: A Security Analysis of the APCO Project 25 Two-Way Radio System docx
... Figure for the the this end oftothe thatData encoding ofThe terminating data unitterminating means Link thethe of the message voice oversimple air isfollow the may more data unit signify end frames ... allocations are managed by the National Telecommunications and Information Administration and, unlike the state, local, and private frequency allocations managed by the Federal Communications ... standard implementations of it admit practical, exploitable vulnerabilities that routinely leak sensitive traffic and that allow an active attacker remarkable leverage At the root of many of the most...
- 16
- 1,185
- 0
Báo cáo khoa học: Downregulation of protease-activated receptor-1 in human lung fibroblasts is specifically mediated by the prostaglandin E2 receptor EP2 through cAMP elevation and protein kinase A pot
... level rather than by an altered mRNA degradation rate As we showed that de novo protein synthesis is not required to mediate the effects of PGE2, we suggest that PGE2 regulates the activities of ... responsible for regulation of PAR-1 gene expression We observed attenuation of the effect of PGE2 by silencing of the transcription factor AP-2 The role of AP-2 as a repressor of PAR-1 gene expression ... degradation Another explanation for the fact that only PGE2 stimulation results in the reduction of PAR-1 protein on the cell surface could be differential modulation of the translation rate or...
- 11
- 338
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25