1— characteristics of a protective barrier system
Báo cáo y học: "Enrichment of intersubtype HIV-1 recombinants in a dual infection system using HIV-1 strain-specific siRNAs" pps
Ngày tải lên :
13/08/2014, 01:20
... specificity of siRNA-mediated inhibition of v120 -A and v126-D replication Panels A and B illustrate the specificity of siRNA12 0a for the 5’ end of v120 -A and of siRNA12 6a for the 3’ end of v126-D As described ... include a siRNA12 0a specifically targeting upstream (C1) of env in virus v120 -A, a primary CXCR4-tropic HIV-1 isolate from a subtype A infected Ugandan, and a siRNA12 6a specifically targeting ... the Case/UHC CFAR Biosafety Core (AI36219) and by research grants awarded to E.J .A and Y.G (NIH/NIAID AI49170 and AI84816) We would also thank Dr David Robertson, University of Manchester, UK and...
- 12
- 250
- 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
Ngày tải lên :
12/09/2012, 15:05
... nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious data manager may change the value of its data on each cache refresh ... access to cached data than the data manager has permitted (e.g., a write fault on a page made read-only by a pager_data_lock call), the kernel issues a pager_data_unlock call The data manager is ... memory as a cache of secondary storage data pages The effect of this kind of caching on the performance of UNIX and its traditional suite of application programs is dramatic Compilation of a small...
- 23
- 1.3K
- 1
Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine
Ngày tải lên :
05/09/2013, 15:28
... percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and has a higher value of maximum heat ... and exhaust gas temperature was observed in case of high unsaturated biodiesel Heat release rate and cumulative heat release rate is lower in case of high- unsaturated biodiesel fuel A general ... properties and combustion parameters "X" variable % of Unsaturation Density Cetane number Heating value Iodine value "Y" variable Start of dynamic injection bTDC Ignition delay Maximum heat release rate...
- 20
- 483
- 0
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf
Ngày tải lên :
20/02/2014, 11:20
... T9 6A F10 0A V12 6A F12 8A S12 9A E13 0A V13 1A E13 2A R13 3A R13 5A F13 6A I13 7A I13 8A N13 9A D14 0A W14 1A V14 2A K14 3A T14 4A H14 5A T14 6A K14 7A M14 9A N15 2A E28 3A E28 5A K32 5A K32 7A PAI-1stab PAI-1stab(E28 5A) ... SDS/PAGE analysis After 24 h, the fraction of molecules behaving as a substrate for uPA decreased approximately twofold for PAI-1(V12 6A) , PAI-1(F10 0A) , PAI-1(F12 8A) and PAI-1(W14 1A) with a concomitant ... rate of latency transition expressed as the functional half-life, t½ The averages and standard deviations for at least three independent measurements are given for each variant PAI-1 variant Activity...
- 9
- 605
- 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
Ngày tải lên :
16/03/2014, 01:20
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
- 9
- 444
- 0
The Design and Implementation of a Sequence Database System * docx
Ngày tải lên :
16/03/2014, 16:20
... on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database.In Proceedings of the International Conference on Very Large Databases(VWB), ... supports relational data as well as sequencedata, using a novel design paradigm of enhancedabstractdata types (BADTs ) The systemimplementation basedon this paradigmallows sequence relational queriesto ... valueis created,or determinedautomatically by the system Catalog Management: Each E-ADT can provide catalogs that maintain statisticsand storeschemainformation Further, certain valuesmay be named Query...
- 12
- 568
- 0
Báo cáo khoa học: "DESIGN OF A MACHINE TRANSLATION SYSTEM " pptx
Ngày tải lên :
17/03/2014, 19:21
... accordance with these considerations Ccmputational considerations In a transfer-based MT system, actual translation takes place in transfer and can be described as the ocr~putaticnal manipulation ... infinitival phrases in place of deverbal nominal constructions Apart from this difference, the major textual characteristics carry over from source to target sublanguage thereby facilitating mechanical ... influenced by target language considerations: the interface structure between analysis and transfer was defined to take advantage of the similarities between the three languages and to accommodate the...
- 4
- 394
- 0
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
Ngày tải lên :
23/03/2014, 06:20
... – 2A – 1A QN + 1A + 2A + 3A + 4A + 5A + 6A + 7A + 8A + 9A Fig Assessment of the contribution of each amino acid residue of K5 to substrate recognition Alanine substitution mutants of K5 were produced as ... M, Yamashita F, Ishida-Yamamoto A, Yamada K, Kinoshita C, Fushiki S, Ueda E, Morishima Y, Tabata K, Yasuno H et al (1998) Defective stratum corneum and early neonatal death in mice lacking the ... Furutani Y, Kato A, Notoya M, Ghoneim MA & Hirose S (2001) A simple assay and histochemical localization of transglutaminase activity using a derivative of green fluorescent protein as substrate...
- 11
- 449
- 1
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx
Ngày tải lên :
23/03/2014, 14:20
... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 2010), the question arises ... another language F , each translation could have m candidates {e } which may contain potential paraphrases for es Our task is to locate the candidate that best fit in the demands of paraphrasing 39...
- 5
- 347
- 0
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot
Ngày tải lên :
24/03/2014, 04:21
... identical patterns and it was therefore concluded that the same polysaccharide was present A hydrolysate of the upper phase, analyzed as alditol acetates, revealed as D-glucose, D-galactose, D-galactosamine, ... initial phenotypic characterization of the strain 10457 with a commercial identification system, API-20 E identified the strain as Hafnia alvei [4] Additional phenotypic characterization and partial ... phenotypic and genotypic characteristics among strains of Hafnia alvei J Clin Microbiol 34, 2973–2979 Albert, M.J., Alam, K., Islam, M., Montanaro, J., Rahman, H., Haider, K., Hossain, M .A. , Kibriya, A. K.M.G...
- 7
- 463
- 0
Báo cáo Y học: Molecular and biochemical characteristics of a gene encoding an alcohol acyl-transferase involved in the generation of aroma volatile esters during melon ripening pptx
Ngày tải lên :
31/03/2014, 21:21
... each primer 50 lM CM-AAT1 was amplified by using RSB-5¢: 5¢-CAAAGAGCACCCTCATTCCAGCC-3¢, and FSD-3¢: 5¢-AGGAGGCAAGCATAGACTTAACG-3¢; CM-AAT2 was amplified with RSB-5¢ and FSA-3¢: 5¢-GATAATT CCACACCCTCCAATTA-3¢; ... The pattern of CMAAT2 mRNA expression was similar to that of CM-AAT1 except that expression peaked at 39 DAP instead of 41 DAP Shalit et al [21] have also demonstrated an increase of AAT activity ... the same activity CM-AAT1 is capable of transferring acyl residues into a variety of alcohols and CM-AAT2 is inactive towards the same substrates CM-AAT1 has the same enzyme activity as a strawberry...
- 8
- 509
- 0
Measuring the Economic Value of a City Park System docx
Ngày tải lên :
02/04/2014, 08:20
... by an average of $250 a year McKinley Park, Sacramento PARK VALUE IN ACTION Promoting Human Health in Sacramento Sacramento has 5,141 acres of parks that provide a multitude of ways to stay healthy ... green space in parks First, land cover data are obtained through analysis of aerial photographs This reveals forested as well as open grassy areas and also water surface; it also reveals impervious ... quadrangles, and corporate campuses.) Third, the amount and characteristics of rainfall are calculated from U.S weather data The model (which Philadelphia Department of Parks and Recreation combines aspects...
- 28
- 386
- 0
Combustion and emission characteristics of a natural gas fueled diesel engine with EGR
Ngày tải lên :
15/06/2014, 09:26
... natural gas diesel engine Energy 2010;35:1129–38 [11] Wannatong K, Akarapanyavit N, Siengsanorh S, Chanchaona S Combustion and knock characteristics of natural gas diesel dual fuel engine SAE paper ... estimate the repeatability of measure- _ m air stoic Accuracy of measurements and uncertainty analysis stoic where (AFR ) and (AFR ) are the stoichiometric air–fuel ratios NG D ment and the accuracy ... Pirouzpanah V, Khoshbakhti Saray R, Sohrabi A, Niaei A Comparison of thermal and radical effects of EGR gases on combustion process in dual fuel engines at part loads Energy Convers Manage 2007;48:1909–18...
- 12
- 573
- 0
báo cáo hóa học:" Representation to the Accident and Emergency department within 1-year of a fractured neck of femur" ppt
Ngày tải lên :
20/06/2014, 07:20
... falls, 57 fractures, head injures) required acute care because of a fall A fall may not have been the offending mechanism in all cases—some patients may have sustained pathological fractures or ... for Trauma (BOAST), 2007 www.boa.ac.uk (last accessed 09/02/2011) National Hip Fracture Database (NHFD) The National Hip Fracture Database National Report 2010 www.nhfd.co.uk (last accessed 09/02/2011) ... Secondary prevention of falls has emerged as a tenet of the multidisciplinary management of hip fractures With a multitude of factors implicated, including symptomatic cardiovascular pathology...
- 16
- 395
- 0
báo cáo hóa học:" Measuring outcomes in allergic rhinitis: psychometric characteristics of a Spanish version of the congestion quantifier seven-item test (CQ7)" pdf
Ngày tải lên :
20/06/2014, 15:20
... Allergology Department, Hospital Son Dureta, Palma de Mallorca, Spain; Mª Teresa Audicana, Allergy Service, Hospital de Santiago, Vitoria, Spain; Ana Mar a Navarro, Allergy Unit, Hospital el Tomillar, Sevilla, ... Pablo Amat, Alfonso Malet, Allergology Unit, Al.lergocentre, Barcelona, Spain; Ignacio Antépara, Ignacio Jauregui, Allergology Department, Hospital de Basurto, Bilbao, Spain; Carmen Vidal, Allergy ... Hospital la Princesa, Madrid, Spain; Carlos Colás, Allergy Service, Hospital Clínico, Zaragoza, Spain; Victoria Cardona, Allergy Service, Hospital Vall de Hebrón, Barcelona, Spain; Ramona Soler, Allergology...
- 5
- 361
- 0
Báo cáo hóa học: " Microstructure and adhesion characteristics of a silver nanopaste screen-printed on Si substrate" pdf
Ngày tải lên :
20/06/2014, 23:20
... confirmed that the diameters of the Ag nanoparticles were within Figure A Schematic diagram of scratch testing Page of Figure A TEM image (a) and size distribution (b) of Ag nanoparticles 10 and 30 ... b shows a TEM image and the measured size distribution of the Ag nanopaste, respectively In the TEM image, most of the Ag nanoparticles have a diameter of approximately 25 nm It was also confirmed ... http://www.nanoscalereslett.com/content/7/1/49 Page of Figure DSC (a) and TGA (b) curves of the Ag nanopaste a similar particle shape and size compared to the asdried one However, when the printed Ag nanopaste was sintered at 200°C...
- 6
- 477
- 0
Báo cáo hóa học: "Dynamics of a two-dimensional system of rational difference equations of Leslie–Gower type" doc
Ngày tải lên :
21/06/2014, 00:20
... other than u1 and u2, then the interior of 〚u1, u2〛 is either a subset of the basin of attraction of u1 or a subset of the basin of attraction of u2 Kalabušić et al Advances in Difference Equations ... subset of the basin of attraction of E All orbits that start below this curve are attracted to E1 All orbits that start above this curve are attracted to E (A1 − A2 − β1 + γ2 ) 4B2 R13 A1 = β1 , A1 ... global stable manifold W s(E3) that separates the positive quadrant so that all orbits below this manifold are attracted to the equilibrium point E1, and all orbits above this manifold are attracted...
- 29
- 241
- 0
Báo cáo hóa học: " Local existence and uniqueness of solutions of a degenerate parabolic system" pptx
Ngày tải lên :
21/06/2014, 03:20
... equations of parabolic type Translation of Mathematical Monographs American Mathematical Society, Providence 23 (1968) 15 Friedman, A: Partial Differential Equations of Parabolic Type Prentice-Hall ... Global and nonglobal weak solutions to a degenerate parabolic system J Math Anal Appl 324(1), 177–198 (2006) doi:10.1016/j.jmaa.2005.12.012 Okubo, A: Diffusion and Ecological Problems: Mathematical ... this article as: Zhang et al.: Local existence and uniqueness of solutions of a degenerate parabolic system Advances in Difference Equations 2011 2011:12 Submit your manuscript to a journal and...
- 11
- 322
- 0
Báo cáo hóa học: " Research Article Dynamics of a Predator-Prey System Concerning Biological and Chemical Controls" ppt
Ngày tải lên :
21/06/2014, 07:20
... involves an active human role Natural enemies of insect pests, also known as biological control agents, include predators, parasites, and pathogens Virtually all pests have some natural enemies, and ... fundamental matrix Φ t and the constant matrix M which we call the monodromy matrix of 2.5 corresponding to the fundamental matrix of Φ t All monodromy matrices of 2.5 are similar and have the ... perturbations have been illustrated to substantiate our mathematical results and to show that the system we have considered in this paper gives birth to various kinds of dynamical behaviors Actually,...
- 17
- 334
- 0
Báo cáo hóa học: " Research Article Asymptotic Behavior of a Periodic Diffusion System" pot
Ngày tải lên :
21/06/2014, 07:20
... 1983 24 O Ladyzenskaja, V Solonnikov, and N Uraltseva, “Linear and quasilinear equations of parabolic type,” in Translations of Mathematical Monographs, vol 23, American Mathematical Society, ... “Global existence and blow-up for a nonlinear reaction-diffusion system, ” Journal of Mathematical Analysis and Applications, vol 212, no 2, pp 481–492, 1997 Journal of Inequalities and Applications ... Theory, Methods & Applications, vol 60, no 5, pp 977–991, 2005 19 V A Galaktionov, S P Kurdyumov, and A A Samarski˘, A parabolic system of quasilinear ı equations I,” Differential Equations, vol 19,...
- 11
- 264
- 0