1 ventilation through the tracheal stump with a sterile et tube
báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc
Ngày tải lên :
18/06/2014, 19:20
... indicate better health Scores above and below 50 are considered above and below the average in the general U.S population [8] The SF-8 was translated into Luo, the main language of Gulu and Amuru ... forward and back translation and a detailed review by the study team Forward translation into Luo was conducted by a retired education lecturer at Gulu University It was then back-translated ... Mental health, social functioning, and disability in postwar Afghanistan JAMA 2004, 292(5):575-584 Lopes Cardozo B, Vergara A, Agani F, Gotway CA: Mental health, social functioning, and attitudes...
- 10
- 647
- 0
Báo cáo hóa học: "Approaching the MIMO Capacity with a Low-Rate Feedback Channel in V-BLAST" docx
Ngày tải lên :
23/06/2014, 01:20
... performance is limited by the antenna with the smallest capacity, as dictated by the channel Hence, it is natural to consider per-antenna rate adaptation using a low-rate feedback channel Using a ... low-rate feedback channel, [13] introduced rate adaptation at each antenna in V-BLAST to overcome this problem We extend their approach to both rate and power adaptations at each antenna and theoretically ... MIMO capacity Optimal power allocation with PARC Equal power allocation with PARC Suboptimal power allocation with PARC Equal power & rate allocation (MMSE V-BLAST) MIMO capacity Optimal power allocation...
- 10
- 221
- 0
Báo cáo toán học: "On the Generalized Convolution with a Weight - Function for Fourier, Fourier Cosine and Sine Transforms" pot
Ngày tải lên :
06/08/2014, 05:20
... Their Application, Russian Academy, Moscow, 1997 16 Nguyen Xuan Thao and Trinh Tuan, On the generalized convolution for I transform, Acta Math Vietnam 28 (2003) 159–174 17 M Saigo and S B Yakubovich, ... convolution with a weightfunction for the Cosine - Fourier integral transform, Acta Math Vietnam 29 (2004) 149–162 15 Nguyen Xuan Thao and Nguyen Thanh Hai, Convolution for Integral Transforms and Their ... Russian) V A Kakichev and Nguyen Xuan Thao, On the design method for the generalized integral convolution, Izv Vuzov Mat (1998) 31–40 (in Russian) V A Kakichev and Nguyen Xuan Thao, On the generalized...
- 16
- 336
- 0
Báo cáo y học: "Long term follow up after surgery in congenitally corrected transposition of the great arteries with a right ventricle in the systemic circulation" pot
Ngày tải lên :
10/08/2014, 09:22
... cardiac transplantation at ages 33, 34 and 47 respectively These three patients had an intact atrial and ventricular septum and an adequate subpulmonary outflow One patient had a dextrocardia ... dextrocardia and a long history of cardiac failure before transplantation The second patient also had a dextrocardia, with additionally mitral and aorta regurgitation, resulting in cardiac failure, finally ... treated with pulmonary valvotomy In all six patients with severe tricuspid valve regurgitation the tricuspid valve was replaced with a prosthetic valve Three patients had an Ebstein anomaly of the...
- 7
- 387
- 0
Báo cáo y học: " Carcinoid tumor of the verumontanum (colliculus seminalis) of the prostatic urethra with a coexisting prostatic adenocarcinoma: a case report" docx
Ngày tải lên :
11/08/2014, 14:21
... Kneale K, Lalak N, Delprado W: Carcinoid tumors of the urinary tract and prostate Arch Pathol Lab Med 2006, 130(11):1693-1706 Katayama M, Hara A, Hirose Y, Yamada Y, Kuno T, Sakata K, Morioka ... performed the original histological examination of the prostate, interpreted and diagnosed the pathology findings, prepared the figures and did the literature review All authors read and approved the ... this article as: Smith et al.: Carcinoid tumor of the verumontanum (colliculus seminalis) of the prostatic urethra with a coexisting prostatic adenocarcinoma: a case report Journal of Medical Case...
- 4
- 226
- 0
Báo cáo khoa học: "Injurious mechanical ventilation in the normal lung causes a progressive pathologic change in dynamic alveolar mechanics" potx
Ngày tải lên :
13/08/2014, 03:21
... that they are not completely surrounded by other alveoli In other words, one wall of a subpleural alveolus is always adjacent to the visceral pleura rather than another alveolus This anatomic arrangement ... 298 g and 548 g were anesthetized with intraperitoneal ketamine (90 mg/kg) and xylazine (10 mg/kg) at the onset of the procedure and as needed to maintain surgical anesthesia A tracheostomy was ... significant) Discussion Alveolar stability Expressed as the percentage change in alveolar area stability between peak inspiration and end expiration (%I – EΔ) Data are the mean ± standard error...
- 9
- 277
- 0
Báo cáo y học: "Through the rear view mirror: a content evaluation of the journal of Chiropractic & Osteopathy for the years 2005–2008" pps
Ngày tải lên :
13/08/2014, 14:20
... objective An International journal Originally the journal was to be an Australasian journal This was later changed to an international journal with an international editorial board In terms of the ... Australasia is problematic The lack of any paper from New Zealand, Oceania including islands of the Pacific Ocean, and Asia would also seem to imply that the journal is not meeting at least one ... origin the papers published fall into the following categories: USA 40, Australia 22, Canada 9, and Europe (including UK) Of the 83 articles about articles involved the collaboration of the USA, Australia,...
- 4
- 147
- 0
Báo cáo y học: "The Nordic back pain subpopulation program: Can low back pain patterns be predicted from the first consultation with a chiropractor" ppt
Ngày tải lên :
13/08/2014, 14:20
... First, each of the independent variables was tested against each of the outcome variables by Fisher’s exact test or regression analysis with one explanatory variable Thereafter, the variables that ... that were associated with one of the outcome variables were considered for a multivariable analysis, providing that these associations had a p-value of less than 0.1 The multivariable analyses were ... patients included for the study Page of 0.05 The statistical package STATA 10.1 (StataCorp, Texas, USA) was used for the analyses Results Descriptive data Seven chiropractors (all women, average...
- 8
- 293
- 0
Báo cáo y học: " Mechanical ventilation in the ICU- is there a gap between the time available and time used for nurse-led weaning?" pot
Ngày tải lên :
13/08/2014, 23:20
... and systemic factors associated with the time available for weaning that was actually Table 2: The relationship between weaning prescribed and weaning being performed in the 572 available weaning ... systemic factors associated with the available time actually used for weaning We identified a significant discrepancy To better understand the under-use of the available weaning time, we analysed patient ... 1) The forth criterion (weaning prescribed by a physician) was analysed as a systemic factor Ethical considerations We collected data from the ICU quality assurance database as well as ICU patient...
- 8
- 338
- 0
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx
Ngày tải lên :
08/03/2014, 09:20
... using a Hewlett Packard G202 5A LD-TOF system mass spectrometer and a- cyano-4-hydroxycinnamic acid as matrix Sample preparation It has been shown that a trifluoroacetic acid pretreatment renders Ab ... of a fluorinated alcohol, hexafluoroisopropanol (HFIP) HFIP has been chosen as a result of a vast exploratory search because it can dissolve Ab-(1–42) better than all other media and, at the same ... (Switzerland) The resin (4-hydroxymethylphenoxyacetic acid) on the polyethyleneglycol/polystyrene support, loaded with Na-Fmoc-Ala (Fmoc-Ala-PAC-PEG-PS) was from Millipore (Waltham, MA, USA) Fmoc-Ala-PACPEG-PS...
- 7
- 624
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
Ngày tải lên :
16/03/2014, 00:20
... FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against multidrug-resistant nosocomial bacterial strains Antimicrob Agents ... permeation/proteome proteome of the target microorganism and no microbial resistance; and (b) the design of potential coadjuvants of those antimicrobial agents that are already available after ... Carlsbad, CA, USA) Egg yolk PG and PE were purchased from Avanti Polar Lipids (Alabaster, AL, USA) FITC-Ds were purchased from Sigma All other chemicals were reagent grade For antimicrobial assays,...
- 18
- 494
- 0
Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx
Ngày tải lên :
16/03/2014, 14:20
... of both starch and pullulan as a substrate Structural comparison of the catalytic site between TVAI and other a- amylases Since pullulan with regular repeats of a- (1,6), a- (1,4), and a- (1,4) glycosidic ... Aspergillus oryzae (TAKA) a- amylase: an application of the simulatedannealing method Acta Crystallog Sect B 47, 535–544 21 Tonozuka T, Sakai H, Ohta T & Sakano Y (1994) A convenient enzymatic synthesis ... Kamitori S, Abe A, Ohtaki A, Kaji A, Tonozuka T & Sakano Y (2002) Crystal structures of Thermoactino˚ myces vulgaris R-47 a- amylase (TVA I) at 1.6 A reso˚ resolution lution and a- amylase (TVA...
- 9
- 342
- 0
Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf
Ngày tải lên :
23/03/2014, 10:20
... EcoRI-T7-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaatttacaaaaaa-BamHI EcoRI-T7-tccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaattt-BamHI EcoRI-T7-aaaaaatccaaaaaaaatct-BamHI EcoRI-T7-tctaaaaaaatcttttaaaaaacccc-BamHI ... EcoRI-T7-tctaaaaaaatcttttaaaaaacccc-BamHI EcoRI-T7-ccccaaaaaaatttacaaaaaatc-BamHI EcoRI-T7-ccccaaaaaaattt-BamHI EcoRI-T7-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaa-BamHI ¨ AARS-4 ¨ AARS-L ¨ AARS-C ¨ AARS-R ¨ AARS-S ... BamHI-gagcgccaggctcac BamHI-aacaagctttacatcggc BamHI-gtggacatcccccttcgg BamHI-gctgctccctatagctcc EarI-catgaaccccagtgcc EarI-catggatgttataaagggc EarI-catgggacgatttaagtct EarI-catggaacagatgaaacaa...
- 13
- 466
- 0
Báo cáo khoa học: Tuberous sclerosis-2 (TSC2) regulates the stability of death-associated protein kinase-1 (DAPK) through a lysosome-dependent degradation pathway doc
Ngày tải lên :
28/03/2014, 23:20
... 12, which then binds to and inactivates mTORC1, leading to an upregulation of autophagy [25] Thus mTORC1 acts as a central regulator balancing anabolic and catabolic pathways within the cell [24] ... a stop codon was introduced at amino acid 1517 using the primers: Fwd 5¢-CGACGAGTC AAACTAGCCAATCCTGCTG-3¢; Rev 5¢-CAGCAGGAT TGGCTAGTTTGACTCGTCG-3¢ Autophagy Apoptosis Fig DAPK and TSC2 form a ... beta, DNA damage, ER-stress and excessive growth factor signaling DAPK also plays a role in survival pathways reflected in its autophagy-signalling activity A substantial amount of research has...
- 17
- 368
- 0
a path with heart - a guide through the perils and promises of spiritual l- jack kornfield
Ngày tải lên :
11/06/2014, 12:01
... absolutely right It takes an egg as well as a sperm to start a Nobel laureate Every one of them has had a mother as well as a father You can say all you want of fathers, but their contribution ... to any practice Instead they have sampled the numerous traditions that are now available in the West They have been initiated by lamas, done Sufi dancing in the mountains, sat a Zen retreat or ... of the self as separate, the heart knows better As one great Indian master, Sri Nisargadatta, put it, The mind creates the abyss, and the heart crosses it.” Many of the great sorrows of the...
- 250
- 467
- 0
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot
Ngày tải lên :
20/06/2014, 01:20
... AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated fragments were electroporated into YEbac102, an E coli DH10B strain ... (5'-aaattctgtgtcaccgcaacaac-3') and UL6-r (5'-gcccgaagcactgactcaa-3') for UL6; UL8-f (5'-cttgctggacgcagagcacta-3') and UL8-r (5'gatttcgcgcaggtgatgag-3') for UL8; and 18S rRNA-f (5'-actcaacacgggaaacctca-3') ... fragment containing a UL7 ORF amplified from the HSV-1 genome by PCR into pBluescript II KS+ (Stratagene) 5'-AGGGCGGGGGCATCGGGCACCGGGATGGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3'...
- 13
- 463
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 1) ppt
Ngày tải lên :
06/07/2014, 20:20
... >0.5 cm in diameter Wheal: A raised, erythematous, edematous papule or plaque, usually representing short-lived vasodilatation and vasopermeability Telangiectasia: A dilated, superficial blood vessel ... focuses on linear erosions overlying an area of erythema and scaling, he or she may incorrectly assume that the erosion is the primary lesion and the redness and scale are secondary, while the correct ... interpretation would be that the patient has a pruritic eczematous dermatitis with erosions caused by scratching Figure 52-1 Superficial spreading melanoma This is the most common type of melanoma...
- 5
- 413
- 0
Báo cáo y học: " High avidity autoreactive T cells with a low signalling capacity through the T-cell receptor: central to rheumatoid arthritis pathogenesis" pot
Ngày tải lên :
09/08/2014, 10:23
... 100:2404-2414 Sakaguchi N, Takahashi T, Hata H, Nomura T, Tagami T, Yamazaki S, Sakihama T, Matsutani T, Negishi I, Nakatsuru S, Sakaguchi S: Altered thymic T-cell selection due to a mutation of the ZAP70 ... H, Iwakabe K, Yahata T, Nishimura S, Ohta A, Ohmi Y, Sato M, Takeda K, Okumura K, Van Kaer L, Kawano T, Taniguchi M, Nishimura T: The natural killer T (NKT) cell ligand alphagalactosylceramide ... whether there are similar (or functionally related) mutations in RA To date, no allelic variants of the human ZAP70 gene have been described in association with RA or in association with any other...
- 9
- 406
- 0