... display as follows A) Relevant information is retrieved and displayed automatically, without user command B) Information is retrieved automatically but displayed only on user command After automatic ... but maintains Japanese grammatical constructions When a user inputs Japanese text, a conversion window of "Eisaku Pen" is automatically popped-up and English equivalents are displayed in the order ... In the first case of translation equivalents and grammatical information retrieval, "Eisaku Pen" automatically retrieves and displays English words equivalent to the input Japanese texts without...
Ngày tải lên: 20/02/2014, 18:20
... supplemental index Search engines not properly index Flash hyperlinks or moving text Try to avoid having flash-based site navigation and a flash-only homepage Avoid using frames because they don’t allow ... that says “digital camera”, even if each one links to the same page Education and Research< /a> Appointments< /a> ... Each page should have a unique description that sells that particular page s content People don’t like surprises, so keep the description relevant to what is on the corresponding page
Ngày tải lên: 28/06/2014, 14:20
Overview of FOCUS: Towards a National Program on Critical Loads Program
... Critical Loads Ad-Hoc Committee (CLAD) NADP sub-committee forum for exchange on CL information (since 2006) Consistent approach to CL calculation and mapping National-scale database ... new datasets Make database publically available FOCUS Work Groups Base Cation Weathering (Work Group A) Leader: Jennifer Phelan Evaluate approaches for estimating mineral weathering rate ... Watmough, Alan VanArsdale, Christine Goodale, Rich Pouyat, Derek Wiggam, Drew Bingham acceptable soil N immobilization (accumulation) denitrification acceptable N leaching rate [NO3-]acc...
Ngày tải lên: 02/07/2014, 12:49
An investigation into the effects of brainstorming and giving a text as model on phan dinh phung high school student's attitude and writing ability
... students at elementary level had writing lesson, they would need the teachers assistance at early stages Using a text as a model has both sides, advantages and disadvantages To begin with its advantages, ... approval the application of giving a text as a model in the future Table 11: The reasons for the disapproval of application of giving a text as a model in the future TABLE OF CONTENTS Page i ACKNOWLEDEGEMENT ... Interactive Approach to Language Pedagory Newyork: Longman Cotton, k (1988) Teaching Composition: Research on Effective Practise Regional Educational Laborratory Doff, A (1998) Teaching English: A...
Ngày tải lên: 18/12/2013, 10:08
Tài liệu Báo cáo khoa học: "Dialog Navigator : A Spoken Dialog Q-A System based on Large Text Knowledge Base" docx
... 2002 “Dialog Navigator” : A Question Answering System based on Large Text Knowledge Base In Proceedings of COLING 2002, pages 460–466 Sadao Kurohashi and Makoto Nagao 1994 A syntactic analysis ... long Japanese sentences based on the detection of conjunctive structures Computational Linguistics, 20(4) A Lee, T Kawahara, and K Shikano 2001 Julius – an open source real-time large vocabulary ... recognition After that, the system retrieves relevant texts in the text knowledge base using each candidate, and makes confirmation based on significance for retrieval Confidence in recognition We...
Ngày tải lên: 20/02/2014, 16:20
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA ... GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT Immunoglobulin domain (type ... Universitat Darmstadt, Germany) was applied at a ¨ concentration of lm GM6001 (Calbiochem, San Diego, CA, USA) was used at a final concentration of 10 lm and phorbol 12-myristate 13-acetate (Sigma,...
Ngày tải lên: 16/03/2014, 04:20
playing for real a text on game theory mar 2007
... paradox of rationality exists Rational players don’t cooperate in the Prisoners’ Dilemma because the conditions necessary for rational cooperation are absent in this game 1.3.3 The Twins Fallacy ... material Ten families herd goats that graze on one square mile of common land The milk a goat gives per day depends on how much grass it gets to eat A goat that grazes on a fraction a of the available ... playing a game with the drivers of the other cars Art lovers at an auction are playing a game with the rival bidders for an old master A firm and a union negotiating next year’s wage contract are playing...
Ngày tải lên: 11/06/2014, 10:14
báo cáo hóa học: " Interleukin-1β and anaphylatoxins exert a synergistic effect on NGF expression by astrocytes" potx
... Sayah S, Patte C, Gasque P, Chan P, Ischenko A, Vaudry H, Fontaine M: Characterization of rat C 5a anaphylatoxin receptor (C5aR): cloning of rat C5aR cDNA and study of C5aR expression by rat astrocytes ... response was specific Thus, the NGF mRNA increase acted via the anaphylatoxins/anaphylatoxin receptors and was not due to contaminants in anaphylatoxin preparations Analysis of NGF mRNA expression ... sense [AGG TGC ATA GCG TAA TGT CC], NGF antisense [CCT TGA CAA AGG TGT GAG TC], GAPDH sense [TGC CAT CAA CGA CCC CTT CA] and GAPDH antisense [TGA CCT TGC CCA CAG CCT TG] The theoretical size was...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Interleukin-1 receptor 1 knockout has no effect on amyloid deposition in Tg2576 mice and does not alter efficacy following Aβ immunotherapy" pot
... SM, Holtzman DM: Peripheral anti -A beta antibody alters CNS and plasma A beta clearance and decreases brain A beta burden in a mouse model of Alzheimer's disease Proc Natl Acad Sci U S A 2001, ... http://www.jneuroinflammation.com/content/3/1/17 mice, coronal sections of each mouse hemibrain were analyzed for changes in immunostained A plaque loads Quantitative image analysis of amyloid plaque burden in all ... indicate that there is the potential of exacerbation of cerebral-amyloid angiopathy (CAA) associated microhemmorhages in certain mouse strains following passive immunization with certain anti -A antibodies...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo hóa học: "An antibacterial coating based on a polymer/solgel hybrid matrix loaded with silver nanoparticles" pdf
... Boonamnuayvitaya V, Tayamanon C, Sae-Ung S, Tanthapanichakoon W: Synthesis and characterization of porous media produced by a sol-gel method Chem Eng Sci 2006, 61:1686-1691 38 Ichinose I, Kawakami ... antibacterial material Microporous Mesoporous Mater 2000, 39:431-444 Park S-J, Jang Y-S: Preparation and characterization of activated carbon fibers supported with silver metal for antibacterial behavior ... Two-level antibacterial coating with both release-killing and contact-killing capabilities Langmuir 2006, 22:9820-9823 36 JIS Z 2801: Japanese Industrial Standard, Japanese Standard Association 2000...
Ngày tải lên: 21/06/2014, 04:20
We have a Web site. Now What? On-Page Search Engine Optimization Practical Advice pptx
... supplemental index Search engines not properly index Flash hyperlinks or moving text Try to avoid having flash-based site navigation and a flash-only homepage Avoid using frames because they don’t allow ... that says “digital camera”, even if each one links to the same page Education and Research< /a> Appointments< /a> ... Each page should have a unique description that sells that particular page s content People don’t like surprises, so keep the description relevant to what is on the corresponding page
Ngày tải lên: 28/06/2014, 19:20
3 V TO 6 V INPUT, 1.5 A OUTPUT SYNCHRONOUS BUCK PWM SWITCHER WITH INTEGRATED FETs (SWIFT) pptx
... PowerPAD to the largest area available Additional areas on the top or bottom layers also help dissipate heat Use any area available when 1.5 -A or greater operation is desired Connect the exposed area ... This Area for Optimum Performance LAYOUT CONSIDERATIONS FOR THERMAL PERFORMANCE For operation at full rated load current, the analog ground plane must provide adequate heat dissipation area A 3-inch-by-3-inch ... without alteration and is accompanied by all associated warranties, conditions, limitations, and notices Reproduction of this information with alteration is an unfair and deceptive business practice...
Ngày tải lên: 24/07/2014, 04:20
Báo cáo khoa học: "Simultaneous in-field boost for patients with 1 to 4 brain metastasis/es treated with volumetric modulated arc therapy: a prospective study on quality-of-life" potx
... parameters was observed at months after VMAT Additional material Additional file 1: Appendix Equations for functional scale, GHS and symptom scales/items scores Abbreviations GPA: Graded Prognostic Assessment; ... metastasis: a multi institutional study Radiat Oncol 2010, 5:13 Harwood AR, Simson WJ: Radiation therapy of cerebral metastases: a randomized prospective clinical trial International journal of radiation ... 71(1):64-70 Casanova N, Mazouni Z, Bieri S, Combescure C, Pica A, Weber DC: Whole brain radiotherapy with a conformational external beam radiation boost for lung cancer patients with 1-3 brain metastasis:...
Ngày tải lên: 09/08/2014, 09:20
Tiết 66: A. MỤC TIÊU: ÔN TẬP HỌC KỲ 2 (TIẾT 1) pot
... học sinh khác làm a) |x| + x = |x| = - x vào Ch a cho học sinh, nhận xét, x0 cho điểm b) x + |x| = 2x x Bài (Tr 89 - SGK) a c a c a c = b d bd bd a c bd a c bd Cho học ... Ch a cho học sinh, nhận xét, cho điểm Chốt: dạng toán TLT Bài (Tr 89 - SGK) Gọi số lãi đơn vị chia a, b, c Vì số lãi tỉ lệ thuận với 2, 3, nên ta có: a b c Tổng số lãi 560 triệu nên: a + ... dãy tỉ số ta có: a b c a bc = 235 560 = =56 10 a = 56 a = 112 Tương tự b = 168; c = 280 Cho học sinh làm (Tr 89 - Một học sinh lên bảng, Bài (Tr 89 - SGK): SGK) Ch a cho học sinh,...
Ngày tải lên: 10/08/2014, 22:20
Báo cáo y học: "Effect of a short-term HAART on SIV load in macaque tissues is dependent on time of initiation and antiviral diffusion" pot
... Statistical analysis Statistical analyses were carried out using Stat View software (SAS institute Inc, Cary, North Carolina, USA) Plasma and cell-associated viral load as well as SIV-RNA, total ... untreated animals at the same stage of infection were used as controls (chronic untreated) Among the HAART treated animals, one (#20929) had undetectable PVL at the initiation of therapy (day 0), ... the same test The correlation between 3TC concentration and residual viral replication /load in tissue, were evaluated using a nonparametric Spearman correlation test Acknowledgements We greatly...
Ngày tải lên: 13/08/2014, 01:20
A supplementary study on zhang ai lings works its history of reception, her film and drama text
... 主要参考资料……………………………………………………………………172 Abstract This thesis analyses Zhang Ailing contributions to the development of Chinese cinema and drama It argues in what ways Zhang Ailing can be seen as a pioneering female playwright It also ... common audience, the representations of details, and audience’ reactions The thesis then continues with both cultural and artistic analyses of Zhang Ailing’s film and drama texts It compares ... the comic narrative style and socially-engaged stance Zhang Ailing adopted in her film and drama texts, showing the playwright Zhang Ailing was very different from the novelist Zhang Ailing who...
Ngày tải lên: 26/09/2015, 10:44
The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro
... Exon6F 5’-GAGATGGTGAAAGAGGTGAAAG-3’ Exon7R 5’-CTCTATATGGGCCTTCTTAATG-3’ Neom_R 5’-GCCAGCTCATTCCTCCACT-3’ Primer pair Exon6F and Exon7R generates a product of 754 base-pairs (bp) on genomic DNA ... (caspase-3, caspase-6 and caspase-7) are effectors of apoptosis Caspase-2, caspase-8, caspase-9 and caspase-10, function upstream of the effector caspases in apoptosis and are known as initiator ... initiator caspases A phylogenetically distinct group of 13 caspases (caspase-1, caspase-4, caspase-5, caspase-11 and caspase-12) activates crucial mediators of innate immunity and inflammation through...
Ngày tải lên: 13/10/2015, 16:41
Tutorial 1 developing a web page
... display the text "Product List" as an h2 heading, centered horizontally on the page What is a presentational attribute?What is a reason for using presentational attributes? What is a reason for avoiding ... text An acronym Plain text Boldfaced text Boklfaced text Big text Larger text A citation Italicized text Program code Fixed width text Deleted text A definition term Italicized text Emphasized content ... paragraphs about Dave's company and its wares Marking Paragraph Elements As you saw earlier, you can mark a paragraph element using the tag where content is the content of the paragraph When...
Ngày tải lên: 30/05/2016, 00:04
A text analysis of “the 2007 commencement speech by bill gates at harvard university ” and “the 2014 commencement speech by bill and melinda gates at stanford university” on the de beaugrande framework
... a major component of their textuality Situationality is the location of a text in a discrete sociocultural context in a real time and place Situationality ―concerns the factors which make a text ... interrogative text) - A text – unlike sentence – is not a grammatical unit but rather a semantic and even a pragmatic one Texture versus Text According to definitions of text, particularly that of Halliday ... Beaugrande and Dressler (1981, p.3) stated, a text is a ―naturally occurring manifestation of language, i.e as a communicative language event in a context The surface text is the set of expressions...
Ngày tải lên: 25/06/2016, 20:56
Báo cáo y học: "Hb J- Meerut [α 120 (H3) Ala -Glu (α1)] In A Turkish Male"
... Yunoki H, Yagi H, Nagashima K, Kuroume T Hb J-Meerut [α120 (H3) Ala ->Glu] found in a Japanese family Hemoglobin 1989; 13(2): 169-175 Yalçin A, Avci F, Beyhan C, Gürgey A, Ural AU A case of Hb ... glutamic acid residue replaced by alanine residue at α120 might interact with the side chain of arginine residue at β 30 of one of the two β chains to form a weak salt bridge, thereby causing a ... 53-55 Molchanova TP, Pobedimskaya DD, Huisman THJ The differencs in quantities of α2- and α1-globin gene variants in heterozygotes Br J Haematol.1994; 88: 300-306 Harano T, Harano K, Imai K, Yunoki...
Ngày tải lên: 02/11/2012, 10:09