1  applying a function to an enumerable

... ELISAs, and guided or performed image analysis, analyzed data and drafted the manuscript LJ performed tissue preparation, immunohistochemistry, image analysisand ELISAs KT carried out ELISAs and ... embedded in paraffin The other hemi-brain was snap frozen and stored at -80°C for biochemical analysis of A Anti -A antibody ELISA Anti -A antibodies in plasma were measured by ELISA as previously ... Unger WW, Jansen W, Wolvers DA, van Halteren AG, Kraal G, Samsom JN: Nasal tolerance induces antigen-specific CD4+CD25regulatory T cells that can transfer their regulatory capacity to naive CD4+...

Ngày tải lên: 19/06/2014, 22:20

... ""; xmlDoc.LoadXml(adoXml); // Create a namespace manager for the XML document XmlNamespaceManager nm = new XmlNamespaceManager(xmlDoc.NameTable); // Add ADO prefixes nm.AddNamespace("s", "uuid:BDC6E3F0-6DA3-11d1 -A2 A3-00AA00C14882"); ... // Load the Orders data into a table in a DataSet DataSet ds = new DataSet( ); SqlDataAdapter da = new SqlDataAdapter(sqlText, ConfigurationSettings.AppSettings["Sql_ConnectString"]); da.Fill(ds, ... schema section and the data section The schema section is required and contains detailed metadata about each column in the table The data section contains an element for each row Column data is stored...

Ngày tải lên: 14/12/2013, 18:16

... (rowCount >= 0) nRows = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection ... the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the names ... = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and rows selected...

Ngày tải lên: 26/01/2014, 10:20

... D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢) and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; forward primer ... (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse primer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPTB-NLD-I D45–47; forward primer ... amino acids) than that of other well characterized bipartite NLSs (Table 1) Searching SWISSPROT and standard databases by PROSITE, and analyzing data deposited at the PredictNLS server (http://maple.bioc...

Ngày tải lên: 18/03/2014, 01:20

... maximum lifespan, as far as we can tell, has not As the twentieth century draws to a close, cardiovascular disease and stroke, cancer and pneumonia account for three-quarters of all human deaths ... of cancer or cardiovascular disease or a genetic disorder—increases an organism's susceptibility to disease and accidental death T h e gradual physical weakening that accompanies aging will make ... understandable, and certainly greatly appreciated But maximum possible lifespan is a mystery that continues to fascinate us T h e causes of human death have changed dramatically during our history as a...

Ngày tải lên: 11/06/2014, 05:26

... radiant with joy On the walls, different patterns of modern paintings were hung: charcoal drawings, pencil drawings and oil paintings were on display Most of them reflect daily activities and ... into a world of imagination and dreams As I strolled through the exhibition halls, I heard the voices of lecturers who were telling the visitors about the artists and their works An oil painting ... brought me back into my happy and peaceful past, full of love and tenderness, among my dear ones Before leaving the exhibition halls, I bought the postcards of my favorite paintings to keep as souvenirs...

Ngày tải lên: 22/07/2014, 04:20

... hỗn hợp (A) gồm chất CaCO 3, MgCO3, Na2CO3, K2CO3 Na2CO3 K2CO3 chiếm a% b% theo khối lượng (A) , biết điều kiện thí nghiệm nung (A) có phản ứng phân hủy CaCO 3, MgCO3 Nung (A) thời gian thu chất ... hỗn hợp (A) gồm chất CaCO 3, MgCO3, Na2CO3, K2CO3 Na2CO3 K2CO3 chiếm a% b% theo khối lượng (4đ) (A) , biết điều kiện thí nghiệm nung (A) có phản ứng phân hủy CaCO3, MgCO3 Nung (A) thời gian thu ... oxit cao (A) , (D) b.Từ phân tử hợp chất quan trọng (A) phân tử hợp chất (D) viết phương trình phản ứng điều chế đơn chất (A) phòng thí nghiệm a Gọi Z, Z/ số proton (A) ,(D)  Z + Z/ = 42 G a sử...

Ngày tải lên: 24/07/2015, 15:35

... hỗn hợp (A) gồm chất CaCO 3, MgCO3, Na2CO3, K2CO3 Na2CO3 K2CO3 chiếm a% b% theo khối lượng (A) , biết điều kiện thí nghiệm nung (A) có phản ứng phân hủy CaCO 3, MgCO3 Nung (A) thời gian thu chất ... hỗn hợp (A) gồm chất CaCO 3, MgCO3, Na2CO3, K2CO3 Na2CO3 K2CO3 chiếm a% b% theo khối lượng (4đ) (A) , biết điều kiện thí nghiệm nung (A) có phản ứng phân hủy CaCO3, MgCO3 Nung (A) thời gian thu ... oxit cao (A) , (D) b.Từ phân tử hợp chất quan trọng (A) phân tử hợp chất (D) viết phương trình phản ứng điều chế đơn chất (A) phòng thí nghiệm a Gọi Z, Z/ số proton (A) ,(D)  Z + Z/ = 42 G a sử...

Ngày tải lên: 24/07/2015, 16:32

... Trung Quốc ph a bắc., ph a tây giáp với Lào Campuchia -Trên biển nước ta tiếp giáp với nước: Trung Quốc, Thái Lan, Campuchia, Malaixia, Xingapo, Inđônêxia, Brunây, Philippin - T a độ đất liền: ... + Khu vực áp cao m a không m a( áp cao đ a cực, áp cao cận chí tuyến thường hoang mạc) -Frông: miền có Frông qua thường có m a nhiều.( FA,FP) -Gió: + Nơi có gió biển ,gió m a m a nhiều + Nơi có ... biện pháp tiến hành cách mạng xanh - Ưu tiên sử dụng giống l a mì l a gạo cao sản vào sản xuất -Tăng cường thủy lợi h a, h a học h a giới h a vào nông nghiệp -Ban hành sách giá lương thực hợp...

Ngày tải lên: 28/07/2015, 07:57

... không giúp nước vượt qua thảm h a thiên tai mà gắn kết phát triển quan hệ hữu nghị, hợp tác quốc gia giới h a bình, tiến phát triển Cơ cấu tổ chức nhà nước Văn Lang - Đứng đầu Vua Hùng, giúp việc ... dược - Mời chuyên viên quân người Đức, Anh sang giúp lục quân, hải quân * Mục đích tổ chức Liên hợp quốc - Duy trì h a bình an ninh giới - Phát triển quan hệ hợp tác, hữu nghị nước sở tôn trọng ... Vàm Cỏ Đông (Vàm Nhật Tảo) (1861) + Khởi ngh a Trương Định Gò Công (1862) - Ở tỉnh miền Tây + Nguyễn Hữu Huân Tân An, Mĩ Tho + Khởi ngh a Phan Tôn, Phan Liêm Bến Tre, Vĩnh Long (1867-1868) + Nguyễn...

Ngày tải lên: 28/07/2015, 07:57

... hưởng thụ quan niệm sống mẻ, tích cực Xuân Diệu năm trước Cách mạng Trong sống nay, quan niệm sống thể giá trị tốt đẹp + Giúp người ý thức thời gian, công việc + Giúp người sống lạc quan, yêu đời ... ĐÀO TẠO LONG AN KÌ THI CHỌN HỌC SINH GIỎI LỚP 12 VÒNG HƯỚNG DẪN CHẤM ĐỀ CHÍNH THỨC MÔN THI: NGỮ VĂN (BẢNG A) NGÀY THI: 06/10/2011 THỜI GIAN: 180 PHÚT (Không kể thời gian phát đề) A YÊU CẦU CHUNG: ... bảo phần nội dung sau: − Đoạn thơ thể cách sống vội vàng, khao khát hưởng thụ hương vị đời − Sống vội vàng, khao khát hưởng thụ hương vị đời cách sống tranh thủ, tận dụng thời gian để tận hưởng...

Ngày tải lên: 28/07/2015, 07:57

... Sở Giáo dục Đào tạo LONG AN -ĐỀ CHÍNH THỨC Kỳ thi chọn học sinh giỏi lớp 12 vòng Ngày thi: 06/10/2011 Môn thi: Tin học bảng A HƯỚNG DẪN CHẤM -Bài ... chạy, nhập điểm a) N M 3125 781250 29296875 11 b) N Con số 3 45890 31250 312501 312500 146484375 146484375 P M 11 P Bài : Thử test Chương trình chạy nhập n, m cho điểm Giải thuật nhanh điểm N M ... nhập n, m cho điểm Giải thuật nhanh điểm N M 15 50 29 100 99 270 200 350 300 Bài 3: Giải thuật nhanh điểm N 20 100 200 k 10 16 15 50 400 m 20 11 13 50 600 i 17 48 121 Điểm 0,5+0,5 0,5+0,5 0,5+0,5...

Ngày tải lên: 28/07/2015, 08:03

... sin x + cos x = ⇔ tan x = − a (2,0 điểm )  Chọn hệ trục t a độ Bxy vuông góc cho tia Bx qua A tia By qua C Ta có: B ( 0;0 ) , A ( 2;0 ) , C ( 0; ) Giả sử M ( x; y )  MA2 + MB = MC 2 ⇔ ( − ... 2GB.GN cos120 ⇔ Vậy AB2 = 148 AB = 37 0,5 0,5 Vậy độ dài trung tuyến lại : ma = 2 AC + AB BC − = 171⇒ ma = 171 Câu a 2,0 điểm (4,0 điểm) * Dễ thấy un > 0, ∀n ∈ N Đáp án Thang điểm 0,5 2 Từ un ... 32011 − 2012 2 Chứng minh được: ( a + b + c ) ≤ ( a + b + c ) = 0,5 Suy ra: a + b + c ≤ ( a + b + c ) ≤ ( a + b + c ) 0,5 (3,0 điểm) 3  a+ b+c  M ≤ ( a + b + c ) + 6abc ≤ +  ÷ ≤ 3   Vậy GTLN M...

Ngày tải lên: 28/07/2015, 08:04

... - Read their answers aloud - Call on Ss to read their answers aloud - Remark and correct mistakes if any - Give correct answers : 1.F ( Ban ad his family had a day trip to their home village ... river bank ) T F ( Liz took a lot of photos to show the trip to her parents ) - Read the text again T and answer the - Ask Ss to read the text again and answer thequestions : questions - Ask Ss to ... of photo to show the trip to her parents - Ask Ss to read all the answers again and copy - Repeat all the correct - Call on some Ss to read the text aloud answers aloud - Correct mistakes...

Ngày tải lên: 03/07/2014, 21:20

... same rate as DNA band number increases Three to five independent processivity assays were performed for each RT and statistical values that include mean, median, standard deviation and maximum and ... (November 15-18, 2009) at Chantilly, Virginia We are also thankful for a travel award to HBC though NIH Antiviral Drug Resistance Symposium to attend Antiviral Drug Resistance 10th Annual Symposium (November ... played an important role initially in the project for designing oligonucleotides for mutagenesis and sequencing, plasmid DNA preparation, transformation in bacteria and transfection in mammalian...

Ngày tải lên: 11/08/2014, 21:21

... 2002 46 Martinez, R., Quintana, K., Navarro, R., Martin, C., Hernandez, M L., Aurrekoetxea, I., Ruiz-Sanz, J I., Lacort, M., and Ruiz-Larrea, M B Pro-oxidant and antioxidant potential of catecholestrogens ... function of activation of the apoptotic death pathway as evidenced by the significant increase in caspase activity, cleavage of the caspase-3 substrate PARP, and appearance of the sub-G1 fraction ... cellular proliferation (14, 44) and inhibits apoptotic signaling (18, 42) A pro-oxidant intracellular milieu is an invariable finding in cancer cells and has been shown to endow cancer cells with a...

Ngày tải lên: 16/09/2015, 17:11

... Descriptive Statistics (includes all cases) 178 Table A6 : Summary of Descriptive Statistics for AREs and CARs 179 Table A7 : ARE and CAR Means and Standard Deviations for No Rationale and Rationale Groups ... requirement SmallCap companies may receive an additional 180 day grace period to achieve compliance Hence, a National Market company may transfer to the Nasdaq SmallCap Market, provided all other ... of Companies in Final Sample by Categories of Book-toMarket Ratios 197 Table A2 5: ARE and CAR Means and Standard Deviations for Different Book -to- Market Ratio Categories 198 Table A2 6a: Longer-Term...

Ngày tải lên: 30/09/2015, 16:58

... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... and humans Some of these human and avian influenza viruses might become adapted to pigs and circulate in that population The cocirculation of the viruses in swine, avian and human populations ... horses, seals, whales, and many types of birds as well as humans This can be a trans-species virus Type B infects only humans [8] Animals act as reservoirs for this influenza virus and Gelbalt [7]...

Ngày tải lên: 02/11/2012, 11:12

Ngày tải lên: 06/11/2012, 10:35

... Vietnam national University, Hanoi College of Foreign Languages Department of Postgraduate Studies A study oF An alternative approach to teaching essay writing to TOEFL learners (Nghiên ... learners (Nghiên cứu Đổi phơng pháp dạy viết Luận cho học viên chứng ToefL) By: Nguyen Thi Chung Mien Supervisor: Do Ba Quy, MA Hanoi, 2005 ...

Ngày tải lên: 06/11/2012, 10:35