... TOPIC Talk about the state of trading shares on Viet Nam stock exchange nowaday? - How does it influence on the economics of Viet Nam? - Topic has two part: I Talk about the state of trading shares ... more accelerating inflation 3 The situation of Viet Nam ‘s stock market today b The rising interest rates is one of causes to decline of the stock market The economic analyst said that the rising ... Viet Nam stock exchange nowaday? - Part 01 includes 04 subjects: Definition The scale of Viet Nam‘s stock market The situation of Viet Nam‘s stock market today Limitation of Viet Nam‘s stock market...
Ngày tải lên: 07/01/2014, 11:13
... Good Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Fair Insufficient On track ... Senegal Bolivia Gambia Vietnam 10 Nepal Equatorial Guinea Ghana India Ethiopia Indonesia 40 Madagascar Malawi Niger Guatemala Brazil Costa Rica Jamaica Chile R =0.61 Czech Republic Singapore Kuwait ... the Code2 (2010) Malawi Madagascar Peru Solomon Islands Bolivia, Plurinational State of Burundi Cambodia Myanmar Rwanda Zambia Papua New Guinea Bangladesh Nepal Egypt Eritrea 95 72 51 75 64 74...
Ngày tải lên: 12/02/2014, 11:20
Tài liệu Developing Culturally and Linguistically Competent Health Education Materials: A Guide for the State of New Jersey ppt
... percent of participants held biologically correct causal models of asthma although 100% reported the use of at least CAM for asthma Biologically based therapies, humoral balance, and prayer were the ... of asthma within the health centers The Asthma Task Force developed medical record documents to facilitate superior asthma care (including an Asthma Test, Asthma Management Plan, and Asthma Action ... practices, and ethnobotanical and other therapies These therapies include prayer, Vick’s VapoRub, siete jarabes, aloe vera juice, and eucalyptus tea The health care practitioner can lower the...
Ngày tải lên: 14/02/2014, 13:20
Tài liệu HOW INTERNET PROTOCOL-ENABLED SERVICES ARE CHANGING THE FACE OF COMMUNICATIONS: A LOOK AT VIDEO AND DATA SERVICES ppt
... be able to easily communicate changes in their signal area They need to easily change and verify their coverage information so that off-air and web broadcasts are ALWAYS identical BENEFITS OF AIR-TO-WEB ... over -the- air broadcasts to American families, and because of the value of localism in broadcasting Localism, a principle underlying the broadcast service since the Radio Act of 1927, serves the ... throughout the Midwest and Southeast United States I am also the chairman of the American Cable Association ACA represents nearly 1,100 smaller and medium-sized independent cable businesses These companies...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx
... substrate S-2444 and measurement of the increase in absorbance at 405 nm The specific inhibitory activity of PAI-1 was calculated from the amount of PAI-1 that had to be added to inhibit 50% of the ... Mab-1 The EC50 values for binding of each variant to Mab-1 or Mab-2 were determined in parallel with the EC50 value for wt and expressed as a fraction of that The means and standard deviations of ... inhibitory activity of any of the variants, and all variants had IC50 values for inactivation by XR5118 indistinguishable from that of wt (data not shown) Whereas wt PAI-1 was totally resistant to...
Ngày tải lên: 20/02/2014, 11:20
Impact of chronic disease on quality of life among the elderly in the state of São Paulo, Brazil: a population-based study pptx
... of the State University of Campinas, Campinas, São Paulo RESULTS The data analyzed came from a total of 958 individuals—929 males and 029 females 60 years of age or more The mean age of the sample ... encompassing the cities of Itapecerica da Serra, Embu, and Taboão da Serra; and the District of Butantã, in the city of São Paulo (13) The state of São Paulo is the most populous in the country and ... in the State of São Paulo from 2001–2002 (São Paulo State Health Survey (ISA-SP)) Sample population The following areas were included in the ISA-SP: the cities of Botucatu and Campinas; an area...
Ngày tải lên: 05/03/2014, 21:20
IN A PERFECT OCEAN THE STATE OF FISHERIES AND ECOSYSTEMS IN THE NORTH ATLANTIC OCEAN pdf
... Sea was the basis of the wealth and importance of the cities that made up the Hanseatic League Because of this fishery, Copenhagen was established and became the Danish capital The Dutch became ... wombats of Australia 50,000 years ago, and the elephant-like mastodons and the sloth of North America about 13,000 years ago The story was similar for large island birds such as the moas of New ... Cataloging-in-Publication Data Pauly, D (Daniel) In a perfect ocean : the state of fisheries and ecosystems in the North Atlantic Ocean / Daniel Pauly and Jay Maclean p cm (The state of the world’s oceans...
Ngày tải lên: 06/03/2014, 18:21
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx
... shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; ... translocation to the nucleus Although functional analyses of individual domains have not been addressed, the global context of the domain analyses allows us to draw a more general picture of the ... DIDO-related apoptosis occurs as a result of alterations in DNA regulation caused by chromatin instability Computational analyses Although all splice variants share common domains, long regions of the...
Ngày tải lên: 07/03/2014, 21:20
Ocean Acidification: A National Strategy to Meet the Challenges of a Changing Ocean docx
... existing data management offices and databases that could support ocean acidification observational and research data The FOARAM Act also calls for an “Ocean Acidification Information Exchange” that ... delineates ambitious priorities and goals for the National Ocean Acidification Program The FOARAM Act calls for the development of a detailed, 10-year strategic plan for the National Ocean Acidification ... contributions of calcite and aragonite, and hence of the organisms 23 Copyright © National Academy of Sciences All rights reserved Ocean Acidification: A National Strategy to Meet the Challenges of a Changing...
Ngày tải lên: 15/03/2014, 15:20
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA ... GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT Immunoglobulin domain (type ... Universitat Darmstadt, Germany) was applied at a ¨ concentration of lm GM6001 (Calbiochem, San Diego, CA, USA) was used at a final concentration of 10 lm and phorbol 12-myristate 13-acetate (Sigma,...
Ngày tải lên: 16/03/2014, 04:20
Measuring and modelling the performance of a parallel ODMG compliant object database server potx
... Muralikrishna M Gamma a high performance dataflow database machine Proceedings of the International Conference on Very Large Data Bases, Kyoto, Japan, August 1986 Morgan Kaufmann: San Mateo, CA, ... performance of various features of database systems The 007 database has been designed to test the performance of object database systems, in particular for analysing the performance of inter-object ... optimization and parallelization are automatic, having as a result an operator tree that represents a query’s evaluation plan Although all of them implement some form of intra-transaction parallelism,...
Ngày tải lên: 17/03/2014, 00:20
explain the role of a concept of the american dream plays in act 1 of millers death of a salesman
Ngày tải lên: 21/03/2014, 22:01
Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf
... (Iwatani, Fukuoka, Japan) All other chemicals used were of analytical grade Formation of a- hydroxyhaem-rHO-1 complex Scheme The resonance structure of a- hydroxyhaem Unless otherwise stated, the ... disappeared, indicates the formation and degradation of a trace amount of the CO-ferrous verdohaem produced from the free a- hydroxyhaem Acidification and extraction of the product into chloroform gave biliverdin, ... Matera et al [26]; the optical spectrum of the ferric form exhibited a rather broad Soret band, whereas the Soret bands of the ferrous and ferrous-CO forms were narrow (Fig 1B) The ratios of the...
Ngày tải lên: 23/03/2014, 21:20
The Confessions of a Caricaturist, Vol. 1 ppt
... camp fire at a great pow-wow in the wigwam of the excellent Savages, alas! remain The old Grecian Theatre in the City Road was the nursery of many members of the theatrical profession, and authors ... with anxiety as to the fluctuations of the Bank rate Be that as it may, I cannot refrain from citing here the case of another brother artist, who was particular in the extreme as regarded the neatness ... to a quick eye and a ready pencil." I can appreciate the fact that at that early age I had an eye for the "pathetic, and even beautiful," but, alas! I have been misunderstood from the day of...
Ngày tải lên: 29/03/2014, 22:20
Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part1 pptx
... Organization The adjutant general is the head of the department and the director of civil defense for the State He is the commanding general of the Hawaii National Guard and responsible for Hawaii ... postaudits of the transactions, accounts, programs, and performance of all departments, offices, and agencies of the State of Hawaii and its political subdivisions Background The Department of ... to the Governor and the Legislature of the State of Hawaii Conducted by The Auditor State of Hawaii and PricewaterhouseCoopers LLP Submitted by THE AUDITOR STATE OF HAWAII Report No 04-06 March...
Ngày tải lên: 18/06/2014, 20:20
Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part2 ppt
... Property and Fiscal Office Engineering Office Hawaii Army National Guard Division Administrative Services Office Hawaii Air National Guard Division Public Affairs Office Quality Office Hawaii State ... certain capital asset costs and the related accumulated depreciation Additionally, the department restated the prior-period capital assets balance to reflect additional capital assets that should ... January 2004 in accordance with auditing standards generally accepted in the United States of America as set forth by the American Institute of Certified Public Accountants and the standards applicable...
Ngày tải lên: 18/06/2014, 20:20
Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part3 ppt
... Independent Auditors’ Report The Auditor State of Hawaii: We have audited the accompanying financial statements of the governmental activities, each major fund, and the aggregate remaining This is trial ... position and the changes in financial position of only that portion of the governmental activities, each major fund, and the aggregate remaining fund information of the State of Hawaii that are attributable ... disclosures in the financial statements An audit also includes assessing the accounting principles used and significant estimates made by management, as well as evaluating the overall financial statement...
Ngày tải lên: 18/06/2014, 20:20