∂q ∂v and the short circuit current at a node

... data as examples and explanatory notes and additional comments on the supplied data In all 15 National Committees gave infomation Information received is listed in table In some cases, average ... Data on typical low- and high-voltage cables The impedances of low- and high-voltage cables depend on national techniques and standards and may be taken from textbooks or the manufacturers data ... recommendations for intem.tiaoal use and they are accepted by the Nationai Committees in that Lwse - 3) In order to promote intemational unification the IEC expressa the wish that ail National Commiaser...

Ngày tải lên: 04/04/2014, 11:57

... Financial Statements and Management’s Discussion and Analysis—for Public Colleges and Universities (GASB), 49–50 Statement 37, Basic Financial Statements and Management’s Discussion and Analysis—for ... Financial Statements and Management’s Discussion and Analysis—for Public Colleges and Universities (Statement 35), 49–50, 274 Basic Financial Statements and Management’s Discussion and Analysis—for ... actuarial accrued liability with the actuarial value of plan assets schedules Explanatory or supplementary state- ments that accompany the balance sheet or other principal statements periodically...

Ngày tải lên: 21/06/2014, 04:20

... was calculated and the data on the temporal distribution of germination was completed Both the data on germination rates and T50 data (the time required to reach 50% of germination) were analysed ... Germination rates at the end of a year of incubation The germination rates of Q robur and Q pyrenaica after a year of incubation are very high: around 85% in Q robur and at 93% in Q pyrenaica (Fig ... caused a delay of weeks, Charcoal caused a delay of weeks and Ash obtained exactly the same value The ANOVAs used to compare the data obtained for both species at the end of a year and at 22 weeks,...

Ngày tải lên: 08/08/2014, 00:22

... Representations of the Symmetric Group, American Journal of Mathematics, vol 60 no 3, pp 761-784, 1938 [Ra] A Ram, A Frobenius formula for the characters of the Hecke algebras, Inventiones Mathematica, ... obtained as linear combinations of the polynomials χλ (q) Remarkably, Ram is also α λ able to show that the polynomials χα (q) may be computed manually by an algorithm that is essentially a q-analog ... 1a1 2a2 · · · k ak a1 !a2 ! · · · ak ! In other words, equation I.5 states that we obtain any character polynomial qµ by the following easy sequential steps: the electronic journal of combinatorics...

Ngày tải lên: 08/08/2014, 01:20

... ta tìm hiểu cấu tạo pin quang điện Solar battery Cells Voltage U0 2,4V 6cm x 6cm, short – circuit current IK < 0,3 2A) 3.1 Cấu tạo pin quang điện Solar battery Cells Voltage U0 6cm, short – circuit ... Low (1x) - Vào menu Options để chọn thời gian trì hoãn thu data (Delayed Start), thời gian tự động dừng thu data sau khoảng thời gian định trƣớc (Automatic Stop) - Các bƣớc tiến hành thí nghiệm ... Voltage U0 6cm x 6cm, short – circuit current IK < 0,3 2A) 2,4V MỤC ĐÍCH Khảo sát đặc tính kỹ thuật cấu tạo pin quang điện (Solar battery Cells Voltage U0 2,4V 6cm x 6cm, short – circuit current...

Ngày tải lên: 22/12/2015, 11:47

... be appreciated The media are important as a source of information on progress in research and innovation: they also draw attention to the balance of advantage and disadvantage We need to make ... implemented by all Member States in a harmonised way and has become the innovation statistics instrument of the Community and a model for non-Member States such as Canada and Australia At present, the survey ... evaluation and peer review of regional and national programmes for enhancing innovation and of the bodies which implement them 2001 At the Union level, the Commission should act as a catalyst and...

Ngày tải lên: 16/01/2014, 16:33

... Wet lands are used for fishing and for gathering crayfish, for growing seasonal crops of rice and maize, and for gathering rattan and roofing materials It was reported that before the clearing ... hand acted as though the land they cleared was neither deeded nor held under customary land, and on the other hand acknowledged that they did not carry out the necessary research and consultations ... clear that they had been informed it was the existing rubber plantation and areas far from the towns that were going to be cleared, not their own farmland, forest land and swamp land They had...

Ngày tải lên: 17/03/2014, 11:20

Ngày tải lên: 22/03/2014, 11:20

... and potassium phosphate as in (A) Relative ATPase activities were calculated by normalizing ATPase activities without preloaded MgADP at each potassium phosphate concentration to 100% The solid ... phosphate As shown in Fig 5A, B, MgATP binding was fast in the absence of phosphate, but slow in the presence of 10 mM phosphate at appropriate MgATP concentrations At 200 nM MgATP, the binding was ... range for thermophilic F1-ATPase activity ATP hydrolysis assay ATP hydrolysis was measured using an ATP-regenerating system as a decrease in A3 40 of NADH at 25 °C The assay mixture contained 50...

Ngày tải lên: 24/03/2014, 00:21

... at a local farm at GOJRA Development of corporate/commercial dairy farms Feeding Table at a local farm (Punjab) Corporate/Commercial Farm A local commercial farm (Punjab) Improvement in animal ... Punjab Burj Attari AI Technicians Training Farm Sarsabz Training Farm for farmer Baluchistan Sindh Sukheki Training Farm for Farmer Chechavatni Zone Khanewal (Farmer trainings) Training at Burj Attari ... Production at a local farm in Punjab Issues with the dairy sector Are the national data of buffalo and cow populations reliable and is the total milk quantity really 34 billion liters per annum??...

Ngày tải lên: 24/03/2014, 04:20

... contralateral knee, the fact that the patients were operated in a relatively short interval of time, the patients were evaluated by an independent unbiased investigator, the evaluation of the standardised ... surgery at the contralateral side, ipsilateral revision operation, ipsilateral posterior cruciate ligament (PCL) or posterolateral corner injury, at the time of the first operation, an abnormal radiograph ... these patients had a combination of medial and lateral meniscal injury, patient had chondral injury grade II, one patient had chondral injury grade III and patients had chondral injury grade IV...

Ngày tải lên: 20/06/2014, 01:20

... Form, Transportation The Local factors (3 D’s) – Kain & Liu (1994) find little evidence of effects Aggregate comuna-level data of density and mode share – Similar analysis at aggregate comuna level ... Ring Road and the Pan American Highway Two Segregated Busways – km segment and ~10 km stretch Differentiated and (in city center) segregated bus stops Metro Lines: 40 kms, 51 stations, 68 trains, ... long-run social contact “externalities” 39 Land Use, Urban Form, Transportation Recent Trends (as seen last week) The migration of the CBD – Providencia, Las Condes, Vitacura (East) – Huechuraba, Quilicura...

Ngày tải lên: 29/06/2014, 04:20

... SERVICE DIGITAL AND TRADITIONAL DESIGN & DEVELOPMENT Website design and development Web application and data gathering backend design, development and management Print collateral design and development ... value in the message itself MEDIA-ENABLED SOCIALIZATION AKA SOCIAL MEDIA The term ‘Social Media’ is backward ‘Social’ should not describe ‘media’, ‘media’ describes the means of socialization Focus ... LOYALTY? PICK ONE STEP WHAT IS YOUR CURRENT RELATIONSHIP WITH YOUR AUDIENCE? WHAT DOES THE TARGET AUDIENCE KNOW ABOUT YOUR PRODUCT? NOTHING AWARE, NO ACTION SINGLE ACTION ADVOCATES REPEATED ACTIONS...

Ngày tải lên: 03/07/2014, 09:44

... condition of the patient as reported by the family and patient was recorded The family as well as the patient were invited to discuss any problems that they encountered during that period and any incidences ... pattern as was used for the family However, while educating patients, the main emphasis was on compliance with pharmacological treatment and the likely benefits of taking medicine as well as advice ... interpersonal and social factors The family and patient are educated about the treatment in detail This component includes information about medication, its side effects and how these can be dealt with,...

Ngày tải lên: 08/08/2014, 23:21

... the stabilization of the chest wall, reducing the pain, improving the ventilation and facilitating the quick healing of the wound Authors Contributions Ceresa Fabrizio and Patane Francesco had written ... written the case report Casablanca Giuseppe had dealt the images All authors read and approved the final manuscript Consent Written informed consent was obtained from the patient of this case report ... treat surgically the chest wall deformities as Pectum excavatum, to stabilize the fractures after severe thoracic trauma or to reconstruct the chest wall after removal of a tumoral mass [3] Each...

Ngày tải lên: 10/08/2014, 09:22

... 27% No data No data No data No data No data No data % mutilated Reynolds and McKee Globalization and Health 2010, 6:21 http://www.globalizationandhealth.com/content/6/1/21 since purchase of younger ... policeman protecting the NAFDAC laboratory was cut to pieces with machetes, the head of NAFDAC survived an assassination attempt in 2003, and arsonists attacked its laboratories and headquarters in 2004 ... Reynolds and McKee Globalization and Health 2010, 6:21 http://www.globalizationandhealth.com/content/6/1/21 for the antimalarial halofantrine, metamizole masquerading as artesunate [33], or diazepam...

Ngày tải lên: 11/08/2014, 14:21

... retracted No regional adenopathy in the axillary and supraclavicular basins was detected Figure Ultrasound evaluation of the lesion Ultrasound evaluation of the lesion A first ultrasound evaluation, ... Discussion The aetiology of lactating adenomas remains unclear; the consensus at this time is that they are tubular adenomas with lactational changes Necrosis and haemorrhage are Page of (page number ... pregnancy, as lobuloalveolar formation and branching of the lactiferous ducts progress, the glandular/fatty tissue ratio in the breast increases A thorough breast examination early in pregnancy...

Ngày tải lên: 11/08/2014, 19:21

... Dependent variables of galactosylation To investigate which factors determine the level of galactosylation multivariate analyses were performed In the multivariate analyses only DAS28 and sulfasalazine ... access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis FG, MW, MS, AD, MH and RD designed the study FG, MW, MS and YM ... improvement and postpartum flare in RA-patients Since IgG galactosylation was associated with sialylation, also sialylation seems to be an additional important modification during pregnancy The levels...

Ngày tải lên: 12/08/2014, 11:22

... income, and other patient outcomes [46-49] These measures incorporate RA activity, in particular RA pain, with cumulative RA effect and damage Bansback et al indicate that that the HAQ is the ‘primary ... in RA is indistinguishable from population normative data No population normative data are available for the HAQ, but its pattern of loss is similar to that of PCS and EQ-5D These data can be ... status, and that pain and difficulty and uncertainty, the burden of RA, may impact measured self-reported health status more than damage Conclusions RA onset caused an immediate and substantial...

Ngày tải lên: 12/08/2014, 11:23

... TTAARTGTTTCAACTGTGGCAAAGAAGA MO187 p24 to env OR 6420 - 6445 CAAGCATGKGTAGCCCAGAYATTATG MO188 p24 to env IF 2034 - 2060 ATGTGGGAARGARGGACACCAAATGAA MO189 p24 to env IR 6335 - 6360 TCCACACAGGTACCCCATAATAGACT ... TCCACACAGGTACCCCATAATAGACT MO191 5’ LTR to gag p24 OR 832 - 859 AATGCTGWRAACATGGGTATTACTTCTG MO192 5’ LTR to gag p24 IR 786 - 814 TCTATTACTTTYACCCATGCATTTAAAGT MO193 env to 3’ LTR IF 7922 - 7944 CAGACCCTTATCCCAAACCCAAC ... 8241-8220 ACCAATTCCACAYACTTGCCCA MO155 env sequencing 8050-8072 CTGGAACKCTAGTTGGAGTAAT MO042 gag p24 OF-1 890-909 TAGTATGGGCAAGCAGGGAG MO024 gag p24 OF-2 508 - 527 AACCCACTGCTTAAGCCTCA MO044 gag p24...

Ngày tải lên: 13/08/2014, 01:20