— not just a tasty treat

... significant financial assistance to a college student, which he was at the time If Jeremy can make a business from a fantasy role-playing card game, it's hard to say what might not make a viable ... At that point, you can say, "Yes, based on the fact that I ran this operation for twenty years and made a living and had a fine time doing it, it appears that I did have what it takes to be a ... Jim and Tatia Rauch had a similar experience "For years we had dreamed about moving to Sedona, Arizona," Jim says "We had vacationed there many, many times in the seven years we have known each...

Ngày tải lên: 01/06/2014, 10:25

... leaf is induced by an array of endogenous factors, such as age and hormonal regulation, as well as by external factors, such as biotic and abiotic stresses It is not known how these signals are ... non-senescent leaves have already been degraded Given that the current database of Arabidopsis ESTs does not represent senescing tissues, it is perhaps not surprising that an additional 100 new genes, not ... identification of leaf senescence-associated genes Plant J 2003, 36:629-642 Andersson A, Keskitalo J, Sjödin A, Bhalerao R, Sterky F, Wissel K, Aspeborg A, Moyle R, Ohmiya Y, Bhalerao R, et al.: A transcriptional...

Ngày tải lên: 09/08/2014, 20:20

... Presse ASDiV Australian Scholarships for Development in Vietnam ASEAN Association of Southeast Asian Nations AusAID Australian Agency for International Development BWTO Beyond World Trade Organization ... international treaties such as Asia-Pacific Economic Cooperation, the ASEAN Free Trade Area and the World Trade Organization (WTO), Vietnam agreed to harmonise its commercial laws with international ... what the law is intended to achieve Policymaking and legal drafting have subsequently not been separated and specialised, which has meant the arguments for drafting particular laws are not always...

Ngày tải lên: 08/08/2015, 19:23

... college debate coach, and a bookseller at a large chain, Dan took a job as a marketing representative in the employee assistance program division of a regional managed-care corporation Dan had never ... communicate about ethics across several domains Chapter addresses work as an important domain of ethical talk The chapter argues that work and the talk about it are unavoidably ethical in nature and ... case, related to us by a colleague At a (re)framing ethics at work 39 business conference in Salt Lake City some years ago, a female African American high-level manager gave a keynote address After...

Ngày tải lên: 18/02/2014, 14:20

... postulated a new classification for them My present efforts are on the creation of a gold standard data set for the extraction task As superlatives are particularly frequent in encyclopaedic language ... Sydney, Australia Bo Pang, Lillian Lee, and Shivakumar Vaithyanathan 2002 Thumbs up? Sentiment classification using machine learning techniques In Proceedings of EMNLP, pages 79-86, Philadelphia, PA, ... occur and which incorporates their semantic properties in an adequate way (semantic role labelling) Finally, for Task 3, I plan to use both manually created rules and machine learning techniques Acknowledgements...

Ngày tải lên: 20/02/2014, 12:20

... there's always enough time to go back and it again I know that you believe that you understand what you think I said, but I am not sure you realize that what you heard is not what I meant If you can ... implementing a plan Having a contingency plan is a must Patience is a virtue Project Management (a. k .a. , the “Whack -a- Mole Role”) What is Project Management? Effectively managing and delivering a project ... Manager Characteristics of an Effective Project Manager Enjoys managing and organizing details Enjoys facilitating communications and working with people Has the ability to communicate with a...

Ngày tải lên: 07/03/2014, 02:20

... of alcohol was classified both as mala in se and mala prohibita The prohibition against intoxication in public was classified as mala in se, inspired by the biblical story of Noah,52 and also as ... securities,47 false notarization of a document,48 and defacing the flag49 are mala prohibita Moreover, the same offenses were classified both as mala in se50 and mala prohibita.51 For instance, driving ... simple idea that unless a man has the capacity and a fair opportunity or chance to adjust his behaviour to the law its penalties ought not be applied to him” 34 ROBERT NOZICK, ANARCHY, STATE, AND UTOPIA...

Ngày tải lên: 07/03/2014, 03:20

... pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC ... 51SufI-BamHI-rv (5¢-ACGCGGATCCAG TCATAAACAGCGGTTGC-3¢, BamHI site underlined), 87SufI-BamHI-rv (5¢-ACGCGGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT ... Tat apparatus FEBS Lett 534, 156–160 Miller, J.H (1992) A short course in bacterial genetics: A laboratory manual and handbook for Escherichia coli and related bacteria Cold Spring Harbor Laboratory...

Ngày tải lên: 07/03/2014, 16:20

... Yashar Mehdad, Matteo Negri, and Marcello Federico 2011 Using bilingual parallel corpora for crosslingual textual entailment In Proc of ACL-11, pages 1336–1345 Rada Mihalcea, Ravi Sinha, and Diana ... from Italian) An API for multilingual WSD BabelNet API BabelNet can be effectively accessed and automatically embedded within applications by means of a programmatic access In order to achieve ... of Navigli and Lapata (2010) At its core, the API leverages an in-house Java library to query paths and create semantic graphs with BabelNet The latter works by pre-computing 69 off-line paths...

Ngày tải lên: 07/03/2014, 18:20

... be cancelled We are not aware of any formalism or computational approach that offers a unified explanation for the cancellability of pragmatic inferences in general, and of no approach that handles ... a logical framework that handles defaults (Reiter, 1980), but this approach is not tractable and it treats natural disjunction as an exclusiveor and implication as logical equivalence Computational ... updated in the future T h a t means that if an interpretation m0 makes an utterance true by assigning to a relation R a defensible status, while another interpretation ml makes the same utterance...

Ngày tải lên: 08/03/2014, 07:20

... mix? — What is the maturity structure of the balance sheet? — What funds are actually available? Is it, for example, at all possible to tap equity and/or debt funding in the capital market and ... example, home loans, commercial real estate loans, loans or promissory notes In principle, everything that yields a predictable and stable cashflow can be used as collateral: all loans that are ... primary and secondary markets are often incapable of gauging and ii) uncertainty about the quality of the (cover) assets, i.e uncertainty about what an investor actually receives in the case of an...

Ngày tải lên: 15/03/2014, 10:20

Ngày tải lên: 17/03/2014, 04:20

... 564 A2 1 Polarization of Electromagnetic Radiation A2 1.1 Introduction A2 1.2 States of Polarization: Monochromatic Radiation A2 1.2.1 Linear polarization A2 1.2.2 Elliptical and circular polarization ... polarization A2 1.2.3 Stokes parameters A2 1.2.4 Stokes parameters for scattered radiation A2 1.3 States of Polarization: Quasi-Monochromatic Radiation A2 1.4 Change of Polarization: Depolarization Ratios, ... to Raman with the remark A scientist painted by a scientist’, Raman answered ‘No, an artist painted by an artist’ A detail of Waterlilies by Claude Monet white lead and lapis-lazuli blue (a) ...

Ngày tải lên: 17/03/2014, 14:46

... nominal reference and temporal constitution In Ivan Sag and Anna Sabolcsi (eds.), Lexical Matters, Chicago University Press, 1991 [Lascarides and Asher, 1991] Alex Lascarides and Nicholas Asher ... a and v This is straightforward enough for the elaboration case We need to consider carefully what it means in a backgrounding case such as (la,le) According to our theoretical analysis, if an ... "patient", as it is thematic roles and not grammatical roles that are important here "thematic relation" between the object and the event has an appropriate property One such property that enables...

Ngày tải lên: 18/03/2014, 02:20

... having a separate general set of rules able to generate a set of acceptable interpretations would significantly alleviate the task of storing and handling semantic information This program, at least ... hand, qua predicates have a set terminal point Assuming that verbal predicates like eat and nominal predicates like bread are (strictly) cumulative, Krifka shows that constructions like to eat ... which lack any initial part I QUANTIZED Intuitively, an event or an object are amorphous when they have no temporal or spatial bounds, and in particular no initial or terminal point Although amorphousness...

Ngày tải lên: 18/03/2014, 02:20

... position, because you could damage your speakers Now fiddle with the volume until you can hear and feel every instrument clearly Also, it¹s best if you can close your eyes and visualize the music ... play on the compact disc player and sit back and listen to your favorite song Turn the volume up; don¹t be afraid Now, turn it up to the ten o¹clock position If there¹s no distortion, only clean ... reading this, you need to get to know your remote control(s) You need to memorize where the mute button is, and where the CD skip, advance, and play are located The two most important buttons...

Ngày tải lên: 21/03/2014, 22:04

... combination therapy to treat 15 patients diagnosed with advanced intracranial malignant brain cancer at the PBH Research Foundation, Kolkata, India The other two authors (S.P and A. S.M.) have performed ... stage of the disease when homeopathic treatment was started in Kolkata, India The patients gradually improved, as indicated by serial computed tomography scans and clinical examinations The major ... culture PATHAK et al: RUTA 6: A NOVEL TREATMENT FOR HUMAN BRAIN CANCER 978 Figure Histograms showing percentages of mitotic index (MI) and normal and abnormal metaphases of human brain cancer and...

Ngày tải lên: 22/03/2014, 17:20

... normal Many small businesses and consumers still struggle to get loans For example, to get a mortgage, a borrower must have a top-notch credit rating and the cash to make a substantial down payment ... Today though, economists in the structural camp argue that the natural rate has risen substantially, largely because of the labor market mismatches I described The idea is that a lot of people are ... War II lows In particular, our purchases of mortgagerelated securities appear to have lowered home loan rates significantly.9 Low mortgage rates have been crucial in stabilizing home sales and...

Ngày tải lên: 23/03/2014, 05:22

... from total RNA was performed using a Reverse Transcription System (Thermoscrip RT, Invitrogen) Human GHR was amplified from cDNA with primers ACACTCAAGAATGGACTCAAG and TGTAAATTGG CTCATCTGAG under ... Human STAT3 was amplified from cDNA with specific primers (STAT3 R: TAGGCGCCTCA GTCGTATCT and STAT3 F: AGCATCGAGCAGCT GACTAC), under the following conditions: denaturation at 95 °C for min, annealing ... Takahashi Y, Shirono H, Arisaka O, Takahashi K, Yagi T, Koga J, Kaji H, Okimura Y, Abe H, Tanaka T & Chihara K (1997) Biologically inactive growth hormone caused by an amino acid substitution J Clin...

Ngày tải lên: 23/03/2014, 10:21

... degrees Place breaded breasts in a glass baking dish coated with oil Bake breasts until cooked though and crumbs are browned, about 15 minutes Top with marinara sauce, mozzarella and parmesan and return ... boil Add the macaroni and cook until tender but firm, about to minutes Drain and transfer to a large bowl Meanwhile, place the frozen squash and milk into a large saucepan and cook over a low heat, ... onions and cook until they are soft and for about minutes Add the garlic and cook for another minute Add tomato sauce, tomato paste, water, vinegar, molasses, pepper and liquid smoke and bring to a...

Ngày tải lên: 23/03/2014, 17:21