4 11 the villus epithelium mirrors the adjacent villus expression pattern cre regulated recombination pattern at adult stages 2 weeks post treatment the recombinant expression pattern marks the stem cells path β actin gfp green and β a
The structure basis for burkholderia pseudomallei hcp induced multinucleated giant cell formation
Ngày tải lên :
10/09/2015, 09:25
... Abbreviations: Ta,, annealing temperature 23 Chapter Materials and Methods Primer (realtime PCR) Gene CACATCCTCGCCTTCAA TCTCGAACTCTTCCATCATCT GTTCCATCGTTCACCAAGTG TTGCAGAAATGTGCTGAATG hcp1 rpoB 2. 1 .2 List ... Table 1: Comparative epidemiology of melioidosis in Southeast Asia and Australia Australia9 Thailand11 Singapore 12 Pahang, Alor Setar, Malaysia13 Malaysia14 No of cases 25 2 22 17 693 135 145 Average ... Hcp1Dn3 GAAATCAAAGGCTCCGCGGGCGCCGCAAACTGG AC 60 Hcp1FH GGCCAGTGCCAAGCTTGCAGATCGTCGTGTCGGA 60 Hcp1RB CGGTACCCGGGGATCCGATCAGCCATTCGTCCAG T 60 TssCRB CGGTACCCGGGGATCCGCGCTTCAGGAAATCGTT 60 Hcp1Q46AE47AF...
- 155
- 1.1K
- 0
Báo cáo khoa học: "The interaction between different types of activated RAW 264.7 cells and macrophage inflammatory protein-1 alpha" potx
Ngày tải lên :
09/08/2014, 09:20
... CTCCCAGCCAGGTGTCATT, and the reverse primer was GGCATTCAGTTCCAGGTCAG The forward primer for b -actin was CCGTGAAAAGATGACCCAG, and the reverse primer was TAGCCACGCTCGGTCAGG The PCR conditions were as ... N-(1-napthyl) ethylenediamine (International Laboratory USA) – each in 2. 5% H3PO4] in a 96-well plate at room temperature for 10 min, and the absorbance at 550 nm was measured with a Multiscan plate ... to the ΔΔCT power Statistical analysis Statistical analyses of data were conducted using oneway analysis of variance (ANOVA) Statistical significance was established at p < 0.05 The software...
- 7
- 380
- 0
Báo cáo khoa học: Ascorbic acid-pretreated quartz enhances cyclo-oxygenase-2 expression in RAW 264.7 murine macrophages pdf
Ngày tải lên :
23/03/2014, 10:20
... was also significantly increased by incubation of the cells with AA-treated and untreated quartz, at all particle Fig NF-jB, pCREB and AP-1 nuclear translocation in quartz-treated RAW 26 4.7 cells ... black bars) as well as AA-treated quartz (Fig 1A, striped bars) The statistical analysis of variance showed a significant difference in COX -2 synthesis both between untreated and AA-treated quartz ... increased in cells incubated with AAtreated or untreated quartz, at all particle concentrations (analysis of variance, P < 0.05) For both the AA-treated and untreated quartz suspensions, the highest...
- 14
- 253
- 0
Báo cáo y học: "Stable expression of a recombinant human antinucleosome antibody to investigate relationships between antibody sequence, binding properties, and pathogenicity" doc
Ngày tải lên :
09/08/2014, 06:23
... Bound antibody was detected by adding goat antihuman IgG alkaline phosphatase conjugate and incubating for hour at 37°C Substrate was added and optical density (OD) at 405 nm was read The true ... additional mice per group were given implants and were killed early, at days 2, 7, and 14 after implantation, to investigate human IgG levels and any pathological changes that might be transient and ... DL and DI participated in the design and coordination of this project AR conceived the study, participated in the design and coordination, and wrote the final paper All the authors participated...
- 13
- 472
- 0
Báo cáo y học: "A randomized, double-blind study of AMG 108 (a fully human monoclonal antibody to IL 1R1) in patients with osteoarthritis of the knee" pdf
Ngày tải lên :
12/08/2014, 17:22
... in the assay Statistical analysis Patient data were analyzed according to randomized treatment arm regardless of actual treatment received during the study The safety dataset included all patients ... (one AMG 108 patient was not evaluable); observed analyses at weeks and 12 include all evaluable patients Panel b, change from baseline, by stratification for pain at baseline dGEMRIC: delayed gadolinium-enhanced ... Donohue, and D Burstein assisted with the acquisition of the data Y-N Sun and L Ni performed data analysis All authors assisted with interpretation of the data, helped to draft and revise the manuscript...
- 30
- 277
- 0
Báo cáo y học: "Identification of signaling components required for the prediction of cytokine release in RAW 264.7 macrophages" pdf
Ngày tải lên :
14/08/2014, 16:21
... activation [10] Given that these minimal models Ligand stimulation Measured pathway Other pathways Cytokine release Figure Schematic representation of the experimental data Schematic representation ... used in which the desired standard deviation is calculated implicitly by utilizing the latent variables of the input data and the standard deviation of the population of output data The procedure ... test data are also included in the training set and the model-reduction procedure is repeated Additional details are provided in Additional data file Matlab code and the data can be obtained...
- 14
- 182
- 0
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot
Ngày tải lên :
08/03/2014, 09:20
... [23 ] The iron saturation of FeC-Tf and Fe2-Tf was also estimated from the ratio of A2 80nm /A4 65nm [23 ] The Yb-Tf solution was prepared by mixing YbCl3 and apo-Tf solutions in a molar ratio of 2. 5 ... apo-Tf, two absorbance bands appeared at 24 2 and 29 2 nm, the characteristic of metal binding to phenolate groups of tyrosine residues at the specific iron bind-sites of apo-Tf The De2 42 increases ... differences in rate constants The almost identical molar absorptivity of e1 and e and approximately the same slope of the k1 and k (Fig 3) suggeststhatthenatureofthefirstkineticphaseofthereaction between...
- 9
- 385
- 0
báo cáo hóa học:"Interdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells" pdf
Ngày tải lên :
18/06/2014, 15:20
... washed, and Ca2+ free buffer containing IgG (panel A) , the CD66ae mAb and CD66b mAb (panel B), the CD66ae mAb and CD66c mAb (panel C), the CD66ae mAb and CD66de mAb (panel D), the CD66b mAb and ... containing the indicated mAb (10 ug/ml final concentration) and 10.8 mM Ca2+ was then added to yield a final physiologic calcium concentration (1.8 mM), and the plates were incubated at 37°C in 5% CO2 ... demonstrated [100] CEACAM1 also appears to play a critical role in tumor lymphangiogenesis [15], and can regulate cell migration via interaction with filamin A [17] CEACAM1 associates with the beta...
- 12
- 599
- 0
báo cáo hóa học: " Human brain endothelial cells endeavor to immunoregulate CD8 T cells via PD-1 ligand expression in multiple sclerosis" pdf
Ngày tải lên :
19/06/2014, 22:20
... transmigration assays; CLP and NA designed the study, analyzed the data and wrote the manuscript; NA secured the funding All authors read and approved the final manuscript Competing interests The ... untreated or stimulated with inflammatory cytokines as indicated and then PD-L1 and PD-L2 expression was determined by qPCR and flow cytometry A Pooled data (n = 4) of PD-L1 and PD-L2 mRNA relative ... Health Research (CIHR) and the Natural Sciences and Engineering Research Council of Canada (#355 722 -20 08) CLP was supported by the Multiple Sclerosis Society of Canada AP and NA hold Donald Paty...
- 12
- 294
- 0
Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot
Ngày tải lên :
10/08/2014, 05:20
... citation purposes) AIDS Research and Therapy 20 08, 5:1 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Martin CH, Kaufman DS: Synergistic use of adult and embryonic stem cells to study human ... 1C and 1D) We also looked for the expression markers during differentiation and figure illustrates CD 1a and CD14 expression at days 0, 3, and 12 At day 0, CD34+ cells expressed neither CD 1a nor ... from hES and FL derived CD34+ cells were stained with CD 1a and HLA-DR, CD 1a and B7.1, and CD 1a and B7 .2 Results showed that hES derived DCs are positive for HLA-DR, B7.1, and B7 .2 surface expression...
- 9
- 261
- 0
Quy trình bảo dưỡng, sữa chữa ô tô con 4-7 chỗ. thiết kế trạm bảo dưỡng, sữa chữa theo tiêu chuẩn
Ngày tải lên :
29/04/2013, 16:30
... 35 Khắc phục S a ch a Thay phớt dầu Thay gioăng S a ch a S a van dầu S a bơm dầu Thay dầu Thay bạc Thay bạc Thay lọc dầu S a ch a van tràn 2. 2.3 HỆ THỐNG LÀM MÁT: Hình 2. 3 Tổng quan hệ thống làm ... Dùng thước đo khe hở đội xupap trục cam Xupap hút: 0.15 – 0 .25 mm (c a xilanh 3, 4) 32 Xupap xả: 0 .25 – 0.35 mm (c a xilanh 2, 4) 2. 2 .2 HỆ THỐNG BÔI TRƠN: Hình 2. 2 Sơ đồ hệ thống bôi trơn I Thông ... 1.000 8.000 4.000 Chạy rà Sau chạy rà Sau s a ch a lớn Chạy rà Sau chạy rà Sau s a ch a lớn Chạy rà Sau chạy rà Sau s a ch a lớn 1 .2. 2 S a ch a: Gồm công việc :Kiểm tra, chẩn đoán, tháo lắp điều...
- 118
- 4.3K
- 56
8 cách đơn giản tăng tốc windows 7
Ngày tải lên :
13/08/2013, 12:04
... ra, tại mụcBase chọn kiểu Decimal, và thiết lập giá trị tại mục Value data Bạn có thể điền một giá trị bất kỳ, quá trình thử nghiệm, 20 0 (0 .2 giây) và số được cho là ... Enter - Tại cư a sổ System Configuration hiện ra, chọn tab Boot và nhấn vào nút Advanced Options… - a nh dấu vào mục Number of processors và chọn số nhân cu a cpu mà máy tính ... kho a WaitToKillServiceTimeout để thay đổi giá trị cu a nó Giá trị mặc định cu a kho a này là 120 00 ( 12 giây, thời gian tối a để tắt các dịch vụ trước shutdown hệ thống), bạn...
- 19
- 440
- 0
cac nguyen to thuoc nhom 7
Ngày tải lên :
11/09/2013, 01:10
... O2 MnO2 bị oxi hoá thành manganat MnO2 + KNO3 + K2CO3 = K2MnO4 + KNO2 + CO2 2MnO2 + O2 + 4KOH = 2K2MnO4 + 2H2O 43 HỢP CHẤT C A MANGAN Hợp chất Mn +7 Kali pemanaganat (KMnO4): tinh thể màu tím ... Clorua vôi điều chế từ khí Cl2 huyền phù đặc Ca(OH )2 đun nóng nhẹ: Cl2 + Ca(OH )2 = CaOCl2 + H2O CaOCl2 không bền, dễ phân huỷ + Trong không khí ẩm : 2CaCl(OCl) + CO2 + H2O = CaCO3 + CaCl2 + 2HClO ... dịch axit MnO + 2H+ = Mn2+ + H2O Tính khử: đun nóng không khí 20 0-3000C t C 2MnO + O2 → 2MnO2 Điều chế: nhiệt phân muối cacbonat oxalat Mn(II) khí H2: 20 0 −300 C MnCO3 → MnO + CO2 MnC2O4...
- 45
- 754
- 2
Essential guide to writing part 7
Ngày tải lên :
20/10/2013, 03:15
... seldom have a clear idea of what grammarians do, and there is an unfortunate confusion about the meaning of the term "grammar" itself W Nelson Francis For more material and information, please visit ... establish coherence All the ideas in a paragraph can relate to the topic yet be poorly arranged Arrangement often inheres in the subject itself A paragraph about baking a cake or preparing to water-ski ... a passage answering the claim that metaphor has no place in prose: For more material and information, please visit www.tailieuduhoc.org IO2 THE EXPOSITORY PARAGRAPH The truth seems that metaphor...
- 15
- 371
- 0
British English A to Z - past 7
Ngày tải lên :
23/10/2013, 13:20
... mashed potatoes Inf Occasionally, creamed potatoes in Britain A pub used to present sausages and mash in the public bar at three shillings and sausages and creamed potatoes in the saloon bar at ... functions as a home-room teacher In all these uses, teacher is gaining in popularity 22 2 match match, n Two sides (teams) play a match, rather than a game, in Britain game match, test See Test Match ... later maths, n matinee coat Also found as matinee jacket math baby coat matron See under sister maximus See under major may, n hawthorn Mayfair, n see comment Used attributively, rather in the...
- 29
- 443
- 0
Đề thi HKI Toán 7-Năm 2010.2011 I m«n to¸n - líp 7
Ngày tải lên :
27/10/2013, 10:11
... gian làm bài: 90 phút Câu 1: Mỗi câu trả lời đợc 0 .25 đ câu đáp án Đ S đ s Câu 2: Mỗi ý đợc 0 .25 đ câu a b c d đáp án a c d b Tự luận: THPT: Mỗi câu 0.5đ a 20 b -36 c Tìm x: Mỗi câu 0.5đ a x= 28 ... Lớp 7A: 35cây + Lớp 7B: 25 + Lớp 7C: 15cây Vẽ hình viết giải thiết, kết luận đúng: 0.5đ a) Chứng minh đợc tam giác ABC = tam giác ADE 0.75đ b) Chứng minh đợc DE//BC c) Chứng minh đợc AF=AC CFEF...
- 2
- 447
- 0
Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc
Ngày tải lên :
23/12/2013, 00:15
... they would tackle a given brief • Press Pack/Kit: a branded pack handed out to the media by an organisation It normally contains background material, photographs, illustrations and news releases ... relevant articles to the respective publications, responding to media enquiries, and providing appropriate information on behalf of an organisation • Messages: agreed words or statements that a ... newsletters and intranets • Logo: A graphic or symbol owned by and representing a company or brand • Media Relations: communicating with the media by pro-actively speaking to journalists and sending...
- 2
- 490
- 0
Tài liệu Thêm Dropbox vào menu Send To trong Windows 7, XP và Vista ppt
Ngày tải lên :
26/01/2014, 04:20
... Vista Đầu tiên, copy đường link sau vào Windows Explorer mục Search menu Start %APPDATA%\Microsoft\Windows\SendTo Nếu bạn có dropbox Favorites, phải chuột vào folder chuyển tới folder Send To Khi ... hệ điều hành Windows XP, vào Control Panel > Folder Options > Show hidden files and folders Chuyển tới C:\Documents and Settings\[User Name]\SendTo (User Name tên máy tính bạn) tạo shortcut cho ... giúp bạn lưu chia sẻ liệu Nếu bạn muốn dễ dàng truy cập ứng dụng này, bạn thêm vào menu Send To menu context Thêm Dropbox vào mục Send To Windows Vista Đầu tiên, copy đường link sau vào Windows...
- 8
- 385
- 0
Tài liệu Human Resources Development Division Head Office, 7, Bhikaiji Cama Place, New Delhi -110607 docx
Ngày tải lên :
16/02/2014, 11:20
... SC/ST/PC category candidates General/OBC/EXSM category candidates For post codes 08 – 10 SC/ST/PC category candidates General/OBC/EXSM category candidates Rs 50/- per candidate (only intimation charges) ... CHANDIGARH 15 CHENNAI 16 DELHI 17 GUWAHATI 18 HYDERABAD 19 10 JAMMU 20 11 JAIPUR 21 12 KOLKATA 22 13 LUCKNOW 23 14 MUMBAI 24 15 PATNA 25 Address of the Circle Office of the Bank located at the Centre ... Tel No 0 522 - 23 04 924 Fax No 0 522 – 23 04 925 Maker Towers,F-wing,7th Floor Cuffe Parade, Mumbai-400005 Tel 022 -22 186405 ,22 161399 Fax- 022 -22 1 521 90, 22 161399 R Block Chanakya Place, Patna-800 001...
- 17
- 347
- 0