β tgf β in cancer tgf β induces apoptosis in lung cells by a smad dependent mechanism
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx
Ngày tải lên :
16/03/2014, 05:20
... ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTCATCGTCTTTGTAGTCCATGG ... of the annealed fragment of the synthesized oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, ... into the XbaI site of pBOS Vector pBOS-Myc and pBOSFlag were constructed similarly by using the synthesized oligonucleotides 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢...
- 9
- 420
- 0
Báo cáo khoa học: "Respiratory compliance but not gas exchange correlates with changes in lung aeration after a recruitment maneuver: an experimental study in pigs with saline lavage lung injury" pptx
Ngày tải lên :
12/08/2014, 22:22
... maximum compliance increase actually increased after recruitment in a nonlinear way (Fig 5d), with a sharp increase beyond an increase in aerated lung >20% If the point of maximum compliance increase ... plateau pressure and static lung compliance correlated equally with nonaerated and poorly aerated lung volumes It appears that in lung injury, VPOOR and VNON are the main determinants in overall ... poorly aerated lung parenchyma (VPOOR)) Note the sharp increase of Pmci beyond 20% increase in aerated lung volume in gas exchange after recruitment are attributed mainly to two basic mechanisms:...
- 12
- 254
- 0
Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"
Ngày tải lên :
31/10/2012, 16:49
... proteolysis and is mutated in a breast cancer cell line Nature 2001;413(6853):316-22 Yada M, Hatakeyama S, Kamura T, Nishiyama M, Tsunematsu R, Imaki H, Ishida N, Okumura F, Nakayama K, Nakayama KI ... regulates Cyclin E levels in Drosophila and is mutated in human cancer cell lines Nature 2001;413(6853):311-6 Perez-Losada J, Mao JH, Balmain A Control of genomic instability and epithelial tumor ... of cyclin E in acute myelogenous leukemia Blood 1997;90(9):3707-13 Rangatia J, Vangala RK, Singh SM, Peer Zada AA, Elsasser A, Kohlmann A, Haferlach T, Tenen DG, Hiddemann W, Behre G Elevated c-Jun...
- 4
- 393
- 0
Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling
Ngày tải lên :
05/09/2013, 09:38
... total bacterial count in the untreated water dropped rapidly at first stage and slowly at second stage in the SC-CO2 treatment and the inactivation rate increased as the temperature increased ... SC-CO2 treatment, whereas phosphatase (alkaline and acid) or naphthol-AS-BI-phosphohydrolase was slightly or a little inactivated Ishikawa et al (1996) reported that enzyme inactivation by the SC-CO2 ... embedded in 1% agar, dehydrated using an ethanol series and embedded in Epon 812 Ultra-thin sections were doubly stained with uranyl acetate and lead nitrate and then examined with a JEM-1200 EX transmission...
- 10
- 451
- 1
Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt
Ngày tải lên :
22/02/2014, 07:20
... signalling pathways Many FcRs and their associated b and c-chains bind to each other through the transmembrane domain resulting in a receptor complex that is able to signal inside the cell The nature ... related PIR -A and Fca-receptor [5,9] and suggests that, in cell lines, the FcR c-chain is acting as a signalling and stabilizing subunit for some receptors, such as FcaR, but only as a signalling ... stimulated or not with PMA for 24 h GPVI was a nity-precipitated using convulxin and detected by ligand blotting as a band of 55 kDa Additional bands of lower molecular mass are indicated The associated...
- 10
- 506
- 0
Báo cáo khoa học: Recombinant bovine zona pellucida glycoproteins ZP3 and ZP4 coexpressed in Sf9 cells form a sperm-binding active hetero-complex ppt
Ngày tải lên :
07/03/2014, 05:20
... (lane in each panel) The rZP3 and rZP3FLAG bands are indicated by arrowheads in (A) , (B), and (C) The rZP4 band is indicated by an arrow in (A) and (B) The ZP4182)464 band is indicated by an asterisk ... were also recognized by GNA and LCA Molecular mass markers are indicated in kDa on the left of each panel candatus agglutinin (ACA) (data not shown) In contrast, all tested lectins recognized native ... LC ⁄ MS analysis of pyridylaminated chains was commercially performed by the Asahi KASEI Analysis & Simulation Center (Fuji, Japan) Pyridylaminated chains were separated using Asahipak NH2P-50...
- 16
- 346
- 0
Báo cáo khoa học: Efficient inhibition of b-secretase gene expression in HEK293 cells by tRNAVal-driven and CTE-helicase associated hammerhead ribozymes doc
Ngày tải lên :
08/03/2014, 08:20
... toward cleavage of the GUC665 containing sequence) is 5¢-CGGTTCGAAACCGGGCACTACAAA AACCAACTTTGCCCTGCCCCCTGATGAGGCCGA AAGGCCGAAACTTGCCCCTGGTACCCCGGATAT CTTTTTTTCTATCGCGTCGACCT-3¢ and the template ... template encoding Rz-2 (targeted toward CUC825 containing sequence) is 5¢-CGGTTCGAAACCGGGCACTACAAA AACCAACTTTCACCCTTCCGCTGATGAGGCCGA AAGGCCGAAAGGTCCCGGTGGTACCCCGGATA TCTTTTTTTCTATCGCGTCGACCT-3¢ The ... Kuwabara, T., Warashina, M., Toda, H & Taira, K (2001) Relationships between the activities in vitro and in vivo of various kinds of ribozyme and their intracellular localization in mammalian cells...
- 9
- 434
- 0
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc
Ngày tải lên :
16/03/2014, 04:20
... nonproductive binding mode Our data indicate an important role for the interactions between the CoA substrate sulfur group and the thiolase active site in assuring an optimal affinity, as well as a competent ... terminal sulfur atom of CoA are listed in Table and shown in Fig Apart from the sulfur-containing residues Cys89, Met157, Met288 and Cys378, these also include side chain atoms of Ala318 and ... binding energy to favour a similar mode of binding for Ac-OPP and Ac-CoA Binding mode of CoA to thiolases oxidized or acetylated at Cys89 The structure of CoA-complexed Z ramigera thiolase, in...
- 13
- 472
- 0
Báo cáo khoa học: Mitochondrial biogenesis in mtDNA-depleted cells involves a Ca2+-dependent pathway and a reduced mitochondrial protein import pdf
Ngày tải lên :
23/03/2014, 15:21
... 5Â-GGCTGAGACAAGAA ACGCTGTAT-3Â, TBP sense 5Â-CCTCACAGGTCAAAG GTTTACAGTAC-3Â, antisense 5Â-GCTGAGGTTGCAG GAATTGAA-3Â) PCR amplications were denaturation at 95C for 15 s, annealing at 60C for and polymerization ... induced by mitochondrial dysfunction is a new signaling pathway that impairs cell proliferation EMBO J 21, 5363 38 Biswas G, Adebanjo OA, Freedman BD, Anandatheerthavarada HK, Vijayasarathy C, Zaidi ... mitochondria, membrane potential was eliminated by treatment with lm valinomycin before the import assay and the values subtracted from each test Colorimetric DNA binding assay To assess the DNA binding...
- 25
- 485
- 0
Báo cáo Y học: Identification and characterization of a novel activated RhoB binding protein containing a PDZ domain whose expression is specifically modulated in thyroid cells by cAMP pot
Ngày tải lên :
23/03/2014, 21:20
... Rho-associated kinase, a novel serine/threonine kinase, as a putative target for small GTP binding protein Rho EMBO J 15, 2208–2216 Nakagawa, O., Fujisawa, K., Ishizaki, T., Saito, Y., Nakao, ... rho-binding domain J Biol Chem 271, 13556–13560 15 Ishizaki, T., Maekawa, M., Fujisawa, K., Okawa, K., Iwamatsu, A. , Fujita, A. , Watanabe, N., Saito, Y., Kakizuka, A. , Morii, N & Narumiya, S (1996) ... (1977) Analysis of singleand double-stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange Proc Natl Acad Sci USA 74, 4835–4838 Savonet, V., Maenhaut, C.,...
- 9
- 394
- 0
Báo cáo khoa học: Deviation of the neurosporaxanthin pathway towards b-carotene biosynthesis in Fusarium fujikuroi by a point mutation in the phytoene desaturase gene ppt
Ngày tải lên :
30/03/2014, 01:20
... fragments obtained with primers CarBG-2F (5¢-TGGGCGAGCTCATGAGCGACATTAAGAA ATCTG-3¢) and CarBG-3R (5¢-CGCTCAGAACGACA CCGTTTG-3¢) The presence of the carB36 mutation was checked using a FokI (Takara ... Paisley, UK) following the manufacturer’s instructions Two microlitres of cDNA were used for the amplification of carB using the primers 5¢-ATGAGCGACATTAAGAA ATCTG-3¢ and 5¢-CTAATTCGCAGCAATGACAAG-3¢ ... Normalization and quantification were performed using an internal a- tocopherol acetate standard according to Hoa et al [69] Carotenoid amounts were calculated according to a b-carotene standard curve Peaks...
- 16
- 440
- 0
Báo cáo khoa học: DYRK1A phosphorylates caspase 9 at an inhibitory site and is potently inhibited in human cells by harmine pptx
Ngày tải lên :
30/03/2014, 02:20
... 5¢-GAAAUUGACUCGCUCAUUGrUrU-3¢, 5¢-ACACGG AGAUGAAGUACUArUrU-3¢, 5¢-GCCAGAGGAUCUA CCAGUArUrU-3¢, 5¢-GCACAUCAAUGAGGUAUACr UrU-3¢ Single siRNA duplexes were synthesized by MWG (Martinsried, Germany) ... 9(C28 7A) as a substrate Active DYRK 1A produced in bacteria catalysed the incorporation of radiolabelled phosphate into caspase 9, whereas a caspase mutant in which Thr125 was mutated to alanine ... His6–caspase 9(T12 5A) (both containing the catalytically inactivating C28 7A mutation) was incubated with recombinant DYRK 1A in the presence of [32P]ATP[cP] as indicated Samples were analysed by SDS...
- 13
- 317
- 0
Báo cáo khoa học: Transient increase of the labile iron pool in HepG2 cells by intravenous iron preparations Brigitte Sturm, Hans Goldenberg and Barbara Scheiber-Mojdehkar doc
Ngày tải lên :
31/03/2014, 07:20
... 1743–1745 Besarab, A (1999) Parenteral Iron Therapy: Safety and Efficacy Seminars Dialysis 12, 237–242 Besarab, A. , Frinak, S & Yee, J (1999) An indistinct balance: The safety and efficacy of parenteral iron ... monolayer was then washed free of excess calcein-AM and reincubated with DMEM containing 20 mM Hepes and a fluorescence-quenching anti-calcein Ig that was added to eliminate all extracellular fluorescence ... pancreatic fibrosis, cancer or myocardial infarction); (b) increased incidence of infections and (c) increased free radical generation from free iron causing increased oxidantmediated tissue injury...
- 8
- 501
- 0
Báo cáo hóa học: " Updated survivals and prognostic factor analysis in myeloma treated by a staged approach use of bortezomib/thalidomide/dexamethasone in transplant eligible patients" pot
Ngày tải lên :
18/06/2014, 16:20
... IgG/lambda from free lambda) One developed a double IgG/kappa from a single IgG/kappa, and two patients had complete change of paraprotein (one from IgA/kappa to IgG kappa, and one from IgD/lambda ... appearance of a new paraprotein persisting for ≥ weeks, was demonstrated in six patients [5] Three patients with light chain myeloma developed a IgG paraprotein (two IgG/kappa from free kappa, ... protocol was approved by the institution review board in accordance with the Declaration of Helsinki, and informed consent was obtained from all participating patients The treatment algorithm was shown...
- 7
- 489
- 0
báo cáo hóa học: " Activation of microglial NADPH oxidase is synergistic with glial iNOS expression in inducing neuronal death: a dual-key mechanism of inflammatory neurodegeneration" docx
Ngày tải lên :
19/06/2014, 22:20
... Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's disease brains Biochem ... Statistical analysis Data are expressed as mean ± SEM and were analysed for significance using ANOVA Results Inflammatory activation of glia in neuronal-glial cultures does not lead to substantial death ... of IL- 1β or arachidonic acid (AA) on neuronal survival in the presence of inflammation-activated glia in neuronal-glial Effects of IL- 1β or arachidonic acid (AA) on neuronal survival in the presence...
- 15
- 382
- 0
Báo cáo hóa học: " Subcellular forms and biochemical events triggered in human cells by HCV polyprotein expression from a viral vector" doc
Ngày tải lên :
20/06/2014, 01:20
... (see induced apoptosis in a caspase -dependent manner HCV proteins previous page) HCV proteins induced apoptosis in a caspase -dependent manner A: Extent of apoptosis HeLa cells were infected at ... colon, breast and lung cancer tissues detected using quantitative analysis Cancer Sci 2007, 98:315-320 Nagasaki K, Manabe T, Hanzawa H, Maass N, Tsukada T, Yamaguchi K: Identification of a novel ... Since DNA fragmentation represents a late apoptotic event, we analyzed the activation of effector caspases as a previous stage in the induction of apoptosis Apoptotic caspases are activated by a proteolytic...
- 20
- 621
- 0
Báo cáo toán học: " Measurement of beta amyloid peptides in specific cells using a photo thin-film transistor" pot
Ngày tải lên :
20/06/2014, 20:20
... phosphate-buffered saline, laminin as an extracellular matrix was coated on the channel, and the channel was kept overnight in an incubator at 37°C We prepared HeLa cells for the expression of A ... neurofibrillary tangles have been regarded as the major histopathological hallmarks of AD [5-10] Biologically, more evolved studies examined that A peptides which are incorporated into planar lipid bilayers ... high-efficient amorphous Si [α-Si] layer on a Si/SiO2 substrate A droplet including cells with intra/extracellular A peptides is placed on the laminin-coated sensing area of the p-FET device, which is, after...
- 12
- 690
- 0
Báo cáo y học: "α Does protein kinase R mediate TNF-α- and ceramide-induced increases in expression and activation of matrix metalloproteinases in articular cartilage by a novel mechanism" pps
Ngày tải lên :
09/08/2014, 01:23
... complementary DNAarray technology Arthritis Rheum 2001, 44:2777-2789 Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases ... penicillin and 10 µg/ml streptomycin In vitro cartilage samples Cartilage was taken from the metacarpophalangeal joint of 7-day-old bovine calves within 12 hours of slaughter using a scalpel and ... cartilage α TNF-α and C2-ceramide induce chondrocyte cell death via a mechanism involving PKR The viability of articular cartilage explants after treatments was assessed by quantitatively measuring...
- 10
- 379
- 0