β is selectively blocked in vitro by a competitive excess of hic

Báo cáo y học: " Intermolecular masking of the HIV-1 Rev NLS by the cellular protein HIC: Novel insights into the regulation of Rev nuclear impo" doc

Báo cáo y học: " Intermolecular masking of the HIV-1 Rev NLS by the cellular protein HIC: Novel insights into the regulation of Rev nuclear impo" doc

... Thus, HIC and Rev interact in vivo and in vitro, and this interaction is mediated by the I-mfa domain of HIC and Rev NLS domain HIC selectively interferes with the Rev NLS interaction with importin ... C-terminal domains of HIC and the Inhibitor of MyoD family a (I-mfa) share a high homology (74%) and are essential for their activities [24] HIC acts as a regulator of transcription and interacts ... Recombinant 6×His -HIC at 0.5, or μg was added Rev nuclear signal intensities were analyzed by ImageJ for a minimum of 100 cells and illustrated by box plots Statistical significance analysis was performed...

Ngày tải lên: 13/08/2014, 01:20

13 283 0
Báo cáo khoa học: Initiation of JC virus DNA replication in vitro by human and mouse DNA polymerase a-primase ppt

Báo cáo khoa học: Initiation of JC virus DNA replication in vitro by human and mouse DNA polymerase a-primase ppt

... [a3 2P]dCTP and [a3 2P]dTTP (3000 CiÆmmol)1, AmershamBiosciences) DNA polymerase a- primase was added as indicated The incorporation of radioactive dNMP was measured by acid-precipitation of DNA and scintillation ... Sawa, H., Komagome, R., Orba, Y., Yamada, M., Okada, Y., Ishida, Y., Nishihara, H., Tanaka, S & Nagashima, K (2001) Broad distribution of the JC virus receptor contrasts with a marked cellular ... creatine kinase, 0.25 mgÆmL)1 heat treated BSA, and lCi [a- 32P]dCTP and lCi [a- 32P]dTTP (each 3000 CiÆmmol)1, AmershamBiosciences) Recombinant DNA polymerase a- primase was added as indicated After...

Ngày tải lên: 17/03/2014, 03:20

8 326 0
Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt

Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt

... same promoter fragment The sequences of the oligonucleotides used for these experiments are: Oligo I, 5¢-CAAGGACGTTCGATGCA CTTCCAAAAAACATATAAT-3¢; Oligo II, 5¢-CAAT GTAGTATTAAAAAGTAGTAGTTAAAAGC-3¢; ... Characterization of a calcium/calmodulin protein kinase homologue from maize roots showing light-regulated gravitropism Planta 199, 18–24 20 Takezawa, D., Ramachandiran, S., Paranjape, V & Poovaiah, ... temperature, but not salinity-stimulated kinase level is mediated via a Ca2+/CaM pathway To further confirm that the upregulation of PsCCaMK by NaCl and low temperature is mediated via a Ca2+/CaM...

Ngày tải lên: 18/03/2014, 01:20

12 365 0
Báo cáo khoa học: RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes pptx

Báo cáo khoa học: RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes pptx

... GCCCGATGCCGACAGCA GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCCTTTATACCAGCCTCCCTTGGGCA GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGAGTACTCCAAAACTAATCAATAT GGGAATTAATACGACTCACTATAGGNNNNNAAAAGTTATCAGGCATGCACCT ... GGGAATTAATACGACTCACTATAGGNNNNNAAAAGTTATCAGGCATGCACCT GGGAATTAATACGACTCACTATAGGNNNNNGATAGTCAGCATGTACGCTGGC GGGAATTAATACGACTCACTATAGGNNNNTAAAAGCAACTAGAAATAGCGT GGGAATTAATACGACTCACTATAGGNNNNAGGGGACCTTGCAAGTCCCCTA GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGGTATGCGCTTAGCCTTAGAC ... GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGGTATGCGCTTAGCCTTAGAC GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCCTTTGTACCGACCTCCGCCAA CAGCAGAATGGTTTCACG CAGAAGCTCATCCGGCTG AGCATCACGACGCCGTCA...

Ngày tải lên: 23/03/2014, 11:20

12 334 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

... production, indicating that TS activated a LPS-stimulated signal pathway (Fig 4) PKC is a key kinase in the LPSstimulated signal pathway [30,31] The findings that PKC inhibitors, not PKA inhibitors, inhibited ... RRR -a- Tocopherol (a- T) was kindly provided by Eisai Co (Tokyo, Japan) Other reagents were of the highest grade commercially available Data were expressed as the mean ± standard deviation of at ... of a- tocopherol in smooth muscle cells J Nutr 131, 378S– 381S Badamchian, M., Spangelo, B.L., Bao, Y., Hagiwara, Y., Hagiwara, H., Ueyama, H & Goldstein, A. L (1994) Isolation of a vitamin E analog...

Ngày tải lên: 22/02/2014, 04:20

6 494 0
Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx

Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx

... exchange on eukaryotic initiation factor Nature 296, 93–95 Sudhakar A, Krishnamoorthy T, Jain A, Chatterjee U, Hasnain SE, Kaufman RJ & Ramaiah KV (1999) Serine 48 in initiation factor alpha (eIF2 ... phosphorylation of eIF 2a by Gcn2p upon amino acid starvation leads to an increase in the levels of Gcn4p, which, in turn, transcriptionally activates genes implicated in amino acid biosynthesis [26] ... (referred to as ER stress) [12,13] All eIF 2a- kinases consist of a conserved kinase domain linked to different regulatory domains [14] that allow stress-specific activation and cognate an increase in the...

Ngày tải lên: 07/03/2014, 05:20

11 376 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

... conserved in plant a- amylases, has a role in substrate binding and activity This local region was different in structures of nonplant a- amylases having a longer ba loop which typically contained aromatic ... domain B) from AMY2 (in green) and TAA (in black) The superimpositioning was guided by the catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 ... complexes of inhibitory substrate analogues derived from acarbose and barley a- amylase (AMY2 [16]); and Taka-amylase A (TAA [17]) (A) Stereo view of interactions involving segments of ba loops and...

Ngày tải lên: 31/03/2014, 08:20

14 557 0
Báo cáo hóa học: " Supporting QoS in MANET by a Fuzzy Priority Scheduler and Performance Analysis with Multicast Routing Protocols" docx

Báo cáo hóa học: " Supporting QoS in MANET by a Fuzzy Priority Scheduler and Performance Analysis with Multicast Routing Protocols" docx

... research papers in national and international conferences and 15 research papers in journals He has been awarded the IETE-CDIL Award in September 2000 for his research paper His areas of interest ... remaining hops to traverse can be obtained from packet headers Weighted-distance scheduling gives higher weight to data packets which have shorter geographic distances The remaining distance is ... bytes Data sessions with randomly selected sources and destinations were simulated Each source transmits data packets at a minimum rate of packets/s and a maximum rate of 10 packets/s The traffic...

Ngày tải lên: 23/06/2014, 00:20

11 362 0
The Project Gutenberg EBook of Short Cuts in Figures, by A. Frederick Collins pdf

The Project Gutenberg EBook of Short Cuts in Figures, by A. Frederick Collins pdf

... have a clear idea of what arithmetic is and of the ordinary methods used in calculation To begin with arithmetic means that we take certain numbers we already know about, that is the value of, ... Suppose, by way of illustration, that you have a certain balance in the bank to your credit and you have made, let us say, four checks against it, and that you want to know what the balance is after ... value of two or more numbers This means that in addition we start with an unknown quantity which is made up of two or more known parts and by operating on these parts in a certain way we are able...

Ngày tải lên: 28/06/2014, 19:20

95 383 0
Ultrasonography in In Vitro FertilizationRoger A. PiersonDepartment of Obstetrics, Gynecology pptx

Ultrasonography in In Vitro FertilizationRoger A. PiersonDepartment of Obstetrics, Gynecology pptx

... (bright) signals, and highly variable signals from the follicular fluid Evaluation of the acoustic characteristics indicative of viability and atresia is an active area of research that has profound ... Computer-Assisted Ultrasonographic Imaging of Follicular Development New work in application of computer-assisted image analysis is demonstrating that ultrasound images have the potential to aid in the ... guidance (49) An aspirating needle is introduced through a guide attached to a transvaginal probe and is inserted into first one ovary, then the other, via the vaginal fornices Almost all aspiration...

Ngày tải lên: 05/08/2014, 16:20

26 178 0
Báo cáo khoa học: "In vitro studies on the modification of low-dose hyper-radiosensitivity in prostate cancer cells by incubation with genistein and estradiol" pot

Báo cáo khoa học: "In vitro studies on the modification of low-dose hyper-radiosensitivity in prostate cancer cells by incubation with genistein and estradiol" pot

... KaleidaGraph 3.5 (Synergy Software, Reading, USA) was used Means and standard deviations were calculated for each of the data points; statistical comparison of the survival data was done using ... 70:161-169 Akimoto T, Nonaka T, Ishikawa H, Sakurai H, Saitoh JI, Takahashi T, Mitsuhashi N: Genistein, a tyrosine kinase inhibitor, enhanced radiosensitivity in human esophageal cancer cell lines in vitro: ... of three assays In controls incubated in FCS containing media and in controls incubated in media with FCS-withdrawal there was a induction of p21 expression The same was seen in cells after incubation...

Ngày tải lên: 09/08/2014, 09:22

12 368 0
Báo cáo y học: "Discovering and validating unknown phosphosites from p38 and HuR protein kinases in vitro by Phosphoproteomic and Bioinformatic tools" doc

Báo cáo y học: "Discovering and validating unknown phosphosites from p38 and HuR protein kinases in vitro by Phosphoproteomic and Bioinformatic tools" doc

... These and many other advances will help clinical research investigations, especially in relation to human malignant diseases Materials and methods Statement of ethical approval This study was conducted ... Innovación de Espa a (MICINN) IL, MD PhD is a recipient of a Grant from “Fundación Leucemia & Linfoma de Espa a) JL and AF are MD PhD and hold a tenured position at Spanish National Hospitals Carlos ... was isolated and validated (R.TAVINAASGR.Q) [Identified and validated phosphopeptides using SIMAC coupled to DDNLMS3 are distinguished by the symbol (*)] López et al Journal of Clinical Bioinformatics...

Ngày tải lên: 10/08/2014, 09:22

16 265 0
Báo cáo khoa học:" In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pot

Báo cáo khoa học:" In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pot

... deficient animals [9-11] Several MVA vectored vaccines against infectious diseases and cancers are in various phases of field and clinical trials [12-16] MVA can be genetically modified by recombination ... replicating (Praha) and non-replicating (modified vaccinia virus strain Ankara, MVA) in mammalian cells Acta Virol 2001, 45:243-247 Vanderplasschen A, Pastoret PP: The uses of poxviruses as vectors ... Esteban M, Kraehenbuhl JP, Acha-Orbea H: Tissue distribution of the Ankara strain of vaccinia virus (MVA) after mucosal or systemic administration Arch Virol 2003, 148:827-839 Hanke T, McMichael AJ,...

Ngày tải lên: 12/08/2014, 04:21

13 377 0
Báo cáo khoa học: " In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pps

Báo cáo khoa học: " In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pps

... deficient animals [9-11] Several MVA vectored vaccines against infectious diseases and cancers are in various phases of field and clinical trials [12-16] MVA can be genetically modified by recombination ... replicating (Praha) and non-replicating (modified vaccinia virus strain Ankara, MVA) in mammalian cells Acta Virol 2001, 45:243-247 Vanderplasschen A, Pastoret PP: The uses of poxviruses as vectors ... Esteban M, Kraehenbuhl JP, Acha-Orbea H: Tissue distribution of the Ankara strain of vaccinia virus (MVA) after mucosal or systemic administration Arch Virol 2003, 148:827-839 Hanke T, McMichael AJ,...

Ngày tải lên: 12/08/2014, 04:21

13 294 0
Báo cáo y học: "Distribution of airway narrowing responses across generations and at branching points, assessed in vitro by anatomical optical coherence tomography" docx

Báo cáo y học: "Distribution of airway narrowing responses across generations and at branching points, assessed in vitro by anatomical optical coherence tomography" docx

... of data points available for each individual airway (Pearson’s correlation analysis) Figure Airway narrowing measured in the most distal and proximal airways within the bronchial airway preparation ... decrease in luminal cross sectional area (% CSA) Airway narrowing was increased at more distal locations indicated by positive correlations between narrowing and airway generation in each preparation ... thereby establishing both a spatial and temporal relationship of response The isolated airway preparation was free of parenchymal attachments and had a standardized transmural pressure (pre and afterload)...

Ngày tải lên: 12/08/2014, 14:20

12 297 0
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

... skilled and specialized discipline It concerns with managing and maintaining a mix of factors, both tangible and intangible to attract consumer loyalty (Stobart, 1994) BRAND BRAND Organizational Associations ... of Planning and Investment, Vietnam Chamber of Commerce and Industry, from the Internet, and other sources Data analysis: Qualitative analysis was done for secondary data and primary data collected ... This chapter will review the literature involving building and maintaining brand The chapter will also highlight the importance of branding in the marketplace 2.2 What is a Brand? There are many...

Ngày tải lên: 13/04/2013, 10:29

67 977 0
Tài liệu Báo cáo khoa học: "Exploiting Readymades in Linguistic Creativity: A System Demonstration of the Jigsaw Bard" docx

Tài liệu Báo cáo khoa học: "Exploiting Readymades in Linguistic Creativity: A System Demonstration of the Jigsaw Bard" docx

... that AdjA1 and AdjA2 are mutually reinforcing The combination is indexed on AdjA1+AdjA2 Example: “as dark and sophisticated as a chocolate martini” (3) AdjA NounS where NounS denotes a cultural ... significant practical merit in the realms of text generation and computational creativity Linguistic Readymades Readymades are the result of artistic appropriation, in which an object with cultural ... creative writer is exposed to a constant barrage of linguistic stimuli, any small portion of which can strike a chord as a potential readymade In this casual inspiration phase, the observant writer...

Ngày tải lên: 20/02/2014, 05:20

6 442 0
Tài liệu In Rare Form A Pictorial History of Baseball Evangelist Billy Sunday pptx

Tài liệu In Rare Form A Pictorial History of Baseball Evangelist Billy Sunday pptx

... Sunday Archives, Grace College, Winona Lake, Indiana future business manager of the grand revival campaigns Also from this period are Nell’s oil paintings, a collection of a dozen paintings of various ... 9:02 AM Page 17 year at the Chicago YMCA, few things in his life had made Sunday happier than this release It was the beginning of a road leading toward evangelism Yet with his athletic style and ... before a midseason trade in 1890 to the Philadelphia Phillies in his final season before leaving baseball During his eight-year professional baseball career, he made his mark stealing bases and was...

Ngày tải lên: 21/02/2014, 06:20

169 398 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

... by following the decrease in A4 56 Data analysis Steady-state kinetic data were fitted with the Michaelis– Menten equation using nonlinear least-squares analysis incorporated into the origin software ... purification of MAO A The gene encoding human liver MAO A was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA ACCATGGAGAATCAAGAGAAGGCGAGTATCGCGG ... Inc., Palo Alto, CA, USA) The concentration of benzylamine was typically in the range 0.02–2 mm, and the assay was started by the addition of MAO A to a final concentration of 0.6 lm Michaelis–Menten...

Ngày tải lên: 07/03/2014, 06:20

9 327 0
w