© 2004 by karen c fox and aries keck
Perinatal Mortality Edited by Oliver C. Ezechi and Karen Odberg-Petterson potx
... Edited by Oliver C Ezechi and Karen Odberg-Petterson Published by InTech Janeza Trdine 9, 51000 Rijeka, Croatia Copyright © 2012 InTech All chapters are Open Access distributed under the Creative Commons ... low income countries of sub Saharan Africa and South central Asia are inadequate obstetric and neonatal care, and harmful home care practices, such as the discarding of colostrum, the application ... Battaglia, FC., Lubchenco LO (1967) A practical classification of newborn infants by weight and gestation age Pediatrics, 71, pp 159-170 Berkő, P (1992) A study of the incidence, causes and consequences...
- 156
- 415
- 0
Project Gutenberg''''s Show Business, by William C. Boyd and Lyle G. Boyd pptx
... performances and research They may be modified and printed and given away you may practically ANYTHING with public domain eBooks Redistribution is subject to the trademark license, especially commercial ... copying and distributing Project Gutenberg-tm electronic works to protect the PROJECT GUTENBERG-tm concept and trademark Project Gutenberg is a registered trademark, and may not be used if you charge ... voice!'" THE END Transcriber's Note: This etext was produced from If Worlds of Science Fiction November 1953 Extensive research did not uncover any evidence that the U.S copyright on this publication...
- 84
- 316
- 0
Project Gutenberg''''s Darwin and Modern Science, by A.C. Seward and Others pot
... PROJECT GUTENBERG EBOOK DARWIN AND MODERN SCIENCE *** Produced by Sue Asscher, and David Widger DARWIN AND MODERN SCIENCE ESSAYS IN COMMEMORATION OF THE CENTENARY OF THE BIRTH OF CHARLES DARWIN AND ... PUBLICATION OF "THE ORIGIN OF SPECIES" By A .C Seward and Others "My success as a man of science, whatever this may have amounted to, has been determined, as far as I can judge, by complex and ... Varieties and Species by Natural Means of Selection," communicated to the Linnean Society by Sir Charles Lyell and Sir Joseph Hooker "I was at first very unwilling to consent (to the communication...
- 2,434
- 446
- 0
Tài liệu Báo cáo khoa học: 3T3-L1 adipocyte apoptosis induced by thiazolidinediones is peroxisome proliferator-activated receptor-c-dependent and mediated by the caspase-3-dependent apoptotic pathway doc
... AATCGTGCGTGACATCAAAG-3¢; actin reverse, 5¢-TG TAGTTTCATGGATGCCACAG-3¢; Akt-1 forward, 5¢-A ACGGACTTCGGGCTGTG-3¢; Akt-1 reverse, 5¢-TTGTC CTCCAGCACCTCAGG-3¢; CD36 forward, 5¢-TCCAGC CAATGCCTTTGC-3¢; ... medium and visualized by confocal microscope (Leica TCS SP2 Confocal Microscope System, Leica microsystems, Wetzlar, Germany) Ten microscopic fields were captured for each sample by fluorescence microscopy, ... 5¢-AAAGACA GCTCCTCCTCGAAGGTT-3¢; and aP2 reverse, 5¢-TGA CCAAATCCCCATTTACGC-3¢ Standard curves were generated with 10-fold serial dilutions ranging from ⁄ 10 to ⁄ 10 000 of the reverse transcription...
- 10
- 594
- 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt
... family of cytosolic cysteine proteases, caspases, which are required for many of the morphological changes that occur during apoptosis The mitochondrial release of cytochrome c and second mitochondria-derived ... wondered if Itch expression could procure protection from apoptosis and increase cell survival To verify this, we compared cell survival and caspase activity in control HEK-293T cells, cells overexpressing ... directly induces cell apoptosis by triggering the aggregation of Bax and Bak on mitochondrial membranes, which liberates cytochrome c and activates caspase and the apoptosome [23] Transfection...
- 12
- 718
- 0
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
... STAT3-speci c or could also interact with STAT1 and disrupt its signalling In colorectal carcinoma cells, treatment with IFN -c sensitizes cells to cytotoxic compounds, and can also induce cell death ... JA (2004) P21Cip1 is a critical mediator of the cytotoxic action of thymidylate synthase inhibitors in colorectal carcinoma cells Cancer Res 64, 6296–6303 Bene A, Kurten RC & Chambers TC (2004) ... efficiently killed by the hpST3dODN SW480 cells were also efficiently killed by IFN -c treatment, and this action was counteracted by hpST3dODN, which reduced transcriptional activity and nuclear...
- 11
- 558
- 0
Tài liệu Báo cáo khoa học: The resident endoplasmic reticulum protein, BAP31, associates with c-actin and myosin B heavy chain Analysis by capillary liquid chromatography microelectrospray tandem MS ppt
... formic acid The collected fractions were combined and the peptides were dried in a speed-vac and kept at )20 C until use was achieved by manually excluding tandem mass spectra of poor quality, by ... amino acid sequence analysis of (A) the myosin heavy chain nonmuscle type B (GeneBank accession P35580) and of (B) nonmuscle c- actin (GeneBank accession P02571) by LC-lESI-MS/MS All amino acids ... immunoprecipitation with the antiFlag Ig, however, c- actin could be detected only in the BAP31 immunocomplex In particular, the immunocomplex Fig The pre-apoptotic BAP31 complex specifically recruits c- actin...
- 8
- 376
- 0
Báo cáo khoa học: The ATPase activities of sulfonylurea receptor 2A and sulfonylurea receptor 2B are influenced by the C-terminal 42 amino acids doc
... effects of ATP on Kir6.2, MgATP activated KATP channels containing SUR2B subunits but blocked those composed of SUR2A [6] The current consensus is that channel opening is enhanced by MgADP occupation ... SUR2A, which might also reflect longer occupancy of site by MgADP [5] We therefore conclude that the lower ATP hydrolysis rate of SUR2B is associated with longer occupancy of the MgADP-bound activated ... Park S, Lim BB, Perez-Terzic C, Mer G & Terzic A (2008) Interaction of asymmetric ABCC9-encoded nucleotide binding domains determines KATP channel SUR2A catalytic activity J Proteome Res 7, 1721–1728...
- 9
- 620
- 0
THE ANTHROPOLOGY OF ONLINE COMMUNITIES BY Samuel M.Wilson and Leighton C. Peterson doc
... interdisciplinary, originating many times in communication and media studies, and often called computer-mediated communication (CMC) research These scholars revealed changing communicative practices ... Social Practice Greenwich, CT: Ablex American Anthropological Association 1998 Code of Ethics of the American Anthropological Association http://www.aaanet.org/ committees/ethics/ethcode.htm Anderson ... emerging constructions of individual and collective identity; and the culturally embedded nature of emerging communicative and social practices Recently there have been calls for an ethnographic approach...
- 19
- 658
- 1
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT ... CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled ... halfvelocity constant As we have determined the OmcA and OmcB concentrations present in omcB– and omcA– cells, respectively, and because omcA– omcB– double mutant cells completely lack Fe(III) reductase...
- 11
- 731
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... slow folding in cytochrome C Acc Chem Res 31, 737–744 30 Shastry MCR, Sauder JM & Roder H (1998) Kinetic and structural analysis of submillisecond folding events in cytochrome C Acc Chem Res 31, ... GdmHCl induces a ligand-exchange mechanism Discussion Bacterial cytochromes c2 show a greater diversity in amino acid homology, size and reduction potentials compared to their mitochondrial counterparts ... Prudencio M, Lowe ˆ CE, Ciofi-Baffoni S, Ubbink M & Canters GW (2005) The effects of ligand exchange and mobility on the peroxidase activity of a bacterial cytochrome c upon unfolding Chembiochem...
- 15
- 509
- 0
Báo cáo khoa học: Vanadium-induced apoptosis of HaCaT cells is mediated by c-fos and involves nuclear accumulation of clusterin pptx
... keratinocyte pooled cell lines Generation of the nCLU (C1 20) plasmid and nCLU (C1 20)-expressing HaCaT cells Using speci c primers: (C1 20, HindIII, forward, 5¢-CGAA TTCGCGGAAGCTTCATGTCTGTGGACT-3¢; and ... 3¢-ATCAGATGGATCCTTATCACTCCTCC CGGTGCTTTTTGC-5¢), the C1 20 cDNA encoding for the minimal Ku70-binding domain of nCLU (120 amino acids of the C- terminus) was amplified from the original pACT2– C1 20 ... by immunoblotting Antibodies against cyclin D1 (sc -20044 ), cyclin E (sc-481), E2F1 (sc-251), p21Cip1 ⁄ Waf1 (sc-817, sc-6246), Bcl-2 (sc-509), p27Kip1 (sc-1641, sc-528), c- fos (sc-7202) and CLU...
- 16
- 312
- 0
Báo cáo khoa học: Plant oxylipins: Plant responses to 12-oxo-phytodienoic acid are governed by its specific structural and functional properties ppt
... transgenic tobacco cell culture By contrast, JA–Ile treatment had no detectable effect on the cellular Ca2+ content of the examined cell culture system [44] Although OPDA and JA both contribute ... the biochemical factors accounting for leaf closing and opening directly affect K+ channel activity, thereby modulating turgor pressure in specialized flexor cells [48–50] By analyzing a rice mutant ... evidence that OPDA can act via the SCFCOI1– JAZ–MYC-complex [86] (see minireview by Chini et al [56b]) However, these results suggest that distinct signaling cascades may emerge from the SCFCOI1 complex,...
- 12
- 416
- 0
Báo cáo khoa học: Kinetic deuterium isotope effects for 7-alkoxycoumarin O-dealkylation reactions catalyzed by human cytochromes P450 and in liver microsomes Rate-limiting C-H bond breaking in cytochrome P450 1A2 substrate oxidation pdf
... (1979) Enzymatic Reaction Mechanisms W.H Freeman Co, San Francisco, CA, USA 14 Miwa GT & Lu AYH (1987) Kinetic isotope effects and ‘metabolic switching’ in cytochrome P450-catalyzed reactions Bioessays ... Guengerich FP (1994) Expression of modified human cytochrome P450 1A2 in Escherichia coli: stabilization, purification, spectral characterization, and catalytic activities of the enzyme Arch Biochem ... AG (2002) Characterization by liquid chromatography-nuclear magnetic resonance spectroscopy and liquid chromatography-mass spectrometry of two coupled oxidative-conjugative metabolic pathways...
- 9
- 314
- 0
Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx
... 5¢-CCCGTCCCCACCATGCAGCGCGGCTTCACCGGG-3¢ 5¢-CCCGTCCCCACCATGCGCATCGGCTTCACCGGG-3¢ 5¢-CCCGTCCCCACCATGCGCCAGGGCTTCACCGGG-3¢ 5¢-TAGCGGAACTGCAGCAGCG-3¢ 5¢-CGCTGCTGCGGTTCGCATACTTCCCGCAGGTC-3¢ 5¢-CGCTGCTGCGGTTCCAATACTTCCCGCAGGTC-3¢ 5¢-AGTGTGTTCTTCCTCATCCCCAACGCGGACTTC-3¢ ... developed by Kunkel [14,15] Mutation Primer sequence Method R74I R74Q R75I R75Q R160Q R162A R162Q R266I R266Q R306L R307Q 5¢-CCCGTCCCCACCATGATCCGCGGCTTCACCGGG-3¢ 5¢-CCCGTCCCCACCATGCAGCGCGGCTTCACCGGG-3¢ ... 5¢-CGCTGCTGCGGTTCCAATACTTCCCGCAGGTC-3¢ 5¢-AGTGTGTTCTTCCTCATCCCCAACGCGGACTTC-3¢ 5¢-AGTGTGTTCTTCCTCCAGCCCAACGCGGACTTC-3¢ 5¢-GATGTGCGCAGGATGTTCA-3¢ 5¢-CTTGGATGTCTGGCGGATGTT-3¢ USE USE USE USE Kunkel PCR PCR USE USE Kunkel Kunkel...
- 5
- 462
- 0
Báo cáo khoa học: Expression of heme oxygenase-1 is repressed by interferon-c and induced by hypoxia in human retinal pigment epithelial cells pot
... for the HRE constructs and human Bach1 cDNA, respectively This work was supported in part by Grants-in-Aid for Scienti c Research (B), Scienti c Research (C) , for Exploratory Research, and for Priority ... Ministry of Education, Science, Sports, and Culture of Japan and by the 21st Century COE Program Special Research Grant Ôthe Center for Innovative Therapeutic Development for Common DiseasesÕ ... SmaI/XhoI site of pGL3-Basic vector and lacks the putative HRE site, CACGTG sequence ()44 to )39) D407 cells were transfected with each plasmid DNA, followed by 24-h incubation and harvested The amounts...
- 9
- 420
- 0
Báo cáo Y học: The porcine trophoblastic interferon-c, secreted by a polarized epithelium, has specific structural and biochemical properties potx
... structural, biochemical and functional properties peculiar to trophoblastic porcine IFN -c, by comparison with a natural IFN -c produced by activated porcine leukocytes (LeIFN -c) and a nonglycosylated, ... differences in the molecular structure and/ or biochemical characteristics of TrIFN -c, when compared with leucocyte IFN -c Consequently, the bioavailability or biological activity of TrIFN -c might be changed ... Speci c antiviral activity of TrIFN -c by comparison with other natural and recombinant IFN -c IFN -c origin Cell line Speci c activity (UÆmg)1 IFN -c) MDBK LeIFN -c 1–5 · 10 rGIFN -c 1–5 · 10 rIFN-c...
- 10
- 380
- 0
Báo cáo Y học: Investigations into the mechanisms used by the C-terminal anchors of Escherichia coli penicillin-binding proteins 4, 5, 6 and 6b for membrane interaction ppt
... recorded as 13 and 42 C, respectively, and in each case, the change was accompanied by a concomitant increase in membrane fluidity (Fig 6A,B) In contrast, in the presence of either P4 or P5, ... as a function of temperature (Figs and 6) Control experiments recorded the Tc of both Myr2-PGro and Myr2PCho membranes as 25 C and that of Myr2-PEtn membranes as 47 C (Figs 3A C and 6A )C) In ... placed in a calcium fluoride cuvette, separated by a 12.5-lm thick Teflon spacer and subjected to automatic temperature scans with a heating rate of C min)1 within the temperature range to 60 °C...
- 9
- 472
- 0
network programming .net with c sharp and vb.net 2004
... Asymmetric encryption Using RSA as asymmetric encryption Symmetric encryption 8.6.1 Using 3DES as symmetric encryption 8.7 Piracy protection 8.8 Conclusion Controlling User Access: Authentication and ... Dim callback As AsyncCallback Private Sub btnReadAsync_Click(ByVal sender As _ System.Object, ByVal e As System.EventArgs) _ Handles btnReadAsync.Click OpenFileDialog.ShowDialog() callback = ... fileContents; AsyncCallback callback; private void btnReadAsync_Click(object sender, System.EventArgs e) { openFileDialog.ShowDialog(); 2.2 Streams 23 callback = new AsyncCallback(fs_StateChanged); fs...
- 562
- 2,536
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25