§ 197  voyage data recorder sometimes referred to as a black box

HỘP ĐEN HÀNG HẢI(MARITIME BLACK BOX VOYAGE DATA RECORDER)

HỘP ĐEN HÀNG HẢI(MARITIME BLACK BOX VOYAGE DATA RECORDER)

Ngày tải lên : 26/04/2016, 09:19
... Những yêu cầu việc trang bị VDR tàu thuyền đợc quy định nghị A8 61(20) - Standard for Shipborne Voyage Data Recorder (VDR) nh sau: Để trợ giúp cho việc điều tra tai nạn, tàu tham gia hành hải tuyến ... hiệu khai thác tàu, tránh h hỏng thời tiết đào tạo kỹ thuyền nghệ Khai thác an to n (SAFETY) Việc khai thác an to n tàu điều quan trọng với ngời khai thác tàu, ngời s a ch a, phận khác Khai thác ... đợc hiển thị lại cho ngời khai thác để tránh tai nạn Những ví dụ sau vài ứng dụng (Real time mode): Tránh h hại thời tiết xấu (Heavy Weather Damage Avoidance ) Các containers bị tích tàu bị h hỏng...
  • 14
  • 1.1K
  • 7
VOYAGE DATA RECORDER JRC

VOYAGE DATA RECORDER JRC

Ngày tải lên : 04/05/2016, 12:38
  • 239
  • 230
  • 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

Ngày tải lên : 02/11/2012, 11:12
... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... effective measure we have to combat influenza is isolation and culling of infected fowls as demonstrated by the government of China, Vietnam, and Thailand As human populations continue to increase and ... as a protease to cleave HA which creates a systemic infection as well [1] Taubenberger [1] reported that this transformation was not observed in the1918 strain, or in strains “captured” in nature...
  • 4
  • 520
  • 0
Báo cáo y học: "Incidence of Ocular Zoonoses referred to the Inflammatory and Autoimmune Ocular Diseases Service of the University of Parma - Italy"

Báo cáo y học: "Incidence of Ocular Zoonoses referred to the Inflammatory and Autoimmune Ocular Diseases Service of the University of Parma - Italy"

Ngày tải lên : 03/11/2012, 11:11
... 119 this case the patient had a panuveitis, which recovered only after a combination of medical treatment and surgery, with a final visual acuity of 40% in the affected eye [1] The only case of ... Lyme disease affected a 31 year-old farmer and his ocular manifestations are described in the specific section Figure 1: Geographical location of the province of Parma (Italy) References Mora P, ... province of Parma (Italy) References Mora P, Vecchi M, Barbera L, Toscani M, Orsoni JG Use of systemic cyclosporin A in a case of severe Toxocara uveitis J Infect 2006; 52:159-161 http://www.medsci.org...
  • 2
  • 447
  • 0
Vcd as a stimulating factor to increase the young learners’ time-on-task

Vcd as a stimulating factor to increase the young learners’ time-on-task

Ngày tải lên : 07/11/2012, 14:44
... 2005), he also makes a distinction between task-based teaching and tasksupported teaching The task-based teaching occurs when the teaching is based exclusively on meaning-focus tasks, and the task-supported ... repeat and participate in a single activity The advantages of using VCDs in English class are also clearly understood as shown in the table and chart above One of the most appreciated materials applied ... good or particularly bad Due to data correlation (same hand): As mentioned before, some of the data are correlated The finger data correlations have been overcame of by using the average value 43...
  • 45
  • 516
  • 0
Tài liệu Using the Data Form Wizard to Create a Windows Form phần 1 pdf

Tài liệu Using the Data Form Wizard to Create a Windows Form phần 1 pdf

Ngày tải lên : 24/12/2013, 01:17
... data connection Click the Next button to continue You now log in to the database by specifying the password for the database user You used the sa user when creating the database connection earlier, ... be creating a new DataSet Enter myDataSet as the name for your DataSet, as shown in Figure 6.19 Figure 6.19: Entering the name of the new DataSet Click the Next button to go to the next step ... use the Data Form Wizard to create a form that accesses the Customers and Orders tables in the Northwind database: Select Project ➣ Add New Item Select Data Form Wizard from the Templates section...
  • 5
  • 502
  • 0
Tài liệu Using the Data Form Wizard to Create a Windows Form phần 2 doc

Tài liệu Using the Data Form Wizard to Create a Windows Form phần 2 doc

Ngày tải lên : 24/12/2013, 01:17
... child table are displayed in a DataGrid control o o o o o Cancel All The Cancel All button allows you to undo any changes you've made to the current row Add The Add button allows you to add a new ... forms that access the database Follow these steps to add a label and a text box to your form: Add a label below the Address label in your form Set the Name property for your new label to lblCity ... Data Binding Each text -box control in the upper part of your form is bound to a column in the Customers table using a process known as data binding When a control is bound to a column in a DataSet...
  • 7
  • 444
  • 0
Using eliciting question as a technique to teach english to 11th form pupils

Using eliciting question as a technique to teach english to 11th form pupils

Ngày tải lên : 27/12/2013, 20:26
... to help pupils understand the whole text such as a funny story Example: A tourist visiting a pub was fascinated by a stuffed lions head mounted on a mahogany plaque above a door behind the bar ... play a very important role in every classroom Teachers can create an active learning environment by encouraging students to ask and answer questions Some ideas to make student questions and teacher ... emphasizing less important material Phrase your questions carefully - Phrase your questions so that the task is clear to students Questions such as What about foreign affairs? not often lead to...
  • 42
  • 641
  • 0
Tài liệu Using a Web Service as a Data Source pdf

Tài liệu Using a Web Service as a Data Source pdf

Ngày tải lên : 21/01/2014, 11:20
... "Order_OrderDetails_Relation"; // [WebMethod] public DataSet LoadOrders( ) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT ... OrderDetails table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM [Order Details]", ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); ... between implementing the LoadOrders( )methods to retrieve a DataSet containing the Orders and Order Details data from Northwind as a local class or as a web services class [ Team LiB ] ...
  • 4
  • 369
  • 0
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

Ngày tải lên : 14/02/2014, 18:20
... Searches in databases Using the putative C-terminal domain of C fluminea as a query, sequence databases were searched by blastp and tblastn for the occurrence of domains similar to the P haloplanktis ... et al The species assayed by PCR were the chiton Acantochitona sp (Mollusca, Polyplacophora) and the oyster Crassostrea gigas (Mollusca, Bivalvia) Sequence data were deposited in GenBank (Table ... modular a- amylases G Feller et al Results and Discussion Identification of new modular a- amylases a- Amylases are ubiquitous enzymes hydrolyzing a- 1,4glycosidic bonds of starch and related polysaccharides,...
  • 8
  • 624
  • 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Ngày tải lên : 18/02/2014, 16:20
... Q279E a- galactosidase A residual activity in patient derived cells; thus, galactose was demonstrated to be first active-site-directed pharmacologic chaperone for a lysosomal storage disease Galactose ... ameliorate Gaucher disease 19 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Accelerated transport and maturation of lysosomal alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor Nat Med ... a- galactosidase A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as a possibility in GD Galactose administration increased...
  • 7
  • 507
  • 0
Tài liệu Use of Event Data Recorder (EDR) Technology for Highway Crash Data Analysis doc

Tài liệu Use of Event Data Recorder (EDR) Technology for Highway Crash Data Analysis doc

Ngày tải lên : 19/02/2014, 03:20
... databases included U.S national accident databases, state accident databases, specialized roadside safety databases, and specialized commercial truck accident databases The research team also ... data collection for the accident databases The research team methodically examined existing eleven crash databases and recommended database formats for candidate EDR data element needs The databases ... Data to Accident Databases: Issues and Recommendations 106 4.3.1 Need for Automated Method to Export EDR Data to Accident Databases 106 4.3.2 Recommendation 107 4.4 EDR Data Archival...
  • 210
  • 751
  • 0
Tài liệu Mining Database Structure; Or, How to Build a Data Quality Browser docx

Tài liệu Mining Database Structure; Or, How to Build a Data Quality Browser docx

Ngày tải lên : 19/02/2014, 12:20
... )Ô@e5H$ÂƯ5F@$5@XUƯYÔFd)bFE5jkƯE$@e& Actual q-gram vector distance 0 0.2 0.4 0.6 0.8 1.2 Estimated vs actual q-gram vector distance, 150 sketch samples 5.5.1 Using Multiset Resemblance Actual q-gram vector distance 0 0.2 ... bC$XX5Fp5b$#rCFbFắỳắ(y`Ôắ(ể Actual resemblance 0.2 0.4 0.6 0.8 Q-gram resemblance 0.2 0.4 0.6 0.8 0.2 0.2 Q-gram vector distance Estimated resemblance 0.4 0.6 0.8 0.4 0.6 0.8 1.2 1.4 Estimated vs Actual Q-gram Resemblance, ... Resemblance Actual q-gram vector distance 0 0.2 0.4 0.6 0.8 5.5 Qualitative Experiments 1.2 Estimated vs actual q-gram vector distance, 50 sketch samples ộ ị ỉố #$rỗ ú õ ó ị ổ ọ ĩ ễ í ó õễ í ị ỉ ỉ ò ĩ...
  • 12
  • 581
  • 0
Tài liệu Using Proven Sales Techniques for Selling WorkKeys as a Solution to Business doc

Tài liệu Using Proven Sales Techniques for Selling WorkKeys as a Solution to Business doc

Ngày tải lên : 19/02/2014, 14:20
... friendly manner, graciously and courteously •  That you want to help them •  To see you as the solution to their problem, and not be seen as your problem •  To be treated as mature adults, not as children ... loves and loses and loves again a slyly dashing war profiteer as she struggles to protect her family and beloved plantation A pig raised by sheepdogs, learns to herd sheep with a little help A cynical ... because you get your work done quickly You like to sugarcoat unpleasant experiences and rationalize bad situations into good ones You have a propensity towards narcotic addiction Twisted Apart,...
  • 48
  • 482
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Ngày tải lên : 19/02/2014, 17:20
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...
  • 12
  • 616
  • 0
Tài liệu Data Management Issues Related to Drought Monitoring at Environment Canada pdf

Tài liệu Data Management Issues Related to Drought Monitoring at Environment Canada pdf

Ngày tải lên : 21/02/2014, 21:20
... Near-real time quality control – Incorporating new data elements and other agencies’ data – Use of related data (e.g RADAR) to assist quality control and data completeness – Metadata, access systems ... monitoring in Environment Canada is steadily improving, especially in the area of availability of near-real time data • Improvements in data management are planned in the areas of – Near-real ... Contractors Autostations via 2304 paper form keypunch via COOLTAP …web or IVR Aviation Autostations Manned A datamart with access via web SM via SM via SM via services SMQC is updated twice via daily...
  • 12
  • 303
  • 0
Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx

Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx

Ngày tải lên : 24/02/2014, 18:20
... Kindergarten Association Multicultural Resource Centre, Richmond, Victoria, Australia Milne, R 1997, Marketing Play, Free Kindergarten Association, Richmond, Victoria, Australia Nyakatawa, S and ... English as a Second Language in the Early Years (birth to six years) Babies and toddlers need freedom to explore challenges, to hear their own language and to start hearing and using English Early ... has shown that a number of factors make a difference to the way children approach the learning of a second language and their ability to interact with others These factors include: • social factors...
  • 31
  • 1K
  • 2
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

Ngày tải lên : 05/03/2014, 17:20
... The transducer was affixed to an offset cam to allow it to rotate in a horizontal plane against the bottom of the ultrasound chamber during treatment Ultrasound gel was used to coat the transducer ... breeders served as untreated controls Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered and maintained at - 2.5% isoflurane/oxygen, ... ME7410 transducer only produced MHz ultrasound Treatment apparatus A Plexiglas cylinder was used as the ultrasound chamber (70 mm diameter, 25 mm tall) The bottom of this chamber was a single layer...
  • 15
  • 967
  • 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Ngày tải lên : 06/03/2014, 22:21
... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... enhance PYM-induced caspase activation and subsequent PARP cleavage (F) Effect of CA9 ASO on PYM-induced caspase activation on Tca8113 ⁄ PYM cells The relative activation of caspase shown was calculated...
  • 13
  • 563
  • 0

Xem thêm