start with an explanation of a controversy

 Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved the final manuscript Competing interests The authors...

Ngày tải lên: 25/10/2012, 09:56

6 612 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx

Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx

... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work...

Ngày tải lên: 16/01/2014, 21:20

8 493 0
Tài liệu Báo cáo khoa học: Crystal structure of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase complexed with an analogue of 1,3-bisphospho-D-glyceric acid Selective inhibition by structure-based design docx

Tài liệu Báo cáo khoa học: Crystal structure of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase complexed with an analogue of 1,3-bisphospho-D-glyceric acid Selective inhibition by structure-based design docx

... oligonucleotides: a sense primer 5¢-CAACAAATTTGCATATGACTATT AAAG-3¢ containing an NdeI site (underlined) next to the start codon of the T brucei gGAPDH gene; an antisense primer 5¢-CAGCCAAGCGCCTAGGGAGCGAGA AC-3¢, ... Scientific, San Carlos, CA Ramachandran, G.N., Ramakrishnan, C & Sasisekharan, V (1963) Stereochemistry of polypeptide chain configurations J Mol Biol 7, 95–99 Jakeman, D.L., Ivory, A. J., Williamson, ... Pi mutant (Thr225Ala: 0.4% activity remaining) than the Ps mutant (Thr196Ala: 9% activity remaining) For the trypanosome enzyme, Km for 1,3-BPGA and GAP increased significantly in the Pi mutant;...

Ngày tải lên: 20/02/2014, 02:21

13 589 0
An Explanation of Clean Renewable Energy Bonds docx

An Explanation of Clean Renewable Energy Bonds docx

... than the burning of feedstock coal predominantly available in the marketplace as of January 1, 2003, and is produced in such a manner so as to result in an increase of at least 50% in the market ... including all private and public sources of financing and the status of the applicants’ efforts to secure all such financing The application must also describe the anticipated date of bond issuance, ... financing bond” has the same meaning as set forth in Section 149(f)(4) (A) , and generally means any bond issued as part of an issue more than $5,000,000 of the proceeds of which are reasonably...

Ngày tải lên: 22/03/2014, 18:20

14 245 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo khoa học: Modelling and simulating interleukin-10 production and regulation by macrophages after stimulation with an immunomodulator of parasitic nematodes potx

Báo cáo khoa học: Modelling and simulating interleukin-10 production and regulation by macrophages after stimulation with an immunomodulator of parasitic nematodes potx

... dynamics of Av17 and macrophages and allow refining of the mathematical model that we currently have A mathematical model goes hand in hand with experimental models It is a caricature of reality, and ... topologies of the receptor-stimulated kinase ⁄ phosphatase signalling cascades and analysed key parameters that characterize the signalling pathways (signal amplitude, signalling time, and signal duration) ... than 10 years A parasitic nematode of rodents, Acanthocheilonema viteae, is used as an animal model to study basic questions of host–parasite interaction, e.g host immune responses and parasite...

Ngày tải lên: 29/03/2014, 23:20

16 257 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

... Dutta P, Bhattacharya SK, Krishnan T, Kobayashi N, Naik TN: Genetic variability of human rotavirus strains isolated from Eastern and Northern India J Med Virol 2004, 72:156-161 Rahman M, Sultana ... Podder G, Faruque AS, Matthijnssens J, Zaman K, Breiman RF, Sack DA, Van Ranst M, Azim T: Typing of human rotaviruses: nucleotide mismatches between the VP7 gene and primer are associated with genotyping ... Rotavirus epidemiology and surveillance Novartis Found Symp 2001, 238:125-147 Arista S, Giammanco GM, De Grazia S, Colomba C, Martella V: Genetic variability among serotype G4 Italian human rotaviruses...

Ngày tải lên: 20/06/2014, 01:20

4 329 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_1 docx

Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_1 docx

... king A well-designed suit can make a man look successful, sophisticated, and chic A pinstripe, a favorite of lawyers and investment bankers, can make a small man look tall or a chunky man look ... taste and balance If you work for a conservative company, the classic pearl necklace is a safe choice, or you can wear a larger pearl bead if you want to look more contemporary Also beware of ... for a change The best fragrances are light, and outdoorsy scents are among my favorites If you don’t like or are allergic to fragrances, choose a bath or shower soap with a pleasant aroma I like...

Ngày tải lên: 21/06/2014, 03:20

23 436 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_2 pptx

Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_2 pptx

... men and women who are apples should avoid tight-fitting jeans and pleated pants YY Rectangle If you are a rectangle, you don’t have many curves, and your body shape is more like a straight-up-and-down ... that doesn’t suit your pate, then hair transplants where you can’t see the plugs are another option William Shatner (“Star Trek,” “Boston Legal”) has a good transplant 4 What Kind of Colleague ... record a video of you in a social setting, and when you watch it, pay attention to your expression It might be a rude awakening, but I can’t emphasize enough the importance of having a pleasant facial...

Ngày tải lên: 21/06/2014, 03:20

23 423 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_4 doc

Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_4 doc

... workshops, asking them to identify the most important factor in arriving at first impressions The participants included Caucasians, A ­ frican-Americans, Latinos, and Asians between the ages of 20 and ... it Europeans also eat salads and cheese after their entrée European portions tend to be smaller than Americans are used to, so don’t complain to the waiter at a French restaurant that you were ... hungrily awaiting your arrival 15. True.  Always send a thank-you note after being taken out to a restaurant, whether it is handwritten or an e-mail 16. False.  It is rude to text or speak on a cell...

Ngày tải lên: 21/06/2014, 03:20

23 415 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_5 doc

Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_5 doc

... better to say nothing at all than to hem and haw like a teenager YY Slang You don’t always have to sound like a college professor, but using too much slang can be a verbal crutch Once in a while ... professional image and get your point across quickly and efficiently Remember, e-mails leave a paperless trail and can easily go viral with one quick C an You He ar Me Now?     129 click of ... following words and phrases are some of my favorites: analysis learn answer listen brainstorm manage collaborate offer collaborative open mind confer productive control profitable cooperate reduce...

Ngày tải lên: 21/06/2014, 03:20

23 416 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_6 doc

Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_6 doc

... YY I can lose weight YY I can stop smoking YY I can heal YY I can let go of guilt YY I can gain self-confidence YY I can let go of fear YY I can take risks YY I can change YY I can be a winner ... displaying your fears of abandonment Shake a few times, and then break YY Too many rings Be careful not to wear too many large rings when you are shaking hands (not good business attire anyway), ... informal conversations can lead to an actual job down the road or to a reference for an opening elsewhere They are typically shorter than job interviews, which can last anywhere between an hour and...

Ngày tải lên: 21/06/2014, 03:20

23 391 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_7 pptx

Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_7 pptx

... buzzwords are job titles (sales manager, project manager, network administrator), specific skills (HTML, project management, financial analysis), and education (M.B .A. , B .A. , B.S.) Examples of business ... $50,000 and $70,000,” with the low figure being an amount that is acceptable to you If the salary offered is below what you want, be ready to walk away from the offer if you 176    Change One ... fee That said, it is also important to recruiters not to offer a candidate who will then turn around and refuse the job because of a salary dispute You must be honest with a headhunter about...

Ngày tải lên: 21/06/2014, 03:20

23 286 0
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_8 docx

Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_8 docx

... (magazine), 12 Nail care, 51, 182 Names, appropriate use of, 103, 122 Napkin, proper placement of, 108 Nasal talkers, 124  Inde x National Association to Advance Fat Acceptance (NAAFA), 62 Navy ... concerns about, 16–19 Alcohol at business meals, 107 Alessandra, Tony, 72 Allstate Insurance Company, xiii American dining style, 107 Anderson, Pamela, 69 Anna’s Better Networking Tips, 96–98 Anna’s ... Hart Schaffner Marx Joseph Abboud Boss St John Knits Armani Collezioni Dana Buchman $1,200–$3,500 $1,200–$3,500 Oxford Donna Karan Collection Hickey Freeman Escada Nicky Hilton Burberry Armani...

Ngày tải lên: 21/06/2014, 03:20

18 400 0
Change One Thing: Discover What’s Holding You Back – and Fix It – With the Secrets of a Top Executive Image Consultant_1 ppt

Change One Thing: Discover What’s Holding You Back – and Fix It – With the Secrets of a Top Executive Image Consultant_1 ppt

... develop a personal image— communication skills, organizational savvy, presentation style, and appearance—that reflects who you are and leads to success as a business professional Following her practical ... motivated to make a change Don’t wait for your life to become unbearable Begin your transformation process now! It’s easier and less daunting if you make one small change at a time, rather than attempting ... can be paralyzing, which is why so many people stay in an unhappy job, marriage, or relationship As dissatisfied as we may feel, the same old same old is far more comfortable than going in a...

Ngày tải lên: 21/06/2014, 03:20

23 345 0
Change One Thing Discover Whats Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_3 pptx

Change One Thing Discover Whats Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_3 pptx

... men and women who are apples should avoid tight-fitting jeans and pleated pants YY Rectangle If you are a rectangle, you don’t have many curves, and your body shape is more like a straight-up-and-down ... that doesn’t suit your pate, then hair transplants where you can’t see the plugs are another option William Shatner (“Star Trek,” “Boston Legal”) has a good transplant 4 What Kind of Colleague ... record a video of you in a social setting, and when you watch it, pay attention to your expression It might be a rude awakening, but I can’t emphasize enough the importance of having a pleasant facial...

Ngày tải lên: 21/06/2014, 13:20

23 374 0
Change One Thing Discover Whats Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_4 pdf

Change One Thing Discover Whats Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_4 pdf

... that you were last man or woman standing is another example of a grandstanding ploy that will backfire Remember, it is just as important to be considered a team player and to have the respect of ... people are afraid of making a social faux pas but not realize that making   99  100    Change One Thing others feel bad is the ultimate in bad form—far worse, and more common, than bad table manners ... work are replacing the old-school shake-and-make for casual chatand-chews at a local coffee house These gatherings involve brainstorming, relationship building, and partner hunting and are taking...

Ngày tải lên: 21/06/2014, 13:20

23 422 0
Change One Thing Discover Whats Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_5 potx

Change One Thing Discover Whats Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_5 potx

... workshops, asking them to identify the most important factor in arriving at first impressions The participants included Caucasians, A ­ frican-Americans, Latinos, and Asians between the ages of 20 and ... it Europeans also eat salads and cheese after their entrée European portions tend to be smaller than Americans are used to, so don’t complain to the waiter at a French restaurant that you were ... hungrily awaiting your arrival 15. True.  Always send a thank-you note after being taken out to a restaurant, whether it is handwritten or an e-mail 16. False.  It is rude to text or speak on a cell...

Ngày tải lên: 21/06/2014, 13:20

23 306 0
Change One Thing Discover Whats Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_8 potx

Change One Thing Discover Whats Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_8 potx

... buzzwords are job titles (sales manager, project manager, network administrator), specific skills (HTML, project management, financial analysis), and education (M.B .A. , B .A. , B.S.) Examples of business ... $50,000 and $70,000,” with the low figure being an amount that is acceptable to you If the salary offered is below what you want, be ready to walk away from the offer if you 176    Change One ... fee That said, it is also important to recruiters not to offer a candidate who will then turn around and refuse the job because of a salary dispute You must be honest with a headhunter about...

Ngày tải lên: 21/06/2014, 13:20

23 276 0
Change One Thing Discover Whats Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_9 doc

Change One Thing Discover Whats Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_9 doc

... (magazine), 12 Nail care, 51, 182 Names, appropriate use of, 103, 122 Napkin, proper placement of, 108 Nasal talkers, 124  Inde x National Association to Advance Fat Acceptance (NAAFA), 62 Navy ... concerns about, 16–19 Alcohol at business meals, 107 Alessandra, Tony, 72 Allstate Insurance Company, xiii American dining style, 107 Anderson, Pamela, 69 Anna’s Better Networking Tips, 96–98 Anna’s ... Hart Schaffner Marx Joseph Abboud Boss St John Knits Armani Collezioni Dana Buchman $1,200–$3,500 $1,200–$3,500 Oxford Donna Karan Collection Hickey Freeman Escada Nicky Hilton Burberry Armani...

Ngày tải lên: 21/06/2014, 13:20

18 323 0
w