associated network for a tm mode
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc
Ngày tải lên :
16/03/2014, 04:20
... to favour a similar mode of binding for Ac-OPP and Ac-CoA Binding mode of CoA to thiolases oxidized or acetylated at Cys89 The structure of CoA-complexed Z ramigera thiolase, in which the catalytic ... Merilainen et al ¨ Table Calorimetric analysis of CoA binding to the Z ramigera biosynthetic thiolase at 25 °C The values and error estimates are calculated from separate measurements (three for ... interactions at the thiolase active site liquor, was allowed to continue for days prior to data collection This experiment was performed for both a wildtype thiolase crystal and a C8 9A mutant...
- 13
- 472
- 0
Fault tree synthesis from a directed graph model for a power distribution network
Ngày tải lên :
03/01/2014, 19:37
... boundary and the boundary variables are treated as P0 / -S primal events The unit models describe both normal and failed behavior and depend on a wide variety of operating parameters and failure modes ... the causal relationships between variables including normal and failed states The basic elements of a digraph are shown in figure for conduction in a wire Node labels represent deviation variables, ... ET Al.: FAULT TREE SYNTHESIS FROM A DIRECTED GRAPH MODEL FOR A POWER DISTRIBUTION NETWORK Each of the mains, A( l), and transformers, T(i), are sized to carry the entire plant load The tie breaker,...
- 10
- 314
- 0
A self organizing neural network model for a mechanism of pattern recognition unaffected by shift in position
Ngày tải lên :
08/07/2014, 17:02
... matches with that of the standard pattern situated at a certain location, and that, at the same time, the lower part of this input pattern matches with that of the same standard pattern situated ... the largest output is chosen as a candidate for the representatives Hence, there is a possibility that a number of candidates appear in a single S-plane If two or more candidates appear in a single ... input layer Figure is a schematic diagram illustrating the interconnections between layers Each tetragon drawn with heavy lines represents an S-plane or a C-plane, and each vertical tetragon drawn...
- 10
- 575
- 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
Ngày tải lên :
13/08/2014, 01:20
... ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg ... agagggcagtggaactcctt PSMB2R gaaggttggcagattcagga VIRvsLTNP CD8 1.3 2.3 PSMA5 NM_002790.2 proteasome subunit, alpha type, PSMA5L tgaatgcaacaaacattgagc PSMA5R ttcttcctttgtgaacatgtgg VIRvsLTNP CD8 2.7 ... LTNP, and BDL versus LTNP) Rather than single DE genes, GSEA evaluates microarray data at the biological pathway level by performing unbiased global searches for genes that are coordinately regulated...
- 21
- 376
- 0
A New Model for Network Traffic Based on Alpha Stable Self similar ...
Ngày tải lên :
14/11/2015, 08:03
... ≠ α , and M s is an the dispersion and the mean or median of the distribution alpha-stable random measure on R with Lebesque A random variable X that follows an alpha-stable control measure The ... new network traffic model advanced distribution with the above parameters is denoted by X ~ Sα (σ , β , µ ) in this paper is based on the Linear Fractional Stable Noise scale and location parameters, ... and c are Table.1 The parameters of alpha-stable processes measured by actual network data Data sets Sequence of packets α β σ µ 1~100000 packets 1.3635 1.0000 13.5331 4.8294 100001~200000 packets...
- 5
- 432
- 0
Artificial neural network modelling approach for a biomass gasification process in fixed bed gasifiers
Ngày tải lên :
01/08/2016, 09:32
... data Neural network models require a large number of measurements Please cite this article in press as: Mikulandric´ R et al Artificial neural network modelling approach for a biomass gasification ... Zagreb (Croatia) References [1] Ahmed T, Ahmad M, Yusup S, Inayat A, Khan Z Mathematical and computational approaches for design of biomass gasification for hydrogen production: a review Renewable ... have been analysed Neural network models show good correlation with measured data and good capability to predict biomass gasification process parameters with reasonable accuracy and speed Acknowledgements...
- 14
- 400
- 0
A Knowledgeable Model: Network of C-Objects
Ngày tải lên :
18/09/2012, 10:13
... F ∪ O Put A0 = A, A1 = t1 (A0 ), , Am = tm( Am-1), and D (A) = Am, we have A0 ⊆ A1 ⊆ ⊆ Am = D (A) ⊆ M A problem A → B on a network (O,F) is called solvable if and only if there is a sequence ... O2 .A} , A2 = { O1 .a , O1 .A, O2 .A, O1.b, O1.c }, A3 = {O1 .a , O1 .A, O2 .A, O1.b, O1.c, O3 .a} , A4 = {O1 .a , O1 .A, O2 .A, O1.b, O1.c, O3 .a, O4 .a} , A5 = {O1 .a , O1 .A, O2 .A, O1.b, O1.c, O3 .a, O4 .a, O2.b}, ... O2}, and the process of extending the set of attributes as follows: O1 A0 f 5→ A1 → A2 f 1→ where A3 f 2→ A4 f 3→ A5 f 4→ O2 A6 → A7 A0 = A = {O1 .a , O1 .A} , A1 = {O1 .a , O1 .A, ...
- 8
- 365
- 2
Exergoeconomic performance optimization for a steadyflow endoreversible refrigeration model including six typical cycles
Ngày tải lên :
05/09/2013, 17:08
... this paper is to build a universal endoreversible steady flow refrigeration cycle model consisting of a constant thermal-capacity heating branch, two constant thermalcapacity cooling branches and ... an infinite heat sink at temperature TH and an infinite heat source at temperature TL is shown in Figure In this T-s diagram, the processes between and , as well as between and are two adiabatic ... branches; the process between and is a heating branch with constant thermal capacity (mass flow rate and specific heat product) Cin ; the processes between and 4, and and are two cooling branches...
- 10
- 1.3K
- 1
Establishing a surface water quality monitoring network for the Mekong delta,Viet Nam
Ngày tải lên :
04/11/2013, 20:15
... Departments - Department of General Administration - Department of Personnel - Department of Finance - Department of Academic Affairs - Department of Sciences and Post-graduate Programs - Department ... environmentally hazardous substances and contamination of groundwater and surface waters Discharge of industrial wastewater which contains toxic substances and accidental spill of chemicals during transportation ... or canals is a popular economic source which makes the surface-water contaminated As many people in the area drinks straight from the surface water, enteric infections and diarrhea diseases are...
- 26
- 578
- 0
Tài liệu A neural-network-based space-vector PWM controller for a three-level voltage-fed inverter induction motor drive doc
Ngày tải lên :
22/12/2013, 08:16
... -phase P states and performed with the and signals only Similar operations are signals of all the phases and all the The drive performance was evaluated in detail by simulation with the neural network ... signals are compared with the output of a single UP/DOWN counter and processed through a logic block to generate the PWM outputs for for for for for (5) for for for for for for for for for for ... states appear as notched waves (see Fig 4) On the other hand, in , or states appear as notched waves the even sector states appear as pulsed waves This can be easily veriand fied by drawing waveforms...
- 10
- 521
- 0
Tài liệu Building a Cisco Network for Windows 2000 P2 doc
Ngày tải lên :
23/12/2013, 01:16
... configured and working StackMaker An application that an administrator can use to create a virtual stack of devices for easier visual management Threshold Manager A remote monitoring (RMON) application ... Balance network traffic to a server by using multiple network adapters and network load balancing s Use media and protocols that enable the highest bandwidth available If you have Category cabling ... suggests a technology need Sometimes that so-called “impossible” feat is actually available as a feature of a technology already available Other times, the requirement that drives that goal can be...
- 20
- 402
- 0
Tài liệu Building a Cisco Network for Windows 2000 P1 pdf
Ngày tải lên :
23/12/2013, 01:16
... Engineers and American MENSA, Ltd Melissa currently resides in Glendale, Arizona with her family, Dan, Justine, and Taylor, and her two Great Danes (a. k .a Mobile Defense Units), Marmaduke and Apollo and ... not possible Database A Application A Database B Application B Database C Application C Database D Application D Users must know which application leads to which data If not, they suffer confusion ... total cost of owning the technology on the network IT groups are also faced with management applications that are proprietary and database systems that are unable to interoperate; both situations...
- 30
- 411
- 0
Tài liệu A Global Model for Regulatory Reform doc
Ngày tải lên :
26/01/2014, 02:20
... Information Technology Agreement II … are countries on use of standards and SDoC US and EU have asked for talks leading to a signed agreement APEC World Trade Organizations surveying …… APEC has ... Declaration of Conformity option June 24, 1998 Model for Regulatory Reform One Standard feedback Designed once to internationally-accepted global standards Market Surveillance Product sample and ... Standard on what are the requirements and content of a Compliance Folder and a Declaration of Conformity Guidance on market surveillance methods that a government should consider Conform to administrative...
- 17
- 417
- 0
Tài liệu A Backpropagation Neural Network for Computer Network Security doc
Ngày tải lên :
14/02/2014, 16:20
... the back propagation algorithm[11, 12] The backpropagation neural network: One of the most commonly used supervised ANN model is backpropagation network that uses backpropagation learning algorithm[2, ... Springer-Verlag, 3333: 418-425 14 Yen, J.C and J.I Guo, 2002 The design and realization of a chaotic neural signal security system Pattern Recognition and Image Analysis (Advances in Mathematical Theory and ... X Liao and Y Chen, 2004 A novel symmetric cryptography based on chaotic signal generator and a clipped neural network Advances in Neural Networks-ISNN, Intl Symp Neural Networks Proc., Part II...
- 6
- 536
- 0
Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx
Ngày tải lên :
19/02/2014, 19:20
... Markov Models (Nabende, 2010; Darwish, 2010; Jiampojamarn et al., 2010), Finite State Automata (Noeman and Madkour, 2010) and Bayesian learning (Kahki et al., 2011) to learn transliteration pairs ... algorithm to estimate the counts of multigrams The algorithm has a forward variable α and a backward variable β which are calculated in the standard way (Deligne and Bimbot, 1995) Consider a node r which ... pronounced as “Jaarj” in Hindi Our semi-supervised system learns this as a non-transliteration but it is wrongly annotated as a transliteration in the gold standard Arabic nouns have an article “al” attached...
- 9
- 521
- 0
Tài liệu Báo cáo khoa học: Cleavage of nonphenolic b-1 diarylpropane lignin model dimers by manganese peroxidase from Phanerochaete chrysosporium Evidence for a hydrogen abstraction mechanism docx
Ngày tải lên :
20/02/2014, 23:20
... prepared for analysis as described above Chromatography and mass spectrometry GC-MS was performed at 70 eV on a Finnigan 4500 mass spectrometer using a Galaxy data system and fitted with a Hewlett ... (III), and a- keto diarylpropane (IV) can be explained on the basis of an initial hydrogen abstraction reaction at one of two positions A benzylic radical can be generated at C1, which is resonance ... abstraction from the aromatic ring We also show that a- keto diarylpropane lignin dimeric compounds are degraded by a hydrogen abstraction mechanism to produce benzoic acid derivatives Materials...
- 9
- 496
- 1
Associated factors for treatment delay in pulmonary tuberculosis in HIV-infected individuals: a nested case-control study docx
Ngày tải lên :
06/03/2014, 04:20
... Mfinanga SG, Mutayoba BK, Kahwa A, Kimaro G, Mtandu R, Ngadaya E, Egwaga S, Kitua AY: The magnitude and factors associated with delays in management of smear positive tuberculosis in Dar es Salaam ... da Saude Secretaria de Vigilancia a Saude Programa Nacional de DST/AIDS: riterios de definicao de casos de aids em adultos ecriancas Brasilia, Ministerio da Saude: Ministerio da Saude, Secretaria ... In the first, a multivariate regression analysis was undertaken in each group, starting with a minimal model and adding one variable at a time Variables associated to treatment delay where P
- 11
- 479
- 0