spectrin band 3 and protein 4 2

Bridge to IELTS Pre-intermediate - Intermediate Band 3.5 to 4.5 Student''s Book

Bridge to IELTS Pre-intermediate - Intermediate Band 3.5 to 4.5 Student''s Book

... lllцstrations Ьу: Kees рр 12, 18 ,22 ,26 ,З8,З9,58, 62, 64, 65,67,71,88, Printed in China Ьу RR Donnelley l 2 45 6789 10- lб |5 |4 |з \2 ]0'l, ] 03, 1 4, ]]0, ]lЗ, ]'l8, ]19, ]2 , l2l, 12 , 125 , 126 .i)- t Рrе5ý Aýsociation ... photo8raphS: tJ; Linn Lбnroth 42 В, 42 С Maria Papageorgiou р 27 , 69 Martin Banfield р 84 Маry Ечапý Pidure Library 45 Ь (Alinari Archives) Muji р99 Hollingsworth), 122 l (iStockPhoto) zooid Рiсtцrеý ... сlоssюоm gол 2: matching headings and paragraphs going to S: mу plans for the future W: discursive essay (2) : The future of education l l о flЖff 1 12* 1 23 will(поt) countable ПоuПs cotтiparative and superlative...

Ngày tải lên: 01/08/2015, 11:37

146 3,6K 12
Bridge to IELTS Pre-intermediate - Intermediate Band 3.5 to 4.5 Workbook

Bridge to IELTS Pre-intermediate - Intermediate Band 3.5 to 4.5 Workbook

... Listen and circle the numbers, а or Ь, 4 ь7 а 1 .4 а 1,7 22 оо а 1 ,2 а6 .3 а l2000 Ь 22 000 ь 2. 1 ь 63 bl200 ýФ]П Listen and repeat Practise saying the пчmьеrs below I.8 500 l800 2, з 800 l50 2, 7 600 ... } 2 оl/ 2 * 20 02/ 0з ý 20 0з/ 04 я ý * , 20 04/ 05 20 05/06 20 06/о7 2 О1 /ОВ 20 08/09 copyi8hto UniveБities The] UK shows the percentage of students in the UK studying' Оп the left, wе сап see the and ... ::j']l,]]],::i' ;:65+ $ } о f ! Bovo zovo 600/о 50о/о 8o Ф ! Ф Ф о- +oozo 500/о 20 0/о l 00/о 00/о 18- 24 25 - 34 35 - 4 45- 54 55- 64 ьs+ Age of shoppers I what information does chart А show? What the colourý...

Ngày tải lên: 01/08/2015, 11:37

122 4,6K 13
Instant Lessons Book ( level 3 and level 4 )

Instant Lessons Book ( level 3 and level 4 )

... his band will win and make a CD Perhaps he'll become a pop star! Tom plays guitar in a band He is not very good but he loves playing His band is going to play in a big competition The best band ... thousand miles away across the Atlantic Ocean and moving to new homes in fresh water all over Scotland climb over the Many die and many more become the food of seabirds; but some (2) rocks and ... Books 20 02 49 Fairy tales Lesson 23 Teacher's Notes ( Skills: Reading; speaking; writing Function: Telling a story Language: Infinitive 'to' used to express purpose Vocabulary: Fairy tales and...

Ngày tải lên: 12/06/2016, 18:35

95 469 0
Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx

Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx

... peroxides H2O (control) H2O2 H2O2 + GSH H2O2 + 2MPG H2O2 + Methionine H2O2 + Trolox C H2O2 + Dithiothreitol H2O (control) H2O2 H2O2 + GSH H2O2 + 2MPG H2O2 + Methionine H2O2 + Trolox C H2O2 + Dithiothreitol ... Dithiothreitol H2O2 + Ascorbic Acid 86 14 83 80 25 13 87 73 67 59 69 100 64 88 45 74 93 52 44 93 97 23 88 109 109 80 55 70 10 99 1 02 95 1 12 91 70 GAPDH + Fe2+EDTA GR + Fe2+EDTA GR + Fe2+EDTA LDH + Fe2+EDTA ... N-Ac-Trp-OMe + peroxides + Fe2+EDTA H2O (control) H2O + Fe2+EDTA H2O2 H2O2 + Fe2+EDTA H2O (control) H2O + Fe2+EDTA H2O2 H2O2 + Fe2+EDTA 87 84 68 62 99 97 98 23 72 70 69 10 GR LDH identical peroxide concentrations...

Ngày tải lên: 21/02/2014, 03:20

10 462 0
Lecture 3 DNA RNA and protein synthesis great

Lecture 3 DNA RNA and protein synthesis great

... its particular protein?  As in, people protein vs tree protein?  The answer is DNA! The species-particular DNA sequences produce the species-particular proteins  GENES code for proteins  GENES ... a sugar, and a nitrogen base  DNA is in a double strand  The nitrogen bases have compliment partners  Adenine-Thymine  Cytosine-Guanine Just a note about RNARNA is single-stranded and acts ... GENES are long strands of DNA on chromosomes  What is DNA? DNA is the genetic code,  Instructions for heredity,  Components of genes,  Director of protein synthesis   AND- DNA is also A...

Ngày tải lên: 13/03/2014, 16:36

17 671 2
Báo cáo khóa học: Overexpression and enzymatic characterization of Neisseria gonorrhoeae penicillin-binding protein 4 ppt

Báo cáo khóa học: Overexpression and enzymatic characterization of Neisseria gonorrhoeae penicillin-binding protein 4 ppt

... 99 100 99 24 92 97 93 99 98 101 1 04 1 03 97 1 04 1 02 1 02 97 105 1 03 79 1 03 105 105 1 03 1 04 105 106 100 1 13 82 78 108 66 89 73 100 100 83 96 44 44 74 95 90 91 96 96 99 96 109 97 91 87 94 95 100 97 ... PBP Ac2-KAA Ac-Cbz-KAA Boc-Cbz-KAA Boc-Ac-KAA Boc-H-KAA Ac2-KA-D-Lac 76 60 27 11 .3 3.58 1 730 29 000 1 42 000 180 000 62 000 830 0 12 30 0 12 12 21 11 700 a (2) (10) (4) (0 .2) (0. 04) (70) (20 00) ... Phosphoramidon 2- Aminoethylphosphonic acid Phenylglyoxal ZnCl2 CdCl2 CaCl2 CoCl2 CuCl2 MnCl2 MgCl2 100 1 04 96 1 03 89 45 85 89 76 81 106 91 56 59 95 1 04 105 109 1 04 115 1 02 100 99 47 1 04 99 107 1 03 92 89...

Ngày tải lên: 23/03/2014, 12:20

10 328 0
Báo cáo khóa học: Human PABP binds AU-rich RNA via RNA-binding domains 3 and 4 pdf

Báo cáo khóa học: Human PABP binds AU-rich RNA via RNA-binding domains 3 and 4 pdf

... brackets Protein Kd for A25 (nM) Kd for AU4 (nM) Kd for M8 (nM) PABP PABP1 2 34 PABP 12 PABP 34 0.67 (0.61–0. 74) 0. 74 (0.61–0.81) 1.8 (1.6–1.9) 1.5 (1 .3 1.6) 3. 9 (3. 7 4. 1) 1 .3 (1 .2 1 .4) 1 13 ( 82 157) 2. 9 ... ( 82 157) 2. 9 (2. 8 3. 1) 7.7 (6.5–9.1) 2 .4 (2. 2 2. 6) 30 8 (88–10 74) 12 (11– 13) However the apparent Kd for A25 was 1.8 nM, which is only slightly decreased compared to PABP1 2 34 As PABP 12 is less than ... His6-tagged proteins PABP1 2 34 contains the four RRM domains but not the large C-terminal domain, while PABP 12 and PABP 34 contain RRM domains and 2, and RRM domains and 4, respectively (Fig 3) The...

Ngày tải lên: 23/03/2014, 12:20

8 307 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

... Calcium 32 , 21 29 34 Zolk O, Frohme M, Maurer A, Kluxen FW, Hentsch B, Zubakov D, Hoheisel JD, Zucker IH, Pepe S & Regulation of CARP by calpain 35 36 37 38 39 40 41 42 43 44 45 Eschenhagen T (20 02) ... human skeletal muscle Ankrd2 Biochem Biophys Res Commun 28 5, 37 8 38 6 FEBS Journal 27 7 (20 10) 43 2 2 43 3 7 ª 20 10 The Authors Journal compilation ª 20 10 FEBS L Laure et al 24 Kemp TJ, Sadusky TJ, Saltisi ... epitope In the presence of the protease-dead C 129 S calpain 3, FEBS Journal 27 7 (20 10) 43 2 2 43 3 7 ª 20 10 The Authors Journal compilation ª 20 10 FEBS 43 2 3 Regulation of CARP by calpain L Laure et al...

Ngày tải lên: 29/03/2014, 21:20

16 462 0
báo cáo hóa học: " Similar promotion of Aβ1-42 fibrillogenesis by native apolipoprotein E ε3 and ε4 isoforms" pptx

báo cáo hóa học: " Similar promotion of Aβ1-42 fibrillogenesis by native apolipoprotein E ε3 and ε4 isoforms" pptx

... Y: Visualization of Aβ 42 ( 43 ) and A 40 in senile plaques with endspecific Af3 monoclonals: Evidence that an initially deposited species is A 42 ( 43 ) Neuron 19 94, 13: 45 - 53 Naslund J, Thyberg J, ... apolipoprotein E 3 CHO apolipoprotein E 4 CHO apolipoprotein E 3 CHO apolipoprotein E 4 CHO apolipoprotein E 3 CHO apolipoprotein E 4 Aβ1 -40 1.0 ± 0.l-fold 1.0 ± 0.l-fold 1.0 ± 0.l-fold 1 .2 ... Chem 19 94, 26 9: 2 34 03- 2 34 06 Zhou Z, Smith JD, Greengard P, Gandy S: Alzheimer amyloid-β peptide forms denaturant-resistant complex with type 3 but not type 4 isoform of native apolipoprotein...

Ngày tải lên: 19/06/2014, 22:20

4 428 0
Proteomics Human Diseases and Protein Functions Part 3 pdf

Proteomics Human Diseases and Protein Functions Part 3 pdf

... protein sorting-associated protein 35 0 1.150 0. 7 42 0 .4 73 VPS4A_HUMAN 4A 34 1 1. 24 2 1 .4 93 0.595 CHM2A_HUMAN Charged multivesicular body protein 2a 28 2 0.958 0.578 22 .45 0 UROM_HUMAN Uromodulin 27 9 ... Gamma-glutamyltranspeptidase 25 8 0.897 0.995 0 .38 1 NEP_HUMAN Neprilysin 2 54 1. 24 5 1.0 93 0.776 EZRI_HUMAN Ezrin 25 2 1 .39 3 0. 43 5 0.601 ANX11_HUMAN Annexin A11 23 1 1 .41 5 5 .2 14 0 . 34 5 PSCA_HUMAN Prostate stem cell antigen 20 8 ... F 175 0. 931 0. 837 0 . 32 0 DPP4_HUMAN Dipeptidyl peptidase 167 0.898 0.679 0.5 73 AQP1_HUMAN Aquaporin-1 151 1 .31 6 2 .33 2 0 .35 4 THY1_HUMAN Thy-1 membrane glycoprotein 145 0. 945 0.5 23 0.7 43 MUC1_HUMAN...

Ngày tải lên: 22/06/2014, 04:20

25 329 0
Báo cáo toán học: "Goldberg-Coxeter Construction for 3- and 4-valent Plane Graphs" pdf

Báo cáo toán học: "Goldberg-Coxeter Construction for 3- and 4-valent Plane Graphs" pdf

... 22 , 10 14 4, 10 32 , 42 , 4, 10 4, 10 32 , 22 , 10 14 12 , 12 6, 14 14 22 , 10 22 , 10 14 [CC] 43 34 26 34 43 43 43 34 43 34 26 26 34 26 34 43 43 43 43 34 34 43 26 43 43 26 34 43 26 34 43 34 ... 43 43 34 34 43 26 43 43 26 34 43 26 34 43 34 34 26 43 43 34 26 43 43 34 34 43 34 43 26 43 43 34 26 GCk,l (Octahedron) P rojection Group 01 D∞h 01 D∞h 01 D∞h D3h 20 D4d 20 D4d 21 D4d D3h 21 D4d ... 34 26 34 34 34 34 34 34 26 34 34 34 26 34 26 34 34 34 26 34 34 34 34 34 26 34 34 Cube Int (0, 0); 23 (0, 0); 24 , (3, 0); 1 23 (9, 0); 2 03 (9, 0); 32 3 (4, 0); 144 , 20 (18, 0); 5 03 (19, 0); 623 ...

Ngày tải lên: 07/08/2014, 08:20

49 265 0
Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

... ATCTCGTTGTCTGAGTACCAGTCC 51 45 4 IHH Sense: GAGGAGTCCCTGCATTATGA Antisense: CAGGAAAATGAGCACATCGC 54 32 1 30 RUNX2 Sense: ACAGATGATGACACTGCCACC Antisense: CATAGTAGAGATATGGAGTGCTGC 55 32 4 35 54 2 34 25 Internal control ... Genet 20 06, 38 : 1 42 4- 1 42 9 46 Goldring MB, Tsuchimochi K, Ijiri K: The control of chondrogenesis J Cell Biochem 20 06, 97 :33 -44 47 Karsenty G, Wagner EF: Reaching a genetic and molecular understanding ... 20 08, 2: 1- 13 43 Bandyopadhyay A, Tsuji K, Cox K, Harfe BD, Rosen V, Tabin CJ: Genetic analysis of the roles of BMP2, BMP4, and BMP7 in limb patterning and skeletogenesis PLoS Genet 20 06, 2: e216...

Ngày tải lên: 09/08/2014, 14:22

15 830 0
Báo cáo khoa học: " Profile of time-dependent VEGF upregulation in human pulmonary endothelial cells, HPMEC-ST1.6R infected with DENV-1, -2, -3, and -4 viruses" pps

Báo cáo khoa học: " Profile of time-dependent VEGF upregulation in human pulmonary endothelial cells, HPMEC-ST1.6R infected with DENV-1, -2, -3, and -4 viruses" pps

... 0 .4 ± 1 .4 0±0 1, 24 4 .0 ± 1 .4 14, 997.5 ± 50 .2 14, 2 23 . 8 ± 46 0 .3 21 ,27 5.6 ± 550.5 9,0 94. 5 ± 22 0.6 24 600.1 ± 59 .4 10,167.1 ± 38 4 .3 11, 039 .2 ± 969 .4 15, 529 .7 ± 23 8 .3 11,7 82. 0 ± 53. 7 96 876.0 ± 28 .6 ... ± 730 .1 10 , 34 9 .4 ± 189.9 13, 541 .0 ± 5 23 . 6 4, 610.1 ± 20 7.9 1 92 3, 24 7 .7 ± 39 8.5 25 , 948 .5 ± 43 2 .0 29 ,889.6 ± 828 .4 41,560 .4 ± 131 .2 20 ,28 1.7 ± 706.1 Samples were taken at time points 0, 8, 24 , 96, ... 0.167950 0.057191 0.000089 0.0080 74 0.006 035 0.0 04 2 34 24 0.008879 0. 045 426 0.001775 0.00 029 7 96 0.07 931 6 0.0 022 76 0.0105 24 0.0 135 08 1 92 0.006617 0.0 128 08 0.0016 83 0.0188 74 Competing interests The authors...

Ngày tải lên: 12/08/2014, 04:21

5 404 0
Professional Visual Basic 2010 and .neT 4 phần 3 pot

Professional Visual Basic 2010 and .neT 4 phần 3 pot

... namespace, as shown in Figure 4- 20 Simpo PDF Merge and Split Unregistered Version - http://www.simpopdf.com 25 2  ❘  Chapter 4   THE COMMON LANGUAGE RUNTIME Figure 4- 20 Summary This chapter introduced ... Studio 20 10 IDE You can find it by selecting View ➪ Object Browser if you are using Visual Studio 20 10, 20 05, or 20 03, or View ➪ Other Windows ➪ Object Browser if you are using Visual Studio 20 02 ... 2. 0 to quickly give you access to your application, your users, your resources, the figure 4- 14 Simpo PDF Merge and Split Unregistered Version - http://www.simpopdf.com The My Keyword  ❘  24 3 ...

Ngày tải lên: 12/08/2014, 23:23

133 328 0
Báo cáo y học: "Adiponectin, retinol-binding protein 4, and leptin in protracted critical illness of pulmonary origin" pps

Báo cáo y học: "Adiponectin, retinol-binding protein 4, and leptin in protracted critical illness of pulmonary origin" pps

... Critical Care 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 Vol 13 No Langouche et al not related to diet-induced changes in insulin sensitivity J Clin Endocrinol Metab 20 07, 92: 23 3 0- 23 3 5 Yang WS, ... SD) 69 ± 14 64 ± 15 0.008 BMI (mean ± SD) 24 . 2 ± 5 .2 24 . 7 ± 5.1 0.5 Adm Apache II score (median [IQR]) 23 [17.5 28 .5] 22 [17 28 ] 0 .4 Adm SOFA score (median [IQR]) [4 9] [4 8] 0 .3 Kidney failure ... (n = 94) P 111 [67 .3] 59 [ 62. 8] 0.5 Age (years; mean ± SD) 66.1 ± 12 .3 67.0 ± 15 .2 0.6 BMI (mean ± SD) 25 .1 ± 5.1 24 . 1 ± 5.0 0.1 Admission Apache II score (median [IQR]) 23 [17 29 ] 21 [17 28 ] 0.6...

Ngày tải lên: 13/08/2014, 16:21

6 391 0
Báo cáo y học: "Circulating retinol binding protein 4 in critically ill patients before specific treatment: prognostic impact and correlation with organ function, metabolism and inflammation" pot

Báo cáo y học: "Circulating retinol binding protein 4 in critically ill patients before specific treatment: prognostic impact and correlation with organ function, metabolism and inflammation" pot

... (%) 26 .0 34 .4 25 .9 35 .7 26 .3 31.6 90-day mortality (%) 40 .2 42 .7 34 .3 180-day mortality (%) 43 . 5 46 .9 35 .3 1-year mortality (%) 52 .4 54. 1 48 .4 Mechanical ventilation n (%) 78 ( 63% ) 53 ( 62% ) 25 ... (range) (h) 38 (0 -29 66) 80 (0 -29 66) 24 * * (0-755) pre-existing diabetes n (%) 42 ( 34 %) 27 ( 32 %) 15 (40 %) BMI median (range) (m2/kg) 26 .1 (15 .3- 59.5) 26 .2 (15 .35 9.5) 25 .4 (19.0- 53. 3) RBP4 median (range) ... 64 (18-81) 64 (21 -81) 60 (18-79) APACHE-II score median (range) 14 (0 -31 ) 14 (0 -31 ) 14 (0 -31 ) SAPS2 score median (range) 42 (0-80) 42 (0-79) 42 ( 13- 80) ICU days median (range) (1- 137 ) 10 (1- 137 )...

Ngày tải lên: 13/08/2014, 21:21

11 216 0
H.264 and MPEG-4 Video Compression phần 3 pps

H.264 and MPEG-4 Video Compression phần 3 pps

... 169 1 34 1 34 1 34 1 34 149 149 149 149 1 34 1 34 1 34 1 34 120 120 120 120 1 34 1 34 1 34 1 34 100 100 100 100 coefficients coefficient (c) (d) 144 159 179 1 94 146 179 187 165 1 24 138 159 1 73 95 146 179 ... ‘Carphone’, QCIF Integer-pel Half-pel Quarter-pel 171 945 24 831 6 10 24 1 8 1 5 34 75 24 5 7 84 739 52 12 8 32 0 22 89 52 5 649 2 1 137 44 21 5585 47 780 Figure 3. 21 Motion vector map (16 × 16 blocks, integer vectors) ... Probability p log2(1/ p) 2 −1 0.1 0 .2 0 .4 0 .2 0.1 3. 32 2 . 32 1 . 32 2 . 32 3. 32 • 63 ENTROPY CODER -2 p = 0.1 p = 0.1 -1 p = 0 .2 p = 0 .2 A p = 0 .2 1 C D p =1.0 B p = 0 .4 p = 0 .4 Figure 3. 45 Generating...

Ngày tải lên: 14/08/2014, 12:20

31 226 0
FCE Speaking Part 3 and 4 teacher handbook 08

FCE Speaking Part 3 and 4 teacher handbook 08

... learned and serious audience 2. What is the key difference between classical music and romantic music ? Classical music has beauty in itself, whereas romantic music arouses people’s emotions 3. Why ... with a strong beat people ? and simple tunes, which are easy to remember  Mus ic Classical De s cript E xam p ♪  F le ionarne d and s e rious leor a SYMPHONY NO .4 audience, dependend ... Unit : 12 “ 1.Which style you like most ? think music 2. Do you play an important role in our Vocabulary English’s Sense Vietnamese’s...

Ngày tải lên: 19/10/2014, 00:00

1 1,1K 6
Proline rich acidic protein 1 in life and death 4

Proline rich acidic protein 1 in life and death 4

... prap1 and gapdh in HCT 116 (p 53 WT) versus HT 29 (p 53 mutant) and Hep G2 (p 53 WT) versus Hep 3B (p 53 deficient) cells after treatment with 5-FU (25 µM) and CPT (20 nM) for 48 hours 111 Figure 3. 42 ... Figure 3. 43 The constructed plasmid (pGL3-PRAP) was checked by restriction enzyme digestion (insert size, 33 7bp; Figure 3. 44 ) and verified by sequencing 110 Figure 3. 41 Hep 3B and HT 29 cells ... and 25 µM) and CPT (20 and 25 0nM) for days Cells were harvested for RT-PCR and western blot analysis at 24 , 48 and 72 hours The expression of PRAP1 mRNA was induced as early as 24 hours and sustained...

Ngày tải lên: 11/09/2015, 16:05

39 194 0
Mitochondrial integrity and antioxidative enzyme efficiency in fischer rats  effects of ageing and epigallocatechin 3  gallate intervention  4

Mitochondrial integrity and antioxidative enzyme efficiency in fischer rats effects of ageing and epigallocatechin 3 gallate intervention 4

... both 100 and 20 0 μM H2O2 resulted in a high ROS level in the EGCG untreated HDF, whereas HDF pretreated with 25 and 50 μM EGCG for 24 hours moderately reduced the ROS level by 36 .9 and 28 .1% after ... moderately reduced the ROS level by 36 .9 and 28 .1% after exposure to 100 μM H2O2 and by 32 .0 and 44 .6 % after exposure to 20 0 μM H2O2 when compared to their respective control (Figure 17E) Furthermore, ... expressions of CAT, SOD1, SOD2 and GPx increased in response to 25 μM 87 EGCG by 94. 1, 61.9, 44 .6 and 139 .2 % respectively (Figure 18A) The gene expressions of CAT and GPx were also significantly...

Ngày tải lên: 11/09/2015, 16:05

3 171 0
w