1. Trang chủ
  2. » Luận Văn - Báo Cáo

Map based cloning of leaf rolled inside lri mutation in arabidopsis thaliana

36 5 0

Đang tải... (xem toàn văn)

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Tiêu đề Map-based cloning of leaf-rolled inside (LRI) mutation in Arabidopsis thaliana
Tác giả Nguyen Thu Huong
Người hướng dẫn Prof. Park Soon Ki, PhD. Pham Bang Phuong
Trường học Thai Nguyen University of Agriculture and Forestry
Chuyên ngành Biotechnology
Thể loại Bachelor thesis
Năm xuất bản 2016
Thành phố Thai Nguyen
Định dạng
Số trang 36
Dung lượng 0,92 MB

Nội dung

THAI NGUYEN UNIVERSITY UNIVERSITY OF AGRICULTURE AND FORESTRY NGUYEN THU HUONG MAP - BASED CLONING OF LEAF-ROLLED INSIDE (LRI) MUTATION IN ARABIDOPSIS THALIANA BACHELOR THESIS Study Mode: Full time Major: Biotechnology Faculty: Biotechnology and Food Technology Batch: 2012-2016 Thai Nguyen – 2016 THAI NGUYEN UNIVERSITY UNIVERSITY OF AGRICULTURE AND FORESTRY NGUYEN THU HUONG MAP - BASED CLONING OF LEAF-ROLLED INSIDE (LRI) MUTATION IN ARABIDOPSIS THALIANA BACHELOR THESIS Study Mode: Full time Major: Biotechnology Faculty: Biotechnology and Food Technology Batch: 2012-2016 Supervisors: Prof Park Soon Ki PhD Pham Bang Phuong _ Thai Nguyen – 2016 THAI NGUYEN UNIVERSITY UNIVERSITY OF AGRICULTURE AND FORESTRY NGUYEN THU HUONG MAP - BASED CLONING OF LEAF-ROLLED INSIDE (LRI) MUTATION IN ARABIDOPSIS THALIANA BACHELOR THESIS Study Mode: Full time Major: Biotechnology Faculty: Biotechnology and Food Technology Batch: 2012-2016 Supervisors: Prof Park Soon Ki PhD Pham Bang Phuong _ Thai Nguyen – 2016 ACKNOWLEDGEMENT First and foremost I would like to express my sincere gratitude to Prof Park Soon Ki and Dr Oh Sung Aeong for all the guidance, helpful advice during the whole period I would like to give a big thank to Dr Nguyen Tien Dung and MSc Nguyen Thi Hoai Thuong for their valuable suggestions and critical review of my thesis I would like to thank Faculty of Biotechnology and Food Technology members for their support through my internship I also would like to thank PhD Pham Bang Phuong for helpful advice during all this time In addition, I would like to thank all members in Sexual Plant Reproduction Laboratory for their help Last, but not least, I would like to thank my family and my friends for their support, understanding and encouragement during all this time Nguyen Thu Huong Contents LIST OF FIGURES i LIST OF TABLES ii LIST OF ABBREVIATIONS iii PART I INTRODUCTION 1.1 Researcher rationale 1.1.1 Overview of Arabidopsis thaliana 1.1.2 Overview of map-based cloning method 1.2 Research’s objective PART II MATERIALS AND METHODS 2.1 Materials and equipments 2.1.1 Plant material for map-based cloning and growth conditions 2.1.2 Equipments .5 2.2 Methods 2.2.1 DNA extraction 2.2.2 Genetic analysis using SSLP markers .7 2.2.3 Electrophoresis 2.2.4 Phenotype analysis 2.2.5 DNA purification PART III RESULTS AND DISCUSSION 11 3.1 Morphological phenotypes of AP-44-1 mutant line 11 3.2 Linkage analysis of the mutation (LRI) 13 3.3 Identification of mutant gene 18 PART IV CONCLUSION 23 REFERENCES 24 Appendices 27 Appendices 28 LIST OF FIGURES No of Title figure Page Figure Arabidopsis thaliana Figure Process of DNA extraction (CTAB method ) Figure Principle of SSLP mapping Figure Process of DNA purification 11 Figure Procedure of AP-44-1 map-based cloning 11 Figure Phenotype of AP-44-1 plant 13 Figure Locations of the SSLP markers in each chromosome 15 Figure Electrophoresis of wild type plant in mapping line (AP-44-1) for confirmation mutant locus Figure Example of linkage analysis with markers using wild-type plants in the mapping population (AP-44-1) 16 17 Figure 10 A schematic diagram of the positional cloning Final region of mapping is 163kb and in this region containing 49 candidate 22 genes Figure 11 Result of PCR analysis with set of primers 32460 25 Figure 12 Structure of At2g32460 gene 25 i LIST OF TABLES No of table Table Title Result of PCR-based analysis using markers in each chromosome Page 18 Table Result of PCR-based analysis using markers in chromosome 19 Table List of candidate genes in the 163kb 23 ii LIST OF ABBREVIATIONS ADW Autoclaved distilled water Col-0 Columbia CTAB Cetyltriethy-ammonium bromide DNA Deoxyribonucleic acid dNTPs Deoxynucleotide triphosphates EDTA Ethylenediaminetetraacetic acid IAA Isoamyl Alcohol Ler-0 Landsberg erecta LRI Leaf rolled inside NaCl Natri chlorua PCR Polymerase Chain Reaction SSLP Simple Sequnce Length Polymophic TAE Tris-acetate-EDTA WB Washing buffer iii ABSTRACT Thai Nguyen University of Agriculture and Forestry Major Biotechnology Student name Nguyen Thu Huong Student ID DNT1253150010 Thesis title Supervisor (s) Map-based cloning of leaf rolled inside (LRI) mutation in Arabidopsis thaliana Prof Park Soon Ki PhD Pham Bang Phuong Map-based cloning is the method of identifying a mutation gene by looking for linkage to markers that physical location in the genome Mutant line, named AP-44-1, to find a mutation gene, mapping population was conducted and phenotypic analyzed using F2 plants of mapping lines Genomic DNA was prepared from leaves of 689 F2 plants for analysis In order to define chromosomal region where mutation located, PCR-based mapping was performed using SSLP molecular markers Finally, the region containing mutant gene was narrowed down to an approximately 163kb Candidate genes in an interval of ~163kb were sequenced to identify the mutant gene Combined with the results of An et al (2014) suggesting that mutant gene, At2g32460 caused leaf rolled inside phenotype in AP-44-1 mutant line Key word Map-based cloning, leaf rolled inside, At2g32460, AP-44-1 Number of pages 30 Date of Submission 8/2016 agriculture, industry, and human health was also stressed A further commitment to Arabidopsis research was made in 1996 with the establishment of the Arabidopsis Genome Initiative dedicated to coordinating large-scale sequencing efforts This initiative has become a model for multinational cooperation and has already resulted in more than 30 Mb of genomic DNA sequence being deposited in public databases The remainder of the 120-Mb genome is scheduled to be sequenced by the end of 2000 Arabidopsis has therefore progressed in 20 years from an obscure weed to a respected member of the “Security Council of Model Genetic Organisms” Here is some recent advances in Arabidopsis research and summarize features that have made this simple angiosperm a model for research in plant biology (Mienke et al., 1998) Arabidopsis thaliana is an important model plant for identifying genes and pursing their function (Rensink et al., 2004) Arabidopsis has been used to as an ideal model for studying the plant biology and genetics There is ample reason to believe that Arabidopsis will serve as a resource base for breeders of crop plants and as a model plant that further the knowledge of plant scientists (Hayashi and Nishimura, 2006) Classified in a member of the mustard and cabbage plants, Arabidopsis thaliana has many advantages for genetics analysis, including a short life cycle, small size of plant, large number of offspring from self-fertilization, ease of out-crossing and a relatively small genome (Mienke et al., 1998) It has thus become the focus on genome project for learning the molecular biology and genetics in flowering plants at the molecular level Proper leaf development is essential for plant growth and development, and leaf morphogenesis is under the control of intricate networks of genetic and environmental cues Leaf development is one of the fundamental processes ensuring robust photoautotrophic growth for higher plants and mechanisms are in place to coordinate the establishment of leaf polarities (Byrne et al., 2012) The leaf is the major organ involved in light perception and conversion of solar energy into organic carbon In order to adapt to different natural habitats, plants have developed a variety of leaf forms, ranging from simple to compound, with various forms of dissection The fact that numerous factors have been shown to be able to modulate leaf curvature suggests that higher plants utilize complex regulatory schemes to ensure the proper Figure Locations of the SSLP markers in each chromosome Figure Electrophoresis of wild type plant in mapping line (AP-44-1) for confirmation mutant locus A Marker: nga63 (Chromosome 1), with 13 samples B Marker: 21930 (Chromosome 2), with 13 samples C Marker: nga168 (Chromosome 2), with 13 samples (L: Ler-0, C: Col-0 and Ht: Heterozygous) 14 Figure Example of linkage analysis with markers using wild-type plants in the mapping population (AP-44-1) D Marker: 29130 (Chromosome 2), with 13 samples E Marker: 30220 (Chromosome 2), with 13 samples F Marker: 32160 (Chromosome 2), with 13 samples G Marker: 32580 (Chromosome 2), with 13 samples (L: Ler-0, C: Col-0 and Ht: Heterozygous) 15 Table Result of PCR-based analysis using SSLP markers in each chromosome No Line no Phenotype Nga63 Nga280 21930 Nga168 Nga6 Nga162 Nga1107 CTR1 PHYC 40750 Chro# Chro# Chro# Chro# Chro# Chro# Chro# Chro# Chro# Chro# At1g0991 At1g55840 At2g21930 At2g39010 At3g62220 At3g13950 At4g38770 At5g03740 At5g35840 At5g40750 N-96-02 wt C C C/L C C/L C C/L C/L L L N-96-04 wt C/L C/L C/L C C C/L C/L L C/L C/L N-96-07 wt C ND C C C/L L ND C/L L L N-96-08 wt C/L C/L C C L L C L L L N-96-14 wt C/L C/L C C/L C/L C C/L C/L C/L C/L N-96-17 wt C C/L C C C/L C/L L C C C N-96-23 wt C C/L C C L C/L C/L C/L C C N-96-28 wt L C/L C C L C L C C C N-96-31 wt C/L C/L C C C/L C C/L C/L L L 10 N-96-32 wt C/L C/L C C L C C/L C/L C/L C 11 N-96-35 wt C/L L C C C/L C/L C C C/L C/L 12 N-96-40 wt C/L ND C C C L C C C/L C/L 13 N-96-41 Wt C L C C C/L C C C/L C/L 9/26 12/22 2/26 1/26 15/26 10/24 10/26 14/26 13/26 Recombinant/Chromosome C/L 11/26 16 Table Result of PCR-based analysis using SSLP markers in chromosome No Line No Phenotype analysis 26870 27130 29130 30220 30680 31370 32160 32360 32580 32830 33793 Chro# Chro# Chro# Chro# Chro# Chro# Chro# Chro# Chro# Chro# Chro# At2g26870 At2g27130 At2g29130 At2g30220 At2g30680 At2g31370 At2g32160 At2g32360 At2g32580 At2g32830 At2g33793 N-99-99 Wt C N-99-100 Wt C N-100-03 Wt C C N-100-04 Wt C C N-100-18 Wt C C N-100-19 Wt C C C C N-100-27 Wt C C C C N-100-29 Wt C C N-100-30 Wt C C 10 N-100-31 Wt C/L C/L C/L C/L 11 N-100-34 Wt C/L C/L C C 12 N-100-35 Wt C C 13 N-100-38 Wt C C 14 N-100-43 Wt C C 15 N-100-45 Wt C C 16 N-100-53 Wt C/L C/L C/L C/L 17 N-100-58 Wt C/L C/L C C 34/1378 31/1378 14/1378 9/1378 Recombinant/Chromosome C C C C C C C/L C/L 4/1378 C C/L C/L 2/1378 C C/L C 1/1378 C C C 0/1378 C/L C C 1/1378 C/L C C C/L C/L C C C C C C C C 1/1378 3/1378 17 3.3 Identification of mutant gene Starting with 10 SSLP markers to covered whole chromosome in AP-44-1 mutant line on F2 population After identified the region containing mutant gene on chromosome 2, we designed new SSLP markers There are 11 set of primers were used as in table F2 plants were analyzed and based on the number of recombinant plants Finally, the region containing mutant gene was narrowed down to an approximately 163kb (Figure 10) In this region include 49 candidate genes, list of these genes showed in table Based on the result of PCR analysis, we chosen At2g32460 gene as the putative mutant gene by data on website (https://www.arabidopsis.org/) Structure of At2g32460 contained exons and introns (Figure 11) We sent homozygous and wild type samples for sequecing with set of primer 32460 (For1-Rev1), 32460 (For2Rev2), 32460 (For3-Rev3) to find out mutation point of At2g32460 gene (Figure 12) After checking sequence of each sample we did not find any mutant point BLAST searches revealed that At2g32460 correspond to MYB domain protein 101, a member of the R2R3 transcription factor gene family In Arabidopsis thaliana plants have 125 R2R3-MYB gens (Martin and Paz-Ares, 1997; Stracke et al., 2001) Among them, more than 92 genes encoding MYB transcription factors of the R2R3 class have been described (Meissne et al., 1999) MYB proteins are key factors in regulatory networks controlling development, metabolism and responses to biotic and abiotic stresses (Dubos et al., 2010) R2R3-MYB transcription factors play important roles in the regulation of the secondary metabolism R2R3-type MYB factors also has functions of the control of development and determination of cell fate and identity (Stracke et al., 2001) and have been reported to participate in plant response to environmental factors, mediating hormone actions, disease resistance, and the response to various stress conditions in higher plants (Kranz et al., 1998: Stracke et al., 2001; Du et al., 2012) On the other hand, as described by An et al., 2014, they identified a T-DNA insertion 102 bp at upstream of the start codon of At2g32460 These results indicated that enhanced expression of At2g32460 underlines the leaf curling up phenotypes of abs71D and ABS7 is At2g32460 MYB transcription factor ABS7/MYB101 is the cause for the abnormal leaf phenotypes found in abs7-1D (An et al., 2014) Give the dominant nature of abs7-1D, they tesed whether the over-expression of At2g32460 was the cause for curly leaves in abs7-1D Therefore, we suggested that At2g32460 gene causes leaf rolled inside phenotype in AP-44-1 mutant line 18 cjq Figure 10 A schematic diagram of the positional cloning Final region of mapping is 163kb and in this region containing 49 candidate genes 19 Table List of candidate genes in the 163kb No Name At2g32160 At2g32170 At2g32179 At2g32180 At2g32190 At2g32200 At2g32210 At2g32220 At2g32230 10 11 At2g32235 At2g32240 12 At2g32250 13 At2g3260 14 At2g32270 15 At2g32273 16 At2g32275 17 At2g32280 Putative functions S-adenosyl-L-methionine-dependent methyltransferases superfamily protein S-adenosyl-L-methionine-dependent methyltransferases superfamily protein Potential natural antisense gene, locus overlaps with AT2G32180 Plastid transcriptionally active 18 (PTAC18); Unknown protein Unknown protein; Unknown protein; Ribosomal L27e protein family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, cytosolic large ribosomal subunit, intracellular, membrane; Encodes a protein-only RNase P that is involved in the 5’ cleavage of the precursor tRNAs and is able to cleave tRNA-like structures involved in the maturation of plant mitochondrial mRNAs Mutants show a drastic reduction in the levels of mature plastid tRNAPhe(GAA) and tRNA-Arg(ACG), limiting plastid gene expression Unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cadmium ion; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; FAR1-related sequence (FRS2); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED Phosphorylcholine cytidylyltransferase (CCT1); CONTAINS InterPro DOMAIN/s: Rossmann-like A member of Zrt- and Irt-related protein (ZIP) family transcript is induced in response to zinc deficiency in the root also response to iron deficiency Encodes a microRNA Mature sequence:GAAGGTAGTGAATTTGTTCGA Functions as a negative regulator of seed germination under salt stress conditions Expressed protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; Encodes a member of a plant-specific gene family that is required for embryo provasculature development The gene product regulates vascular network complexity and connectivity in cotyledons 20 Table List of candidate genes in the 163kb (continued) No 18 19 20 21 Name At2g32290 At2g32291 At2g32295 At2g32300 22 23 At2g32310 Ât2g32315 24 25 26 27 28 At2g32320 At2g32340 At2g32350 At2g32360 At2g32370 29 30 At2g32380 At2g32390 31 32 33 At2g32400 At2g32410 At2g32415 34 35 36 37 38 39 At2g32430 At2g32440 At2g32450 At2g32460 At2g32470 At2g32480 40 41 42 43 44 45 46 47 48 49 At2g32487 At2g32500 At2g32490 At2g32510 At2g32520 At2g32530 At2g32540 At2g32550 At2g32560 At2g32580 Putative functions Beta-amylase (BAM6); Pseudogene of AT2G31470; F-box family protein EXS (ERD1/XPR1/SYG1) family protein; Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods CCT motif family protein; Potential natural antisense gene, locus overlaps with AT2G32310 tRNAHis guanylyltransferase; TraB family protein; Ubiquitin-like superfamily protein; Ubiquitin-like superfamily protein; Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family Together with ATML1 and PDF2, it is involved in cotyledon development Transmembrane protein 97, predicted; Encodes a ionotropic glutamate receptor ortholog, a member of a putative ligand-gated ion channel subunit family Glr5 Molybdenum cofactor biosynthesis, Polynucleotidyl transferase, ribonuclease H fold protein with HRDC domain; Galactosyltransferase family protein; Ent-kaurenoic acid hydroxylase (KAO2) Calcium-binding tetratricopeptide family protein; Member of the R2R3 factor gene family F-box associated ubiquitination effector family protein; Metalloprotease essential for plastid development Located in the inner membrane of chloroplasts Unknown protein; Stress responsive alpha-beta barrel domain protein; Pseudogene of 3'-5' exonuclease domain-containing protein Member of MEKK subfamily Alpha/beta-Hydrolases superfamily protein; Encodes a gene similar to cellulose synthase Encodes a gene similar to cellulose synthase Cell differentiation, Rcd1-like protein; F-box family protein; Protein of unknown function (DUF1068); 21 Figure 11 Result of PCR analysis with set of primers 32460 W1-6: Wild-type, H1-3: Homozygous and L1-3: Ler (with 32460 for1 to and rev1 to primers, respectively) ATG Predicted promoter E1 TAG I1 E2 I2 E3 Figure 12 Structure of At2g32460 gene E1: Exon (300 bp ) E2: Exon (858bp) E3: Exon (308 bp) I1: Intron (108 bp) I2 : Intron (192 bp) Red box UTR (229 bp) 22 LIST OF FIGURES No of Title figure Page Figure Arabidopsis thaliana Figure Process of DNA extraction (CTAB method ) Figure Principle of SSLP mapping Figure Process of DNA purification 11 Figure Procedure of AP-44-1 map-based cloning 11 Figure Phenotype of AP-44-1 plant 13 Figure Locations of the SSLP markers in each chromosome 15 Figure Electrophoresis of wild type plant in mapping line (AP-44-1) for confirmation mutant locus Figure Example of linkage analysis with markers using wild-type plants in the mapping population (AP-44-1) 16 17 Figure 10 A schematic diagram of the positional cloning Final region of mapping is 163kb and in this region containing 49 candidate 22 genes Figure 11 Result of PCR analysis with set of primers 32460 25 Figure 12 Structure of At2g32460 gene 25 i REFERENCES An R., Liu X., Wang R., Wu H., Liang S., Shao J., Qi Y., An J., YuF., (2014) The over-expression of two transcription factors, ABS5/bHLH30 and ABS7/MYB101, leads to upwardly curly leaves PLoS ONE e107637 Byrne M.E., (2012) Making leaves Current Opinion in Plant Biology 15, 24– 30 Du H., Feng B.R., Yang S.S., Huang Y.B., Tang Y.X., (2012) The R2R3-MYB transcription factor gene family in Maize PloS ONE Dubos C., Stracke R., Grotewold E., Weisshaar B., Martin C., Lepiniec L., (2010) MYB transcription factors in Arabidopsis Trends Plant Science 15, 573-581 Hayashi M., and Nishmura M., (2006) Arabidopsis thaliana-A model organism to study plant peroxisomes Biochimica et Biophysica Acta 1763, 1382-1391 Jander G., Noris S.R., Sounsley S.D., Bush D.F., Levin I.M., Robert L., (2002) Arabidopsis map-based cloning in the post-genome era Plant Physiology 129, 440-450 Lukowitz W., Gillmor C.S., Scheible W.B., (2000) Positional cloning in Arabidopsis: why it feels good to have a genome initiative working for you Plant Physiology 123, 795-805 Martin C., Paz-Ares J., (1997) MYB transcription factor in plants, Trends in Genetics 13, 67-73 Meissne R.C., Jin H., Cominelli E., Denekamp M., Fuertes A., Greco R., Kranz HD., Penfield S., Petroni K., Urzainqui A., Martin C., Paz-Ares J., Smeekens S., Tonelli C., Weisshaar B., Baumann E., Klimyuk V., Marillonnet S., Patel K., Speulman E., Tissier A.F, Bouchez D., Jones J.J.D., Pereira A., Wisman E., Bevana M., (1999) Function Search in a Large Transcription Factor Gene Family in Arabidopsis: Assessing the potential of reverse genetics to identify insertional mutations in R2R3 MYB genes, The Plant Cell 11,1827–1840 10 Mienke D.W., Cherry J.M., Dean C., Rounsley, Koornneef M (1998) Arabidopsis thaliana: a model plant for genome analysis Science 282, 662-665 24 11 Nath U., Crawford B.C., Carpenter R., Coen E., (2003) Genetic control of surface curvature Science 299, 1404–1407 12 Rensink W.A., Buell C.R., (2004) Arabidopsis to rice Applying knowledge from a weed to enhance our understanding of a crop species Plant Physiology 135, 622-629 13 Stracke R., Werber M., Weisshaar B., (2001) The R2R3-MYB gene family in Arabidopsis thaliana Current Opinion in Plant Biology 4, 447-456 25 Appendices List of primer used in this study No Purpose Primer Forward primer (5’ to 3’) Reverse primer (5’ to 3’) nga63 ACCCAAGTGATCGCCACC AACCAAGGCACAGAAGCG nga280 GGCTCCATAAAAAGTGCACC CTGATCTCACGGACAATAGTGC 21930 AGCTCACTCCAAATCGAGAAG TATGGACATAGTCTCGGCATG nga168 GAGGACATGTATAGGAGCCTCG TCGTCTACTGCACTGCCG nga162 CTCTGTCACTCTTTTCCTCTGG CATGCAATTTGCATCTGAGG nga6 ATGGAGAAGCTTACACTGATC TGGATTTCTTCCTCTCTTCAC nga8 TGGCTTTCGTTTATAAACATCC GAGGGCAAATCTTTATTTCGG nga1107 CGACGAATCGACAGAATTAGG GCGAAAAAACAAAAAAATCCA 26400 TGGACACACCTCACATAAGTC TCTCGTGGTTACTCCTACATG 10 26870 TACGTCATATAATCTTGTTGTCG GTTGTTGTAAGATGAGCATTTGC 11 27130 GTAATTTGGACTGTCCGATTCG TATTTCCTATTTCAAGACTTTGC 12 29130 CTTATGAAATTTTACTGTTATGGAC ATCTTACTTTGGTATCGCCAC Mapping 26 Appendices List of primers used in this study (continued) No Purpose Primer Forward primer (5’ to 3’) Reverse primer (5’ to 3’) 13 30220 GGAGCACTTAGAAGATCTTCAC AAATGTATACGCCATAATGCCAAG 14 32830 GTATGTGTGAGGCCAAGAACC GTTTAAGATGAAACCAAAACCAAGC 15 33793-2 GGATTAGTCTGGATCTTGTATC CTGAGTGCTTCAGAGCTGATG 30680 ACAGCGAAGACCTGCCTGCCG CGCAAGTCCGAGACGATATAATG 17 31370 TGCCCTGTATGATTACTAATCAG GTGATGAATTGATTGAGTCTGTC 18 32160 CGTACTCTACAAACCCCCGGTC TCCTCATTGTCCAGAAGACAGG 19 32580 CCAAAACAACAAAGGATTAGTGG GATCTAACAATACACCTTGCC 20 32360 – AATCTATCCTCAAGTTTACCCAAC TGACTTTCGTAATGTGGTAGGCGC 21 32460 – TCCTCTCCTTGATCGGAGGGTCGC GATCTTGGTTTTGGAACTGAAAGG 32460 – CCTGGAAGAACAGACAATGAGATC CACATAGGTCACTGGAGGAAACCC 32460 – GACCCATTCGTTCAGTTCTAGTCC CAGTTCATAGCACATCCCAAG 16 Mapping 22 23 Sequencing 27 LIST OF TABLES No of table Table Title Result of PCR-based analysis using markers in each chromosome Page 18 Table Result of PCR-based analysis using markers in chromosome 19 Table List of candidate genes in the 163kb 23 ii ... cloning of leaf rolled inside (LRI) mutation in Arabidopsis thaliana Prof Park Soon Ki PhD Pham Bang Phuong Map- based cloning is the method of identifying a mutation gene by looking for linkage... gene causes leaf rolled inside phenotype in AP-44-1 mutant line 18 cjq Figure 10 A schematic diagram of the positional cloning Final region of mapping is 163kb and in this region containing 49 candidate... accurate strategy and map- based map cloning was used to identify the mutated gene in this study stud Map based cloning is the method of identifying a mutation gene by looking for linkage to markers

Ngày đăng: 08/06/2021, 18:27

Nguồn tham khảo

Tài liệu tham khảo Loại Chi tiết
1. An R., Liu X., Wang R., Wu H., Liang S., Shao J., Qi Y., An J., YuF., (2014) The over-expression of two transcription factors, ABS5/bHLH30 and ABS7/MYB101, leads to upwardly curly leaves. PLoS ONE 9. e107637 Sách, tạp chí
Tiêu đề: PLoS ONE
2. Byrne M.E., (2012) Making leaves. Current Opinion in Plant Biology 15, 24–30 Sách, tạp chí
Tiêu đề: Current Opinion in Plant Biology
3. Du H., Feng B.R., Yang S.S., Huang Y.B., Tang Y.X., (2012). The R2R3-MYB transcription factor gene family in Maize. PloS ONE 7 Sách, tạp chí
Tiêu đề: PloS ONE
Tác giả: Du H., Feng B.R., Yang S.S., Huang Y.B., Tang Y.X
Năm: 2012
4. Dubos C., Stracke R., Grotewold E., Weisshaar B., Martin C., Lepiniec L., (2010). MYB transcription factors in Arabidopsis. Trends Plant Science 15, 573-581 Sách, tạp chí
Tiêu đề: Arabidopsis
Tác giả: Dubos C., Stracke R., Grotewold E., Weisshaar B., Martin C., Lepiniec L
Năm: 2010
5. Hayashi M., and Nishmura M., (2006). Arabidopsis thaliana-A model organism to study plant peroxisomes. Biochimica et Biophysica Acta 1763, 1382-1391 6. Jander G., Noris S.R., Sounsley S.D., Bush D.F., Levin I.M., Robert L., (2002).Arabidopsis map-based cloning in the post-genome era. Plant Physiology 129, 440-450 Sách, tạp chí
Tiêu đề: Arabidopsis" map-based cloning in the post-genome era. "Plant Physiology
Tác giả: Hayashi M., and Nishmura M., (2006). Arabidopsis thaliana-A model organism to study plant peroxisomes. Biochimica et Biophysica Acta 1763, 1382-1391 6. Jander G., Noris S.R., Sounsley S.D., Bush D.F., Levin I.M., Robert L
Năm: 2002
7. Lukowitz W., Gillmor C.S., Scheible W.B., (2000). Positional cloning in Arabidopsis: why it feels good to have a genome initiative working for you.Plant Physiology 123, 795-805 Sách, tạp chí
Tiêu đề: Arabidopsis": why it feels good to have a genome initiative working for you. "Plant Physiology
Tác giả: Lukowitz W., Gillmor C.S., Scheible W.B
Năm: 2000
10. Mienke D.W., Cherry J.M., Dean C., Rounsley, Koornneef M (1998). Arabidopsis thaliana: a model plant for genome analysis. Science 282, 662-665 Sách, tạp chí
Tiêu đề: Arabidopsis thaliana": a model plant for genome analysis". Science
Tác giả: Mienke D.W., Cherry J.M., Dean C., Rounsley, Koornneef M
Năm: 1998
12. Rensink W.A., Buell C.R., (2004). Arabidopsis to rice. Applying knowledge from a weed to enhance our understanding of a crop species. Plant Physiology 135, 622-629 Sách, tạp chí
Tiêu đề: Plant Physiology
Tác giả: Rensink W.A., Buell C.R
Năm: 2004
13. Stracke R., Werber M., Weisshaar B., (2001). The R2R3-MYB gene family in Arabidopsis thaliana. Current Opinion in Plant Biology 4, 447-456 Sách, tạp chí
Tiêu đề: Arabidopsis thaliana. Current Opinion in Plant Biology
Tác giả: Stracke R., Werber M., Weisshaar B
Năm: 2001
8. Martin C., Paz-Ares J., (1997). MYB transcription factor in plants, Trends in Genetics 13, 67-73 Khác

TỪ KHÓA LIÊN QUAN

TÀI LIỆU CÙNG NGƯỜI DÙNG

TÀI LIỆU LIÊN QUAN