Phenotypic characterization and map based cloning of a novel mutant causing abnormal leaf in arabidopsis thaliana

THAI NGUYEN UNIVERSITY UNIVERSITY OF AGRICULTURE AND FORESTRY LE VIET TRINH PCHARACTERIZATION AND MAP-BASED CLONING OF A NOVEL MUTANT CAUSING ABNORMAL LEAF IN Arabidopsis Thaliana BACHELOR THESIS Study Mode: Full Time Major: Biotechnology Faculty: Biotechnology & Food Technology Batch: 2012-2016 Thai Nguyen, 2016 THAI NGUYEN UNIVERSITY UNIVERSITY OF AGRICULTURE AND FORESTRY LE VIET TRINH PHENOTYPIC CHARACTERIZATION AND MAP-BASED CLONING OF A NOVEL MUTANT CAUSING ABNORMAL LEAF IN Arabidopsis Thaliana BACHELOR THESIS Study Mode: Full Time Major: Biotechnology Faculty: Biotechnology & Food Technology Batch: 2012-2016 Supervisors: Professor Soon- Ki Park Doctor Bang Phuong Pham Thai Nguyen, 2016 DOCUMENTATION PAGE WITH ABSTRACT Thai Nguyen University of Agriculture and Forestry Major Biotechnology Student name Student ID Viet Trinh Le Thesis title Supervisor(s) DTN1153150084 PHENOTYPIC CHARACTERIZATION AND MAP-BASED CLONING OF A NOVEL MUTANT CAUSING ABNORMAL LEAF IN ARABIDOPSIS THALIANA Professor Soon-Ki Park Dr Bang Phuong Pham Abstract: This study was carried out to identify the mutant gene causing Leaf Rolled Inside (LRI) phenotype of mutant line named as AP-44-1 Mutant line obviously showed curly leaf for all rosette leaves, less leaf number compared to wild type To identify mutant gene, F2 mapping population was generated for map-based cloning using SSLP markers Based on PCR analysis, the LRI gene was predicted to locate between 32160 and 32580 markers that containing 49 candidate in the region of approximately 163kb At2g32460 gene that was identified by sequencing and compared with previous report (An et al., 2014) is a strong candidate causing abnormal leaf phenotype Based on the Arabidopsis database (TAIR; http://www.arabidopsis.org), At2g32460 is the gene coding for a member of the R2R3-MYB transcription factor family and was designated MYB101 The expression and genetic complementation of At2g32460 is being carried out to investigate the responsible of gene to abnormal leaf phenotype Keyword: Arabidopsis, map-based, cloning, curly leaf, leaf-rolled inside Number of pages: 36 Date of submission: 2016/08/29 ACKNOWLEDGEMENT I would like to sincerely thank my supervisor, Prof Soon-Ki Park, for all the guidance and support me to develop an understanding of the subject I am also thankful to Dr Sung-Aeong Oh and Dr Tien- Dung Nguyen for all advices I also would like to thank MSc Thi Hoai Thuong Nguyen, MSc Hyo-Jin Park for their technical support I wish to thank to graduate students Rupesh Tayade, Saima Samin and Thu Huong Nguyen, for their help and friendship It is a pleasure to thank those who made this thesis possible to complete I would like to give a very special thanks to my supervisor committee members, Dr Bang Phuong Pham Despite the geographical distance, my family was always nearby I am grateful for their love and believing in me This thesis would not have been possible unless their support Lastly, I would like to thank Faculty of Biotechnology and Food Technology members for their support through my internship CONTENT LIST OF FIGURES i LIST OF TABLES ii LIST OF ABBREVIATIONS iii PART I INTRODUCTION PART II MATERIALS AND METHODS Plant materials and growth condition Methods 2.1 DNA extraction 2.2 Genetic analysis using SSLP markers for positional cloning of AP- 44-1 2.2.1 PCR analysis 10 2.2.2 Gel electrophoresis 10 2.3 Phenotypic characterization of a novel mutant causing abnormal leaf 11 2.4 DNA Purification 16 PART III RESULT AND DISCUSSION 18 Plant morphological analysis 18 1.1 Morphological phenotypes of AP-44-1 mutants showing defects and sterility 18 1.2 Comparative analysis of growth and biological activity 18 Fine mapping of AP-44-1 locus 21 PART IV SUMMARY AND CONCLUSION 29 REFEFENCES 30 Appendix 32 Appendix 33 LIST OF FIGURE Figure No Title Page Figure Arabidopsis Thaliana model Figure Procedure of map and clone mutation Figure Figure Arabidopsis growth room Generation of F2 mapping population 14 Figure Procedure of a typical map-based cloning experiment 15 Figure Figure Principle of PCR-based mapping using SSLP markers Steps of PCR purification 15 17 Figure Comparative analysis of the morphological phenotypes of wild-type, and AP-44-1 plants 19 Figure Plants at flower stage 20 Figure 10 Example of linkage analysis with four markers using wildtype plants in the mapping population (AP-44-1) 22 Figure 11 Example of linkage analysis with four SSLP markers to narrow down the region of mutant gene using wild-type plant in the mapping population (AP-44-1) 23 Figure 12 Result of PCR analysis with three sets of primer 32460 24 Figure 13 Schematic representation of SSLP markers positions used in the genetic mapping experiment 25 Figure 14 A schematic of the positional cloning of the AP-44-1 gene (A) and structure of candidate gene 28 i LIST OF TABLE Table No Table Table Table Title Page Primer sequences used in this study 12 Identification of chromosome containing the gene of interest Recombinants by PCR analysis of a large mapping population with flanking markers 27 28 ii LIST OF ABBREVIATIONS ADW Autoclaved distilled water Col-0 Columbia CTAB Cetyltriethy-ammonium bromide Ler-0 Landsberg erecta DNA Deoxyribonucleic acid EDTA Ethylenediaminetetraacetic acid IAA Isoamyl Alcohol LRI Leaf rolled inside PCR Polymerase Chain Reaction SSLP Simple Sequnce Length Polymophic TAE Tris-acetate-EDTA dNTPs Deoxynucleotide WB Ethanol 75% CLF Curling leaf CTAB Cetyl trimethylammonium bromide iii PART I INTRODUCTION Arabidopsis Thaliana is a small flowering plant that is widely used as a model organism in plant biology Arabidopsis has been used as an ideal model for studying the plant biology and genetics As a model organism for agricultural biotechnology, Arabidopsis presents the opportunity to provide key insights into the way that gene function can affect commercial crop production (Boyes et al., 2001) There is ample reason to believe that Arabidopsis will serve as a resource base for breeders of crop plant and as a model plant that furthers the knowledge of plant scientists (Hayashi and Nishimura, 2006) Classified in a member of the mustard and cabbage plants, Arabidopsis has several advantages that make it an excellent experimental model (Hartwell et al., 2004) Not only the smallest genome makes Arabidopsis useful for genetic mapping and sequencing, also it could be easily grown in the laboratory In addition, its small size and rapid life cycle, approximately 6-8 weeks, are also advantageous for research Finally, mutants are easily induced by treating the seeds with various chemical mutagens The surviving seeds are the germinated and mutant progeny are recovered for analysis (Hopkins et al., 2004) Over 750 natural accessions of Arabidopsis thaliana have been collected from around the world and are available from the two major seed stock centers, ABRC (Arabidopsis Biological Resource Center) and NASC (Nottingham Arabidopsis Stock Centre) These accessions are quite variable in terms of form and development (e.g leaf shape, hairiness) and physiology (e.g flowering time, disease resistance) Researchers around the world are using these differences in natural accessions to uncover the complex genetic interactions such as those underlying plant responses to environment and evolution of morphological traits While many collections of natural accessions may not meet a strict definition of an ecotype, they are commonly referred to as ecotypes in the scientific literature Figure Arabidopsis Thaliana model (TAIR) Proper leaf development is essential for plant growth and development, and leaf morphogenesis is under the control of intricate networks of genetic and environmental cues (An et al., 2014) Optimum leaf shape and size are very important for photosynthesis process that directly effect on seeds of yield and quality also Leaf physiological functions are supported by several specialized cell types, such as paired guard cells in the epidermis for gas exchange, mesophyll cells for photosynthesis, and vascular cells for internal fluid and nutrient transport As a fundamental component of the plant body, the continuous vascular network provides not only mechanical strength but also the key role of transport: the vascular tissue xylem transports water and minerals, and phloem translocates dissolved photoassimilates efficiently Leaf morphogenesis corresponds closely with genetic controls and environmental factors and often used to distinguish different plant species (Tsukaya, 2005) Over the past two decades, the isolation of leaf morphological mutants of Arabidopsis thaliana has been commonly used to further genetic studies of leaf development (Scarpella et al., 2010) through activation tagging screens, which display an intriguing upwardly curly leaf phenotype) Therefore, we recommend the use of Real-time polymerase chain reaction (RT-PCR) to confirm that the overexpression of At2g32460 led to the leaf rolled inside phenotype Figure 10 Example of linkage analysis with four markers using wild-type plants in the mapping population (AP-44-1) A Marker; nga6 (Chromosome #1) B Marker; nga168 (Chromosome #2) C Marker; nga280 (Chromosome #1) D Marker; 40750 (Chromosome #5) L Ler, C Col-0, H Heterozygous 22 Figure 11 Example of linkage analysis with four SSLP markers to narrow down the region of mutant gene using wild-type plant in the mapping population (AP-44-1) A Marker; 32160 (Chromosome #2) B Marker; 32360 (Chromosome #2) C Marker; 32360 (Chromosome #2) D Marker; 33793 (Chromosome #2) L Ler, C Col-0, H Heterozygous 23 Figure 12 Result of PCR analysis with three sets of primer 32460 W1 Wild-type sample W2 Wild-type sample L1 Ler-0 with 32460 F1-R1 primers L2 Ler-0 with 32460 F2-R2 primers L3 Ler-0 with 32460 F3-R3 primers H1 Homozygous with 32460 F1-R1 primers H2 Homozygous with 32460 F2-R2 primers H3 Homozygous with 32460 F3-R3 primers 24 Figure 13.Schematic representation of SSLP markers positions used in the genetic mapping experiment 25 Table 2: Identification of chromosome containing the gene of interest No nga63 nga280 21930 nga168 nga6 nga162 nga1107 CTR1 PHYC 40750 Chro# Chro# Chro# Chro# Chro# Chro# Chro# Chro# Chro# Chro# Line No Phenotype At1g09910 At1g55840 At2g21930 At2g39010 At3g62220 At3g13950 At4g38770 At5g03740 At5g35840 At5g40750 35% 54% 7% 3% 57% 42% 41% 38% 54% 50% N-96-2 wt C C C/L C C/L C C/L C/L L L N-96-4 wt C/L C/L C/L C C C/L C/L L C/L C/L N-96-7 wt C ND C C C/L L ND C/L L L N-96-8 wt C/L C/L C C L L C L L L N-96-14 wt C/L C/L C C/L C/L C C/L C/L C/L C/L N-96-17 wt C C/L C C C/L C/L L C C C N-96-23 wt C C/L C C L C/L C/L C/L C C N-96-28 wt L C/L C C L C L C C C N-96-31 wt C/L C/L C C C/L C C/L C/L L L 10 N-96-32 wt C/L C/L C C L C C/L C/L C/L C 11 N-96-35 wt C/L L C C C/L C/L C C C/L C/L 12 N-96-40 wt C/L ND C C C L C C C/L C/L 13 N-96-41 wt C L C C C/L C/L C C C/L C/L 9/26 12/22 2/26 1/26 15/26 11/26 10/24 10/26 14/26 13/26 26 Table 3: Recombinants identified by PCR analysis of a large mapping population with flanking markers 26870 27130 29130 30220 30680 31370 32160 32360 32580 32830 33793 Chro#2 At2g268 70 Chro#2 At2g271 30 Chro#2 At2g291 30 Chro#2 At2g302 20 Chro#2 At2g306 80 Chro#2 At2g313 70 Chro#2 At2g321 60 Chro#2 At2g323 60 Chro#2 At2g325 80 Chro#2 At2g328 30 Chro#2 At2g337 93 No Line No Phenoty pe Analysis N-99-99 Wt C N-99-100 Wt C N-100-03 Wt C C N-100-04 Wt C C N-100-15 Wt C/L N-100-18 Wt C N-100-19 Wt L L C C N-100-27 Wt C C C C N-100-29 Wt C C 10 N-100-30 Wt C C 11 N-100-31 Wt C/L C/L C/L C/L 12 N-100-34 Wt C/L C/L C C 13 N-100-35 Wt C C 14 N-100-38 Wt C C 15 N-100-43 Wt C C 16 N-100-45 Wt C C 17 N-100-53 Wt C/L C/L C/L C/L 18 N-10-58 Wt C/L C/L C C 34/1378 31/1378 14/1378 Recombinants C C C/L C C/L C C/L C C/L C/L C/L C/L C/L C/L C/L C/L C 9/1378 C C/L C/L 4/1378 C C/L C/L 2/1378 C C/L C 1/1378 C C C 0/1378 C/L C C 1/1378 C C C/L C/L C C C C C C C C 1/1378 3/1378 27 A B Figure 14 A schematic of the positional cloning of the AP-44-1 gene (A) and structure of putative gene(B) The positions of molecular markers used, the physical distances between the markers and the numbers of recombinants plants analyzed are shown (A) The arrow on the diagram of putative gene structure shows the positions of the base changes at At2g32460 E1: Exon (300bp) E2: Exon 2(858bp) E3: Exon 3(308bp) I1: Intron (108bp) I2: Intron 2(192bp) 28 PART IV SUMMARY AND CONCLUSION The AP-44-1 mutant exhibited various developmental defects such as aberrant phenotype of leaves Developmental analysis of the AP-44-1 mutant indicated that At2g32460 plays as an important role during leaf development At2g32460 locus was mapped in the 168kb region (chromosome #2) that contains 49 genes to identify of AP-44-1 mutant gene BLAST search revealed that At2g32460 gene encodes a member of the Arabidopsis transcription factors family encodes MYB transcription factor ABS7/MYB101- a member of the R2R3 factor gene family, is the cause for the abnormal leaf phenotypes Molecular cloning showed that the elevated expression of a bHLH transcription factor ABS5/T5L1/bHLH30 or a MYB transcription factor ABS7/MYB101 is the cause for the abnormal leaf phenotypes found in abs5-1D or abs7-1D, respectively (An et al.,2014) Leaf development is one of the fundamental processes ensuring robust photoautotrophic growth for higher plants and mechanisms are in place to coordinate the establishment of leaf polarities The isolation of two dominant leaf polarity mutants, abs5-1D and abs7-1D has also been reported, both displayed an ‘‘upward curly leaf’’ phenotype The An et al report the identification of two upwardly curly leaf mutants in Arabidopsis, designated abs5-1D (abnormal shoot5-1Dominant) and abs7-1D They cloned ABS5 and ABS7 and demonstrated that ABS5 encodes a bHLH transcription factor bHLH30 and ABS7 encodes a MYB transcription factor MYB101, and both ABS5 and ABS7 were targeted into the nucleus The “upward curly leaf” mutant have also been reported The leaf phenotypes of abs7-1D co-segregated with T-DNA insertion(s) Through plasmid rescue, identify a TDNA insertion 102 bp upstream of the start codon of At2g32460 Given the dominant nature of abs7-1D, the test of whether the over-expression of At2g32460 was the cause for curly leaves in abs7-1D These results indicate that enhanced expression of At2g32460 29 underlines the leaf curling inside phenotypes of abs7-1D and ABS7 is At2g32460 (An et al., 2014) These data suggested that At2g32460 is able to alter leaf lamina development and reinforce the notion that leaf epidermis plays critical roles in regulating plant organ morphogenesis It is the cause leaf rolled inside phenotype in AP 44-1 mutant line Furthermore, we recommend the use of Real-time polymerase chain reaction (RT-PCR) It is a method can be used for both qualitative and quantitative analysis, to confirm that the overexpression of At2g32460 led to the AP-44-1 phenotypes This work demonstrate the utilities of gain-of-function genetic approaches in uncovering potential regulators of plant development and this gene may be exploited in the future for generating leaf rolled inside or flowering traits variation when desired 30 REFERENCES An R., Liu X., Wang R., Wu H., Liang S 2014 The Over-Expression of Two Transcription Factors, ABS5/bHLH30 and ABS7/MYB101, Leads to Upwardly Curly Leaves PLoS ONE 9(9): e107637 Aryal S 2015 Polymerase Chain Reaction (PCR)- Principle, Procedure, Types, Applications and Animation Microbiology Notes Borevitz J.O., Xia Y., Blount J., Dixon RA., Lamb C 2000 Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis Plant Cell 12: 2383–2393 Boyes D.C, Zayed A.M, Ascenzi R, McCaskill A.J, Hoffman N.E., Davis K.R and Görlach J.2001 Growth Stage–Based Phenotypic Analysis of Arabidopsis: A Model for High Throughput Functional Genomics in Plants The Plant Cell 13: 1499–1510 Chen Y., Yang X., He K., Liu M., Li J., Gao Z., Lin Z., Zhang Y., Wang X., Qiu X., Shen Y., Zhang L., Deng X., Luo J., Deng X.W., Chen Z.,Gu H., Qu L.J 2006 The MYB transcription factor superfamily of Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family Plant Molecular Biology 60:107–124 Giraudat J., Beaudoin N., Serizet C 2006 Practical Course on Genetic and Molecular Analysis of Arabidopsis EMBO COURSE Module Hartwell L., Hood L., Goldberg M., Reynolds, A and Veres, R (2004) Genetics from Genes to Genomes 2nd ed Boston, USA: McGraw-Hill Higher Education, pp.759-784 Hayashi M., Nishimura M 2006 Arabidopsis thaliana—A model organism to study plant peroxisomes Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1763: 1382-1391 Hopkins W.G., Hüner N.P.A 2004 Plant physiology 3rd ed John Wiley&Sons Inc 10 Jander G 2006 Gene identification and cloning by molecular marker mapping Methods in Molecular Biology™ 323:115-26 31 11 Jander G., Norris S.R., Rounsley S.D., Bush D.F., Levin I.M and Last R.L 2002 Arabidopsis map-based cloning in the post-genome era Plant Physiology 129: 440450 12 Juenger T., Perez J.M., Bernal S., Micol J.L 2005 Quantitative trait loci mapping of floral and leaf morphology traits in Arabidopsis thaliana: evidence for modular genetic architecture Evolution & Development 7:3, 259-271 13 Kim G.T., Tsukaya H., Uchimiya H 1998 The CURLY LEAF gene controls both division and elongation of cells during the expansion of the leaf blade in Arabidopsis thaliana Planta 206: 175-183 14 Lodish H., Berk A., Zipursky S.L 2000 Molecular Cell Biology 4th ed New York: W.H Freeman 15 Meinke D.W., Cherry J.M., Dean C., Rounsley S.D., Koorneef M 1998 Arabidopsis Thaliana: a model plant for genome analysis Science 282: 662-665 16 Park S.K., Rahman D., Oh S.A and Twell D.2004 Gemini pollen 2, a male and female gametophytic cytokinesis defective mutation Sexual Plant Reprod 17: 6370 17 Peters J.L., Cnudde F and Gerats T.2003 Forward genetics and map-based cloning approaches TRENDS in Plant Science 8: 484-491 18 Scarpella E., Barkoulas M and Tsiantis M 2010 Control of Leaf and Vein Development by Auxin Cold Spring Harb Perspect Biol 2(1): a001511 19 Tsukaya H.2005 Leaf shape: genetic controls and environmental factors Int J Dev Biol 49: 547-555 20 Twell D., Park S.K., Hawkins T.J., Schubert D., Schmidt R., Smertenko A and Hussey P.J 2002 MOR1/GEM1 plays an essential role in the plant-specific cytokinetic phragmoplast Nature Cell Biology 4: 711-714 32 Appendix Sequencing analysis of genomic DNA of At2g32460 At2g32460 (Member of the R2R3 factor gene family-MYB101) tcttaagaccactctgtcttttctctaaggaaagaccaaagagacgagaagaagacaaaacaaggcattaatagtttaaataaagcacgtaataacaaca aattattacgtaataatttaacacaaaatttatatttcttccaaatatacaccaaacacctctaaaaaaaaattcacccttttcttctttttctctatat atctaaaatcacaacacacaaaaatactcatatatacaaaaatatatacaatatacaaacatcgtatatatcaagtaacagagagaaaaatcttttttct tcctctccttgatcggagggtcgccgtgttgaaaaggATGGATGGTGGTGGAGAGACGACGGCGACGGCTACGATGGAGGGGAGAGGGTTGAAGAAAGGG CCGTGGACAACGACGGAGGATGCGATCTTGACGGAGTACGTGAGAAAACACGGTGAAGGTAATTGGAACGCCGTGCAAAAGAACTCAGGTTTGCTCCGGT GTGGCAAAAGTTGCCGTCTACGGTGGGCGAATCATCTCCGGCCAAATCTAAAGAAAGGATCTTTTACTCCTGATGAAGAAAAGATCATCATCGACCTTCA CGCTAAGCTTGGAAACAAATGGGCTCGTATGGCTTCTCAGgttataaatttttatcataaatcttttttttcttatttcttcatttattaatttttgttt tttaaattaatcaccttatttgtttcttcaattcaagaaactagagggctttaaattttcttatatgcaatttttttttcctagttaaacacacaatttg catgattaaatgtgtttgaactttgaatctttctttctcttggcatgattaatcttgcttctctatttttttgtttgatgcttataagcatgtttttttt tttgtttttgatgtatatagTTACCTGGAAGAACAGACAATGAGATCAAGAACTATTGGAACACGAGGATGAAGAGAAGACAAAGAGCTGGTTTGCCTTT ATACCCTCATGAGATTCAACATCAAGGGATTGATATTGATGATGAGTTTGAGTTTGATTTAACTTCCTTTCAGTTCCAAAACCAAGATCTTGATCATAAC CACCAAAATATGATTCAGTACACTAATTCTTCTAATACTTCATCATCCTCGTCTTCATTCTCTTCTTCATCTTCTCAACCATCAAAAAGGCTGCGTCCTG ATCCTTTAGTCTCTACTAATCCCGGCCTAAACCCGATCCCCGATTCTTCGATGGATTTTCAAATGTTCTCTCTTTACAACAATAGCCTTGAGAATGACAA TAACCAGTTTGGTTTCTCTGTTCCTTTGTCCTCATCATCCTCGTCTAACGAGGTGTGTAATCCCAACCACATCCTTGAGTACATCTCCGAGAATTCGGAC ACAAGAAATACCAATAAGAAAGACATTGATGCTATGAGTTATAGTTCATTGCTTATGGGAGATCTTGAGATAAGATCGAGTTCTTTCCCTTTAGGACTAG ACAATAGCGTCCTAGAGCTTCCTTCAAACCAAAGACCGACCCATTCGTTCAGTTCTAGTCCTATTATTGACAATGGTGTCCATCTTGAGCCACCTTCTGG CAATAGTGGACTACTTGATGCCCTCTTGGAGGAGTCTCAAGCCTTGTCTCGAGGCGGACTCTTCAAGGACGTTAGGGTTTCCTCCAGTGACCTATGTGAG GTTCAAGATAAAAGGGTGAAGATGGACTTTGAGAATCTTTTAATAGATCATCTAAACTCTTCTAATCATTCATCATTGGgtaagcacataaaatttccca tcattttcatttataaaattctttttgttataaccgatgattttaattaatttactcaaaagtagtatggatctttggtagtatcgaagatatctactgg atcttagggctaattgactctttcattttaaatagtgtttaatagtacataacttgggttcaatgcaacagGAGCAAACCCTAATATTCACAACAAGTAC AATGAGCCAACAATGGTAAAAGTAACGGTGGATGATGATGATGAATTATTGACGAGCCTTCTCAACAACTTCCCTTCAACCACAACACCTTTGCCTGATT GGTATCGGGTGACAGAAATGCAAAACGAGGCCTCATATCTTGCCCCACCAAGTGGAATTCTTATGGGAAACCATCAAGGTAACGGCAGGGTGGAACCACC CACGGTGCCGCCTTCGTCCAGTGTAGATCCTATGGCCTCGTTGGGGTCATGCTATTGGAGCAACATGCCTAGCATCTGTTAGtttggaacctgcccatga gcaaaaatcatatttctttgatttgaaaaaaagagaaagctaattgtgagcttaacttgtgtttaatgtgtaaaatcttcttcaaagtgttttcaacttg ggatgtgctatgaactgtatgttaacatgttttcaaggaacaaaagagaaattgaaagagatgaggaatgagcatataattttcttttgggttaaagtca tggtacatatggatcttatggctgtacaagagatgtttacaagtaaaagaattgcattatacaaactgatagtttcttttatttattcattttgggacaa aacctaattttgcatttgattgttgtttagatttatcagatcctcttacacagaattttaaagttcatcatctcacaatcagttaagatttagtgaagtg • • • • • • • Translation start/stop codon: Green highlighted with white-colored capitals Exon regions: Orange colored capital Intron regions: Blue colored capital UTR regions: Red colored lower case Primer set 1: Yellow highlight Primer set 2: Brown highlight Primer set 3: Blue highlight 33 Appendix 2: List of candidate genes present in AP-44-1 mutant line No Name Putative functions At2g32160 At2g32170 At2g32179 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein S-adenosyl-L-methionine-dependent methyltransferases superfamily protein Potential natural antisense gene, locus overlaps with AT2G32180 At2g32180 Plastid transcriptionally active 18 (PTAC18); At2g32190 Unknown protein At2g32200 Unknown protein; At2g32210 Unknown protein; At2g32220 At2g32230 10 At2g32235 Ribosomal L27e protein family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, cytosolic large ribosomal subunit, intracellular, membrane; Encodes a protein-only RNase P that is involved in the 5’ cleavage of the precursor tRNAs and is able to cleave tRNA-like structures involved in the maturation of plant mitochondrial mRNAs Mutants show a drastic reduction in the levels of mature plastid tRNAPhe(GAA) and tRNA-Arg(ACG), limiting plastid gene expression Unknown protein; 11 At2g32240 12 At2g32250 13 At2g3260 14 At2g32270 15 At2g32273 16 At2g32275 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cadmium ion; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; FAR1-related sequence (FRS2); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED Phosphorylcholine cytidylyltransferase (CCT1); CONTAINS InterPro DOMAIN/s: Rossmann-like A member of Zrt- and Irt-related protein (ZIP) family transcript is induced in response to zinc deficiency in the root also response to iron deficiency Encodes a microRNA Mature sequence:GAAGGTAGTGAATTTGTTCGA Functions as a negative regulator of seed germination under salt stress conditions Expressed protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; 34 Appendix 2: List of candidate genes present in AP-44-1 mutant line(continued) 17 At2g32280 18 At2g32290 Encodes a member of a plant-specific gene family that is required for embryo provasculature development The gene product regulates vascular network complexity and connectivity in cotyledons Beta-amylase (BAM6); 19 At2g32291 Pseudogene of AT2G31470; F-box family protein 20 At2g32295 EXS (ERD1/XPR1/SYG1) family protein; 21 At2g32300 22 At2g32310 Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods CCT motif family protein; 23 Ât2g32315 Potential natural antisense gene, locus overlaps with AT2G32310 24 At2g32320 tRNAHis guanylyltransferase; 25 At2g32340 TraB family protein; 26 At2g32350 Ubiquitin-like superfamily protein; 27 At2g32360 Ubiquitin-like superfamily protein; 28 At2g32370 29 At2g32380 Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family Together with ATML1 and PDF2, it is involved in cotyledon development Transmembrane protein 97, predicted; 30 At2g32390 31 At2g32400 Encodes a ionotropic glutamate receptor ortholog, a member of a putative ligand-gated ion channel subunit family Glr5 32 At2g32410 Molybdenum cofactor biosynthesis, 33 At2g32415 34 At2g32430 Polynucleotidyl transferase, ribonuclease H fold protein with HRDC domain; Galactosyltransferase family protein; 35 At2g32440 Ent-kaurenoic acid hydroxylase (KAO2) 36 At2g32450 Calcium-binding tetratricopeptide family protein; 37 At2g32460 Member of the R2R3 factor gene family 35 Appendix 2: List of candidate genes present in AP-44-1 mutant line(continued) At2g32470 F-box associated ubiquitination effector family protein; 38 39 At2g32480 40 At2g32487 Metalloprotease essential for plastid development Located in the inner membrane of chloroplasts Unknown protein; 41 At2g32500 Stress responsive alpha-beta barrel domain protein; 42 At2g32490 Pseudogene of 3'-5' exonuclease domain-containing protein 43 At2g32510 Member of MEKK subfamily 44 At2g32520 Alpha/beta-Hydrolases superfamily protein; 45 At2g32530 Encodes a gene similar to cellulose synthase 46 At2g32540 Encodes a gene similar to cellulose synthase 47 At2g32550 Cell differentiation, Rcd1-like protein; 48 At2g32560 F-box family protein; 49 At2g32580 Protein of unknown function (DUF1068); 36 ... family-MYB101) tcttaagaccactctgtcttttctctaaggaaagaccaaagagacgagaagaagacaaaacaaggcattaatagtttaaataaagcacgtaataacaaca aattattacgtaataatttaacacaaaatttatatttcttccaaatatacaccaaacacctctaaaaaaaaattcacccttttcttctttttctctatat... aattattacgtaataatttaacacaaaatttatatttcttccaaatatacaccaaacacctctaaaaaaaaattcacccttttcttctttttctctatat atctaaaatcacaacacacaaaaatactcatatatacaaaaatatatacaatatacaaacatcgtatatatcaagtaacagagagaaaaatcttttttct tcctctccttgatcggagggtcgccgtgttgaaaaggATGGATGGTGGTGGAGAGACGACGGCGACGGCTACGATGGAGGGGAGAGGGTTGAAGAAAGGG... CACGGTGCCGCCTTCGTCCAGTGTAGATCCTATGGCCTCGTTGGGGTCATGCTATTGGAGCAACATGCCTAGCATCTGTTAGtttggaacctgcccatga gcaaaaatcatatttctttgatttgaaaaaaagagaaagctaattgtgagcttaacttgtgtttaatgtgtaaaatcttcttcaaagtgttttcaacttg ggatgtgctatgaactgtatgttaacatgttttcaaggaacaaaagagaaattgaaagagatgaggaatgagcatataattttcttttgggttaaagtca