In combination of utilizing a leader specific primer and primers complementary to porcine reproductive and respiratory syndrome virus PRRSV genome through RT-PCR, the leader junction seq[r]
(1)FULL PAPER Virology Leader-Body Junction Sequence of the Viral Subgenomic mRNAs of Porcine Reproductive and Respiratory Syndrome Virus Isolated in Taiwan Yu-Chieh LIN1), Ruey-Yi CHANG2) and Ling-Ling CHUEH1)* 1) Department of Veterinary Medicine, National Taiwan University, Taipei 106, and 2)Department of Life Science, National Dong Hwa University, Hualien 974, Taiwan (Received 20 March 2002/Accepted July 2002) ABSTRACT In combination of utilizing a leader specific primer and primers complementary to porcine reproductive and respiratory syndrome virus (PRRSV) genome through RT-PCR, the leader junction sequences of subgenomic mRNA (sg mRNA) was identified from a Taiwanese isolate of PRRSV Thirty-six cDNA clones derived from sg mRNAs 2, 3, 4, 5, and were determined The junction sequences analyzed from different sg mRNA were found to contain a similar nucleotide sequence motif, (U/G)(C/A)(A/G)CC The distance between the junction site and the translation initiation codon of the down stream open reading frame varied from to 26 nucleotides Minor heterogenecity was observed in the nucleotide sequence surrounding the junctions from all six sg mRNA analyzed However, for sg mRNA 7, two junction sites approximately 103 nucleotides apart from each other were identified The additional site is a new junction not previously reported in sg mRNA from other PRRSV strains KEY WORDS: junction sequence, porcine reproductive and respiratory syndrome virus, subgenomic mRNA, Taiwanese isolate J Vet Med Sci 64(11): 961–965, 2002 Porcine reproductive and respiratory syndrome virus (PRRSV), a pathogen that causes the disease characterized by reproductive failure in sows and gilts, pneumonia in nursery and young growing pigs, and an increasing of preweaning mortality [17] The virus was first isolated in the Netherlands in 1991 [21], and shortly thereafter in different parts of the world From the accumulated sequence data of the PRRSV around the world, two genotypes, eg the European and the North American have been recognized [10, 14] The genome of the PRRSV is a single strand of positive sense RNA 15 kb in size Nine open reading frames (ORFs) were identified and are designated 1a, 1b, 2a, 2b and through [12, 22] PRRSV was classified as a member of the family of Arteriviridae, order of Nidovirales Other viruses include in the same family are Equine arteritis virus (EAV), Lactate dehydrogenase-elevating virus (LDV) of mice, and Simian hemorrhagic fever virus (SHFV) [1] A 3’- coterminal nested set of viral subgenomic mRNAs (sg mRNA) are generated in the replication cycle for the virus in this order The sg mRNAs all contain a leader sequence derived from the 5’ end of the viral genome [7, 18] The leader sequences are connected to the mRNA bodies by a short, conserved sequence that has been identified in different arterivirus mRNAs, including EAV [6], LDV [3], SHFV [9, 24] as well as PRRSV [13, 14] Generation of the sg mRNA of the Arterivirus had recently been shown to use a discontinuous minus-strand transcription mechanism through base pairing of the conserved junction sequence [20] In addition, the local secondary RNA structure of the body in the conserved junction region has been found to be * CORRESPONDENCE TO: CHUEH, L.-L., Department of Veterinary Medicine, National Taiwan University, 142 Chou San Road, Taipei 106, Taiwan an important factor in the regulation of the discontinuous step in EAV sg mRNA synthesis [16] PRRSV associated with clinical disease was first identified from an outbreak in 1991 in Taiwan, and the virus was subsequently isolated [2] The genome sequence from ORF to ORF of this local isolate has been confirmed The results showed that Taiwanese PRRSV is much more similar to the North American strains than the Europeans [4, 5] In the present study, we report identification of the leaderbody junctions between the 5’ leader and the six (ORF to 7) sg mRNAs of our local isolate The junction sequences were compared with other PRRSV, including one Asian [19], two European [13, 15], and three American [8, 11, 14, 15] strains An additional species of sg mRNA from the transcription of ORF was identified which has never been reported from other strains of PRRSV MATERIALS AND METHODS Cells and virus: PRRSV strain tw91 (also known as MD001) was a local isolate originated from an outbreak of PRRS in the year of 1991 in Taiwan [2] The MARC-145 cells were grown in Dulbecco’s modified Eagle medium (Gibco BRL) supplemented with 1% nonessential amino acid (Gibco BRL) and 7% fetal bovine serum (Gibco BRL) The virus was cloned following three rounds of purification by limited dilution After propagation of the cloned virus, the viruses from the batch of 4th passage were used for the present study Viruses were inoculated into cells that reached 80% confluency at a multiplicity of infection of 0.1 Cells were harvested to days post-infection when cytopathic effect was clearly observable RNA extraction and RT-PCR: Total intracellular RNAs were isolated from the tw91-infected cells The cells were pelleted and resuspended in TRIzol reagent (Gibco BRL) (2) Y-C LIN, R-Y CHANG, L-L CHUEH 962 Table ORF Primer sequences used for PCR Primer sequence (5’ to 3’) CCTGGCACTGGGAGAG AGTGGCCTTCGTGGAGAG CAGAGGACGGGTTGC GACCAACTGTATCAAG CCCAGCATTTGGCACAGC CCCAGCATTTGGCACAGC with the ratio of 5–10 × 106 cells to ml TRIzol reagent for at 15–30°C Chloroform (0.2 ml/1 ml TRIzol reagent) and isopropyl alcohol (0.5 ml/1 ml TRIzol reagent) were added to deposit the RNA RNA was spun down at 12,000 × g for 10 at 4°C, washed with 75% alcohol and air-dry To analyze the sg mRNAs, cDNA fragments specific for each of the ORFs through were amplified by RT-PCR Cellular RNA was reverse transcribed with SuperScript II RT (Gibco BRL) Primer used for reverse transcription was 5’TTGCTGGGCGATGATCTTA3’, an oligonuleotide complementary to the genome sequence of ORF (81 nt to 99 nt) of tw91 The forward PCR primer was a published oligonucleotide I M755 (5’GACTGCTTTACGGTCTCTC3’), specific for the leader sequence of VR2332 [11] The reverse PCR primers for each mRNA were situated downstream of the first codon The design of the reverse primers specific to each mRNA was based on the genomic sequence data of tw91 (GenBank accession no AF121131) Detailed primer sequences for each mRNA and their distance to initiation codon were listed in Table Amplification was performed with TaqPlus® Precision PCR System (Stratagene) under the following conditions: denaturation of dsDNA for 1.5 at 94°C, annealing of the primers for at 58°C and primers extention for 2.5 at 72°C The number of cycles was 35 cDNA cloning and sequence analysis: The results of the PCR amplification were analyzed by electrophoresis After the amplification, DNA fragments with distinct sizes were excised from the agarose gel and extracted by GFXTM PCR Distance to initiation codon (nt) Size of amplified cDNA fragment (nt) 250 309 181 278 593 80 302 425 217 351 643 236/341 DNA and Gel band purification kit (Amersham) The purified DNA fragments were then ligated to plasmid pCR TMII (Invitrogen®) and introduced to E coli DH5α using standard protocol Four to eight cDNA clones from each sg mRNA were isolated and the inserted DNA was sequenced with an automated DNA sequencer (Applied Biosystem) The leader-mRNA junction sequences were determined by comparing the 5’-terminal sequence of the sg mRNAs and the genomic sequences RESULTS Thirty-six clones derived from the amplification of sg mRNAs to were sequenced and analyzed The size and location of the cDNA clones in related to the genomic ORF were summarized in Fig In comparison with genomic sequence of tw91, the junction sites for each sg mRNA were determined (Table 2) More than one groups of sg mRNA were detected for each ORF The junction sequences of the six sg mRNAs shared a common sequence of five nucleotides, represented by (U/G)(C/A)(A/G)CC The last two nucleotides CC of this motif were identical in all sequenced clones The junction of leader to the genomic sequence of the sg mRNA to were uaually occur at the specific sites, except for sg mRNA In sg mRNA 7, two species of cDNA clones were isolated One junction site for sg mRNA 7, UAACC, is 123 nucleotides (group A & B) upstream to the start codon AUG of ORF7 The other site, UCACC, located approximately 103 nucleotides apart from the first one is Fig Schematic representation of the genome organization of PRRSV tw91 ORFs and cDNA clones generated by reverse transcription RNA extracted from days of PRRSV infected-MARC 145 cells were reverse transcribed by oligo d(T) The leader specific primer used for cloning was IM755 (Meng et al., 1996); other tw91 specific oligonucleotides targeted to each sg mRNA were listed in Table (3) JUNCTION OF sg mRNA FOR A TAIWANESE PRRSV Table 963 Sequence of the leader-body junction region of subgenomic RNA to of PRRSV tw91 sgRNA 7-1 Sequencea) Junction nucleotidesb) No of clones c) Group A Group B Genome CUCCACCUCUUGAACCAACUUU CUCCACCUCUCGAACCAACUUU UGAACCAACUUU Group A Group B Genome CUCCACCUCUGUAACCAUAGUG CUCCACCUCUUUAACCAUAGUG AGGGUCAAAUGUAACCAUAGUG Group A Group B Genome CUCCACCUCUUUCACCUGGAAU CCACCUCUGUUUCACCUGGAAU GGCAACUGGUUUCACCUGGAAU Group A Group B Group C Genome CUCCACCUCUUUUUAGCCUGUC CUCUCCACCUUUUUAGCCUGUC CUCUCCACCUCUUUAGCCUGUC GGGGCGACUGUUUUAGCCUGUC 1 Group A Group B Genome CUCCACCUCUGUAACCAGAAUU CUCCACCUCUUUAACCAGAAUU GGCAACCCCUGUAACCAGAAUU Group A Group B Genome Group A Genome CUCCACCUCUAUAACCACGCAU CUCCACCUCUUUAACCACGCAU GCGGCAAGUGAUAACCACGCAU CUCCACCUCUUCAUCACCUCUA ACCUGGAGAUUCAUCACCUCUA Positiond) 20 83 40 17 123 226 a) Different group represent cDNA clones identified for each subgenomic RNA that containing the same junction sequence b) The nucleotides identical between the genome and subgenomic RNAs are underlined c) The number of cDNA clones of each group that was isolated d) Distance in nucleotides between the junction motif and the initiation codon of the downstream open reading frame Table Sequence of the leader-body junction sites of subgenomic RNA of known PRRSV strains sgRNA Virus tw91 VR2332 VR2332 (variant) ISU79 ISU1894 EDRD-1 Lelystad 111/92 a) References GAACC GAACC UAACC UAACC 3-1 UAACC 4-1 5-1 UCACC UCACC CAGCC UAGCC UAGCC UAGUC UAACC UAACC UAACC UAACC UAACC 7-2 UCACC AAACC AAACC AAACC Nelsen Faaberg Oleksiewicz Meng UCACC UGACC AAACC AACCC UGACC UGACC CAACC CAACC UAGCC CAACC AACC UAACC CAACC CAACC UAACC UAACC UAACC Consensus GAACC Consensus –A–CC UAACC U–ACC UCACC – –ACC UAGCC –A–CC UAACC –AACC UAACC UAACC b) 7-1 Saito Meulenberg Oleksiewicz a) Consensus among viruses of North American genotype, including VR2332, ISU79, ISU1894, EDRD-1, and tw91 b) Consensus among all viruses list above 226 nucleotides upstream to the start codon of ORF7 (sg mRNA 7-1, Table 2) The available junction sequences of PRRSV isolates from around the world, including the Japanese EDRD-1, the American VR2332, ISU79 and ISU1894, the Dutch Lelystad, the Danish 111/92, and our tw91 were aligned in Table While comparing the junction sequences of the viruses from North American genotypes (EDRD-1, VR2332, ISU79, ISU1894, and tw91), a pentanucleotide motif for each sg mRNA were found identical from mRNA through (Table 3) When the two European strains were aligned for the further comparison, only junction sequence for ORF (4) 964 Y-C LIN, R-Y CHANG, L-L CHUEH remains conserved (UAACC) The other junction sites appeared to show some variation (Table 3) A second junction site was reported from the VR2332 strain [8] and its variant [15] for the transcription of ORF (sg mRNA 7–1, Table 3) However, the junction sequence (UAAACC) is different from ours (AUCACC, tw91 sg mRNA 7–2, Table3) and the position of the junction to the start codon of ORF were and 226 nucleotides of VR2332 and tw91, respectively DISCUSSION The alignment of all the junction sequences studied update revealed that there are actually only two nucleotides (CC) remained invariably conserved in all PRRSV isolates for all species of sg mRNA The two strictly conserved Cs are located in the last two nucleotide of the junction motif (Table 3) The last nucleotide of the leader-mRNA junction motif has been suggested to be critical for the binding of the leader and for the initiation of transcription [11] The results from the present study suggest that not only the last nucleotide but the one upstream to it may be equally important The identification of more than one species of sg mRNA from PRRSV has been reported in the transcription of other sg mRNA Meng et al in 1996, reported an additional species of sg mRNA from isolate ISU 79 Besides the common site (GUAACC) noted in other isolates of North American genotypes, a second site (UUGACC) was found (Table 3) By comparison of the genomic sequences of ISU79 with other US isolates, a point mutation in the genome located at the last nucleotide of the junction motif, was identified which led to the acquisition of the additional leader mRNA junction sequence Nelsen et al in another study of leader-body junction sequences using the American PRRSV prototype virus VR2332 identified additional junction site for mRNA and (Table 3) In the study of sg RNA transcripts from VR2332 infected cells similar finding were reported [8, 14, 15] The major species of junction sequence that was identified in all the PRRSV strains studied up dated is located 123 nt upstream of the AUG start site The second species is located nt [8, 14] or 10 nt [15] upstream of the AUG start site In addition to the two species of junction for sg RNA 7, the third junction identified in the present study is a novel one located 226 nt upstream of the AUG start site These finding clearly indicated the utilization of another junction site for the transcription of sg RNA for PRRSV Comparing the junction sequence of sg mRNA to of tw91 with those of LV: (U/A)(C/U/A)(A/G)ACC; the US VR2332: (U/G/A)(U/G)(A/C)(A/G)CC; US:U(G)UA(G/ C)ACC; EDRD-1 strain isolated in Japan: UA(A/G)CC, all the junction sequences exhibit some similarity with one another, especially between EDRD-1 and our tw91 strains The junction sequences of sg mRNA 5, and determined from a Japanese isolate EDRD-1 were identical to our tw91 [19], however, the second junction site for sg m RNA 7-1 identified in our study was not found in EDRD-1 Minor heterogenecity was observed in the nucleotide sequence surrounding the junctions from all six sg mRNA analyzed It is difficult to determine exactly which nucleotide is derived from the leader and which nucleotide is derived from the genomic RNA For example, the junction sequence of sg mRNA could be a longer sequence of CUGUAACC and the sg mRNA7–1 could be of UUCAUCACC (Table 2) The heterogenecity revealed that the fusion of the leader to the body of sg RNA of PRRSV might be imprecise By analyzing more clones, variety in the junction sequence may be seen more clearly The sg mRNAs are believed to be formed by a discontinuous transcription mechanism that appears to involve sense and antisense base pairing of transcription-regulating sequences [20] Recently an atypical sg RNAs that contain open reading frame 1a, termed heterocilte (meaning “deviating from common forms or rules”) sg RNAs were found to produce during PRRSV infection [23] The expression of these novel RNA species supports another template-switching model of similarity-assisted RNA recombination for the transcription of PRRSV ACKNOWLEDGMENTS The authors would like to thank Taiwan Pig Research Institute for providing the PRRS virus This work was supported by National Science Council of Republic of China (NSC85–2321-B-002–066-A13) REFERENCES Cavanagh, D 1997 Nidovirales: a new order comprising Coronaviridae and Arteriviridae Arch Virol 142: 629–633 Chang, C C., Chung, W B., Lin, W M., Weng, C N., Yang, P C., Chiu, Y T., Chang, W F and Chu, R M 1993 Porcine reproductive and respiratory syndrome (PRRS) in Taiwan I Viral isolation J Chin Soc Vet Sci 19: 268–276 Chen, Z., Kuo, L., Rowland, R R R., Even, C., Faaberg, K S and Plagemann, P G W 1993 Sequences of 3’ end of genome and 5’ end of open reading frame 1a of lactate dehydrogenaseelevating virus and common junction motifs between 5’ leader and bodies of seven subgenomic mRNAs J Gen Virol 74: 643–660 Chueh, L L., Lee, K H., Wang, F I., Pang, V F and Weng, C N 1998 Sequence analysis of the nuclecapsid protein gene of the porcine reproductive and respiratory syndrome virus Taiwan MD-001 strain Adv Exp Med Biol 440: 795–799 Chueh, L L and Lee, K H 2001 Sequence analysis of two membrane associated protein genes of porcine reproductive and respiratory syndrome virus, Taiwan MD-001 strain J Chin Soc Vet Sci 27: 80–88 de Boon, J A., Kleijnen, M F., Spaan, W J M and Snijder, E J 1996 Equine arterivirus subgenomic mRNA synthesis: analysis of leader-body junctions and replicative-form RNAs J Virol 70: 4291–4298 de Vries, A A F., Chirnside, E D., Bredenbeek, P J., Gravestein, L A., Horzinek, M C and Spaan, W J M 1990 All subgenomic mRNAs of equine arteritis virus contain a common leader sequence Nucleic Acids Res 18: 3241–3247 Faaberg, K S., Elam, M R., Nelsen, C J and Murtaugh, M P 1998 Subgenomic RNA is transcribed with different leaderbody junction sites in PRRSV (strain VR 2332) infection of (5) JUNCTION OF sg mRNA FOR A TAIWANESE PRRSV 10 11 12 13 14 15 16 CL2621 cells Adv Exp Med Biol 440: 275–279 Godeny, E K., de Vries, A A F., Wang, X C., Smith, S L and de Groot, R J 1998 Identification of the leader-body junctions for the viral subgenomic mRNAs and organization of the simian hemorrhagic fever virus genome: evidence for gene duplication during arterivirus evolution J Virol 72: 862–867 Meng, X J., Paul, P S., Halbur, P G and Lum M A 1995 Phylogenetic analysis of the putative M (ORF 6) and N (ORF 7) genes of porcine reproductive and respiratory syndrome virus (PRRSV): Implication for the existence of two genotypes of PRRSV in the U.S.A and Europe Arch Virol 140: 745– 755 Meng, X J., Paul, P S., Morozov, I and Halbur, P G 1996 A nested set of six or seven subgenomic mRNAs is formed in cells infected with different isolates of porcine reproductive and respiratory syndrome virus J Gen Virol 77: 1265–1270 Meulenberg, J J M., Hulst, M M., de Meijer, E J., Moonen, P L., den Besten, A., de Kluyver, E P., Wensvoort, G and Moormann, R J M 1993a Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV and EAV Virology 192: 62–72 Meulenberg, J J M., Meijer, E J D and Moormann, R J M 1993b Subgenomic RNAs of Lelystad virus contain a conserved leader-body junction sequence J Gen Virol 74: 1697– 1701 Nelsen, C J., Murtaugh, M P and Faaberg, K S 1999 Porcine reproductive and respiratory syndrome virus comparison: divergent evolution of two continents J Virol 73: 270–280 Oleksiewicz, M B., Botner, A, Nielsen, J and Storgaard, T 1999 Determination of 5’-leader sequences from radically disparate strains of porcine reproductive and respiratory syndrome virus reveals the presence of highly conserved sequence motifs Arch Virol 144: 981–987 Pasternak, A O., Gultyaev, A P., Spaan, W J and Snijder, E J 2000 Genetic manipulation of arterivirus alternative mRNA leader-body junction sites reveals tight regulation of structural 17 18 19 20 21 22 23 24 965 protein expression J Virol 74: 11642–11653 Rossow, K D 1998 Review article: porcine reproductive and respiratory syndrome Vet Pathol 35: 1–20 Snijder, E J and Meulenberg, J J M 1998 The molecular biology of arteriviruses J Gen Virol 79: 961–979 Saito, A., Kanno, T., Murakami, Y., Muramatsu, M and Yamaguchi, S 1996 Characteristics of major structural protein coding gene and leader-body sequence in subgenomic mRNA of porcine reproductive and respiratory syndrome virus isolated in Japan J Vet Med Sci 58: 377–380 van Marle, G., Dobbe, J C., Gultyaev, A P., Luytjes, W., Spaan, W J M and Snijder, E J 1999 Arterivirus discontinuous mRNA transcription is guided by base pairing between sense and antisense transcription-regulating sequences Proc Natl Acad Sci 96: 12056–12061 Wensvoort, G., Terpstra, C., Pol, J M., ter Laak, E A., Bloemraad, M., de Kluyver, E P., Kragten, C., van Buiten, L., den Besten, A., Wagenaar, F., Broekhuijsen, J M., Moonen, P L J M., Zetstra, T., de Boer, E A., Tibben, H J., de Jong, M F., van't Veld, P., Groenland, G L R., van Gennep, J A.,Voets, M T., Verheijden, J H M and Braamskamp, J 1991 Mystery swine disease in the Netherlands: the isolation of Lelystad virus Vet Q 13: 121–130 Wu, W H., Fang Y., Farwell, R., Steffen-Bien, M., Rowland, R R R., Christopher-Hennings, J and Nelson, E A 2001 A 10-kDa structural protein of porcine reproductive and respiratory syndrome virus encoded by ORF2b Virology 287: 183– 191 Yuan, S., Murtaugh, M P and Faaberg K S 2000 Heterolite subgenomic RNAs are produced in porcine reproductive and respiratory syndrome virus infection Virology 275: 158–169 Zeng, L., Godeny, E K., Methven, S L and Brinton, M A 1995 Analysis of simian hemorragic fever virus (SHFV) subgenomic RNAs, junction sequences, and 5’ leader Virology 207: 543–548 (6)