Dehydration-responsive element-binding (DREB) proteins play a critical role in the plant’s droughttolerance mechanism despite their presence in minor amounts in the cell. In this study, a maize-derived transcription factor protein, ZmDREB2.7, was overexpressed in the Escherichia coli strain Rosetta 1. The interested gene conjugating with the thioredoxin gene (TrxA) and his6 tag in the pET-32a vector encoded a 55.7 kDa fusion protein. The optimum condition for inducing the thioredoxin-his6 -ZmDREB2.7 expression was five hours of induction with 0.05 mM IPTG at 300 C. The Tris-HCl 20 mM pH 8.0 lysis buffer was harnessed to extract the recombinant protein for the purification process. Using the immobilized-metal affinity chromatography column, the recombinant protein was purified and then injected into rabbits. The antisera containing polyclonal antibodies (pAbs) could specifically recognize the ZmDREB2.7 fusion protein. This study represents updated data on the bacterial expression of the recombinant ZmDREB2.7 protein and the production of anti-ZmDREB2.7 pAbs.
Life Sciences | Agriculture Doi: 10.31276/VJSTE.61(1).23-29 Expression and purification of thioredoxin-his6-ZmDREB2.7 fusion protein in Escherichia coli for raising antibodies Thuy Linh Nguyen1, 2, Thuy Duong Nguyen1, Van Hai Nong1, Thi Thu Hue Huynh1* Institute of Genome Research, Vietnam Academy of Science and Technology University of Science, Vietnam National University, Hanoi Received August 2018; accepted 23 November 2018 Abstract: Introduction Dehydration-responsive element-binding (DREB) proteins play a critical role in the plant’s droughttolerance mechanism despite their presence in minor amounts in the cell In this study, a maize-derived transcription factor protein, ZmDREB2.7, was overexpressed in the Escherichia coli strain Rosetta The interested gene conjugating with the thioredoxin gene (TrxA) and his6 tag in the pET-32a vector encoded a 55.7 kDa fusion protein The optimum condition for inducing the thioredoxin-his6-ZmDREB2.7 expression was five hours of induction with 0.05 mM IPTG at 300C The Tris-HCl 20 mM pH 8.0 lysis buffer was harnessed to extract the recombinant protein for the purification process Using the immobilized-metal affinity chromatography column, the recombinant protein was purified and then injected into rabbits The antisera containing polyclonal antibodies (pAbs) could specifically recognize the ZmDREB2.7 fusion protein This study represents updated data on the bacterial expression of the recombinant ZmDREB2.7 protein and the production of anti-ZmDREB2.7 pAbs The ZmDREB2.7 protein belongs to the DREBs transcription factor family that involved in the plant abiotic resistance mechanism The DREB transcription factors can be classified into two groups based on the protein structure: DREB1, and DREB2, despite the fact that they both contain an AP2 DNA-binding domain In fact, DREB proteins bind specifically to the dehydration-responsive element (DRE) which contains a core motif of A/GCCGAC locating in the promoter region of many genes induced by drought and/ or cold [1] The DREB2 proteins and their coding genes were characterized in different species In Arabidopsis thaliana, DREB2A and DREB2B are induced by osmotic stress and high temperature Transgenic A thaliana plants overexpressing AtDREB2A CA, which was AtDREB2A with a deletion of the negative regulatory domain, showed an improved stress tolerance to drought and heat-shock stresses [2, 3] An OsDREB2B gene isolated from rice enhanced drought and cold tolerance in transgenic plants without any phenotypic changes [4] Meanwhile, a PeDREB2 gene from the desert-grown tree (Populus euphratica) was reported to be induced by cold, drought, and high salinity conditions and PeDREB2 could specifically bind to the DRE element in the promoter region of many stress-driven genes [5] In addition, the transient expression of PeDREB2 in onion epidermis cells showed that the protein localized to the nucleus which confirmed that DREB proteins act as a transcription factor [5] Pandey and colleagues [6] built a model of a wheat DREB2 protein (Triticum aestivum L.) and reported that the protein interacts with the major DNA grove through its β-sheets Keywords: E coli, fusion expression, recombinant protein, ZmDREB2.7 protein Classification number: 3.1 In maize (Zea mays L.), a genome-wide analysis [1] successfully identified and cloned 18 ZmDREB genes (10 ZmDREB1 genes and ZmDREB2 genes) Among them, *Corresponding author: Email: hthue@igr.ac.vn March 2019 • Vol.61 Number Vietnam Journal of Science, Technology and Engineering 23 Life Sciences | Agriculture ZmDREB2.7 was reported as the most potential gene for crop improvement by marker-assisted breeding and genetic engineering ZmDREB2.7-Tv is a gene isolated from Tevang maize cultivar which exhibits a good tolerance with drought and cold conditions Originally, the DREB transcription factors are present in a small amount in the plant cells In addition, the ZmDREB2.7 protein is induced mainly when a plant confronts osmotic stress [1] In order to clarify the role of ZmDREB2.7 protein involvement in drought tolerance, it is necessary to obtain the protein in a high quantity with good quality Therefore, the heterologous expression of the DREB2.7 in bacteria brings advantages A high amount of the ZmDREB2.7 protein could be used for understanding the characteristics of the protein In addition, anti-ZmDREB2.7 polyclonal serum can be employed to detect the presence of the specific ZmDREB2.7 protein Heterologous protein expression in other host systems has been harnessed for the production of many plant proteins [7] Due to the fact that the protein isolation from the plant is high-cost, labor-intensive, time-consuming, and low-quantity, bacterial expression systems offer a promising alternative In fact, the plant proteins produced by bacteria were widely employed for research, therapy, and industrial applications The popularity of using E coli as a workhorse for synthesizing plant protein is a result of its rapid growth at high-cell density on an inexpensive carbon source, well-known genetics, and the commercial availability of enormous expression vectors and strains However, challenges faced when using bacterial systems to express eukaryotic proteins are lack of post-translation modification and formation of inclusion bodies containing inactive proteins [8] These causes can be classified into two categories: those that are in the gene sequences and those that are the limitations of the E coli [8] Fortunately, a number of literature reviews provided comprehensive knowledge to optimize the procedures and parameters involved in the bacterial heterologous protein expression and the purification process [7-11] In order to troubleshoot the aforementioned problems, the recombinant host, the strain, the expression vector, the inducing conditions, and the approach to modifying the coding sequence of the interested protein should be carefully considered The immunization of animals to induce an immune response is a procedure performed routinely worldwide The process produces antibodies against a specific antigen in laboratory animals such as mice, rabbits, and chickens Among them, mice and rabbits are the most frequent species used for antibody production Depending on the desired application and the availability of time and money, scientists may choose between generating monoclonal antibodies (mAbs) or polyclonal antibodies (pAbs) Production of 24 Vietnam Journal of Science, Technology and Engineering mAbs is a labor-intensive and time-consuming work In addition, generation of mAbs comprises cell culture which requires high financial investment, but a low titer of mAbs can be obtained Meanwhile, the induction of pAbs usually takes 4-8 weeks with high titer In fact, polyclonal antiserum can be obtained with inexpensive procedures and instruments Therefore, the pAbs is suitable for many applications and is favored by many scientists [12] In this study, we introduced the ZmDREB2.7 gene into the pET-32a expression vector to generate the thioredoxinhis6-ZmDREB2.7 fusion protein The recombinant ZmDREB2.7 fusion protein was overexpressed, purified and used for raising polyclonal antibodies Materials and methods Construction of the recombinant expression vector The coding sequence of ZmDREB2.7 originated from maize was cloned into the pJET1.2 vector at Genome Biodiversity Laboratory, Institute of Genome Research In order to enable cloning the gene into the pET-32a expression vector, two primers (Zm2.7 BamHI F: 5’ TAGTCGGATCCGATCGGGTGCCGC - 3’, Zm2.7 EcoRI R: 5’- CGACGAGAATTCTAAAGAGGGACGACGA 3’) were designed with EcoRI and BamHI restriction sites at the 5’ and 3’ end, respectively The PCR reaction using the primer pair was conducted with the total volume of 25 µl which contains 12.5 µl 2X Thermo Scientific DreamTaq PCR Master Mix, µl of 10 µM each primer, µl of 10 µg/µl pJET1.2+ZmDREB2.7 plasmid, 0.8 µl of DMSO, and 8.7 µl ddH2O The temperature conditions were as follows: at 94°C followed by 35 cycles of 45 sec at 94°C, 45 sec at 56°C and 10 sec at 72°C, then a final extension of at 72°C The PCR product of approximately 1.1 kb long was digested with EcoRI and BamHI restriction enzymes, and the same to the pET-32a expression vector The two digested fragments, one of ZmDREB2.7 and one of the linearized pET-32a plasmid in which both flanked by EcoRI and BamHI restriction sites, were ligated using standard molecular biology techniques [13] The identity of clones harboring the pET-32a+ZmDREB2.7 plasmid was identified by restriction enzymes-based screening and confirmed by sequencing Expression of thioredoxin-his6-ZmDREB2.7 in E coli The pET-32a+ZmDREB2.7 expression vector was transformed into the E coli strain Rosetta A transformed colony was used to optimize the heterologous protein expression as followed the isopropyl-β-D-thiogalactopyranoside (IPTG)-induce protocol [13] A colony was inoculated in ml of LB medium supplied with 50 mg/l ampicillin with 200 rpm shaking overnight at 37°C March 2019 • Vol.61 Number Life Sciences | Agriculture The 16-hour culture was transferred into fresh 25 ml of LB medium containing 50 mg/l ampicillin to achieve the final OD600 of 0.1 The culture was incubated with 200 rpm shaking at 37°C When the culture’s OD600 reached 0.6-0.8, the transformant was induced by adding 0.1M IPTG with an appropriate final concentration After five hours, cells in ml of the induced culture were collected by centrifuging at 5,000 rpm for The cell pellets were suspended with the same volume of lysis buffer and stored at -20°C until further processing Cell extract was prepared using the freeze-thaw protocol with Qsonica Q55-220 Sonicator Ultrasonic Processor (Cole-Parmer®) on ice [13] The condition for sonication step was as follows: five cycles of 30 sec with a rest period of between cycles One hundred µl of lysate was transferred into a new tube as the total protein sample The cell lysate was separated by centrifuging at 10,000 rpm for at 4°C The soluble protein fraction as the supernatant was collected The bacterial cell debris was resuspended in 900 µl lysis buffer and treated as the insoluble protein fraction Purification of the fusion protein The large-scale soluble protein fraction was prepared as described above then added with 500 mM NaCl and filtered through a 0.45 μm syringe filter The his6-tag protein was purified using the ml HisTrap™ HP columns (GE Healthcare, Piscataway, NJ, USA) by following the manufacturer’s instruction The solution flowed through the column at the speed of 0.5 ml/min The protein sample was loaded on the column and washed with 25 ml washing buffer (20 mM Tris HCl, 100 mM NaCl, 50 mM Imidazole, pH 8.0) The protein was eluted by applying 10 ml elution buffer (20 mM Tris HCl, 100 mM NaCl, 250 mM Imidazole, pH 8.0) All fractions containing the fusion protein were analyzed by SDS-PAGE The eluted fractions then were applied with Microcon® centrifugal filter (Millipore, MA, USA) for desalting and concentrating, and then used as an antigen for injection into rabbits Raising of polyclonal antibodies Two healthy 3-month-old rabbits used for immunization were provided by Vetvaco National Veterinary Joint-Stock Company (VETVACO., JSC), and weighed about 2.53.0 kg at the time of acquisition The pAbs production procedure and laboratory animals care were adopted from the CCAC guidelines on antibody production by the Canadian Council on Animal Care (CCAC) with some modifications (https://www.ccac.ca/Documents/Standards/ Guidelines/Antibody_production.pdf) Rabbits were given intramuscular injections at one site on their limbs and subcutaneous injection at five sites on their backs The first priming injection was performed with a low dose of 0.25 mg/ml purified recombinant ZmDREB2.7 protein (Antigen-Ag) emulsified in Freund’s Complete Adjuvant (FCA) After that, the rabbits received three additional injections with raising concentrations of Ag 0.5 mg/ ml, 0.75 mg/ml, and 0.1 mg/ml in Freund’s Incomplete Adjuvant (FIA), respectively Each additional injection was administered at 10-day intervals Bleeding was implemented from ear veins three times, seven days after each administered day and the last time at day 10 of the final injection Rabbit blood was collected into a sterile 15 ml centrifuge tube and placed at room temperature for 30 followed by incubating at 4°C for one hour The antiserum was collected by centrifuging the blood tubes at 5,000 rpm for 10 at 4°C then pipetting the supernatants into new tubes and stored at 4°C Agglutination test was conducted by mixing 20 µl of antiserum and Ag on a sterile plate The plate was placed at room temperature for 10 After that, if the collected serum contained pAbs of a specific Ag, white clumps could be observed SDS-PAGE and dot blot analysis The SDS-PAGE analysis was conducted using TrisGlycine Gel, including a separate gel of 12.6% and a stacking gel of 5%, with the Bio-Rad system according to the manufacturer’s instructions Protein was then electrophoresed using a Bio-Rad PowerPac Basic Mini Electrophoresis system (Bio-Rad), for 35 at 200 V Protein was visualized by Coomassie blue staining For dot blot analysis, a range of concentration of the purified recombinant ZmDREB2.7 protein (from mg/ml to mg/ml) was loaded onto nitrocellulose membrane by pipetting The membrane was dried at room temperature for about 20 and incubated with a 1:8 dilution of rabbit serum containing anti-ZmDREB2.7 antibodies After that, the primary antibody was recognized by the secondary antibody Goat Anti-Rabbit IgG (whole molecule)-Alkaline Phosphatase (Sigma-Aldrich), and the membrane was exposed to 1-StepTM NBT/BCIP substrate solution (Thermo Fisher Scientific) Results Construction of the recombinant expression vector The recognition sites of restriction enzyme EcoRI and BamHI were introduced at the 5’ and 3’ ends of ZmDREB2.7 gene, respectively, in order to clone the gene into the pET32a plasmid (Fig 1A) The ZmDREB2.7 gene was designed to be in frame with TrxA (thioredoxin) gene and fused with March 2019 • Vol.61 Number Vietnam Journal of Science, Technology and Engineering 25 Life Sciences | Agriculture his6 tag sequence for a further purification experiment (Fig 1A) Thus, the expected thioredoxin-his6-ZmDREB2.7 fusion protein contains 522 amino acids and has a theoretical weight of 55.7 kDa By mean of PCR with two specific primers, Zm2.7 BamHIF and Zm2.7 EcoRIR, the approximately 1089 bp-long coding sequence of ZmDREB2.7 was successfully amplified from the cloning vector pJET1.2+ZmDREB2.7 (Fig 1B) The PCR product was double digested with two mentioned restriction enzymes, and the vector pET-32a was linearized using the same enzymes (Fig 1C) The ligation product of the two digested samples was transformed into the DH10β competent cells We isolated plasmids from six random colonies and characterized by electrophoresis on 1% agarose gel As shown in Fig 1D, all plasmid bands obtained from putative recombinant clones were higher than the empty vector pET-32a The recombinant vectors were verified by restriction enzyme-based screening (Fig 1E) and confirmed by sequencing (data not shown) Taken together, we successfully constructed the pET-32a+ZmDREB2.7 bacterial expression vector Expression of thioredoxin-his6-ZmDREB2.7 in E coli The pET-32a+ZmDREB2.7 recombinant vector was transformed into the competent E coli strain Rosetta 1, and a number of recombinant colonies were obtained At first, we accessed the solubility of four different lysis buffers based on Tris buffer and Phosphate buffer to the heterologous protein (data not shown) The result showed that most of the proteins produced by the recombinant strain (about 9095%) were in the soluble protein fraction The Tris-HCl pH 8.0 buffer was chosen for subsequent experiments due to the highest solubility to the fusion protein Other factors affecting protein expression-including time of induction, temperature, and IPTG’s concentration were examined (Figs 2A-2C) As expected, the expression of the recombinant protein increased over time and reached the highest level after five hours (Fig 2A) However, the production of the fusion protein was not influenced by the tested concentration of IPTG as the intensity of bands representing the interested protein was nearly the same in all lanes on the SDS-PAGE gel (Fig 2C) The same situation was observed when inducing protein expression at 30°C Fig Construction of the pET-32a+ZmDREB2.7 expression vector (A) schematic illustration of the pET-32a+ZmDREB2.7 expression vector; (B) PCR amplification of ZmDREB2.7 fragment flanked by EcoRI and BamHI recognition sites 1: product of PCR using pJET1.2+ZmDREB2.7 as the template; (C) double digestion of DNA with EcoRI and BamHI, 1: PCR products amplifying ZmDREB2.7 gene from pJET1.2+ZmDREB2.7, 2: the pET-32a plasmid; (D) plasmid isolation from bacteria colonies 1: the pET-32a vector, 2-7: plasmids isolated from six putative recombinant colonies, respectively; (E) restriction enzyme-based screening of putative recombinant colonies 1: the pET-32a vector, 2-7: plasmids isolated from six putative recombinant colonies, respectively M: marker kb plus (Thermo Fisher Scientific) 26 Vietnam Journal of Science, Technology and Engineering March 2019 • Vol.61 Number Life Sciences | Agriculture and 37°C (Fig 2B) Taken together, the optimum condition established to produce the thioredoxin-his6-ZmDREB2.7 fusion protein was five hours of induction using 0.05 mM IPTG at 30°C (Fig 2D) Fig Purification of the thioredoxin-his6-ZmDREB2.7 fusion protein using HisTrap™ HP columns M: Thermo Scientific™ Pierce™ Unstained Protein Molecular Weight Marker 1: the soluble fraction of the recombinant E coli strain 2: the flow through from column 3: elute after washing with 50 mM Imidazole 4-10: fractions after applying the elution buffer containing 250 nM Imidazole The arrow indicates the interested protein Raising of anti-ZmDREB2.7 fusion protein polyclonal antibodies Fig Expression of the thioredoxin-his6-ZmDREB2.7 fusion protein (A) effect of induction period on the expression of the fusion protein 1-4: 0h, 1h, 3h, 5h after adding IPTG, respectively; (B) effect of temperature on the expression of the fusion protein 1: 250C, 2: 300C, 3: 370C; (C) effect of IPTG’s concentration on the expression of the fusion protein 1-6: IPTG of 0.05, 0.1, 0.25, 0.5, 0.75, 1.0 mM, respectively; (D) overexpression of the recombinant protein in the E coli strain Rosetta harboring the pET-32a+ZmDREB2.7 vector 1: optimized induction conditions 2: without IPTG M: Thermo Scientific™ Pierce™ Unstained Protein Molecular Weight Marker The arrow indicates the interested protein Purification fusion protein of the The protein after the purification step was used for injection into two rabbits via the procedure described above The agglutination test was implemented using sera from the two rabbits against the purified recombinant ZmDREB2.7 fusion protein The assays were conducted seven days after each injection to monitor antibody response during the immunization process We obtained the positive result of the agglutination test immediately after the priming injection In addition, the intensity of reactions rose as more injections were given As shown in Fig 4A, there were visible white clumps after 30 minutes combining the serum of the last bleeding with the antigen Moreover, it was obvious that serum originated from the first rabbit exhibited higher thioredoxin-his6-ZmDREB2.7 We took advantage of the fact that the DREB2.7 fusion protein contains a his6 sequence at N-terminal to purify the fusion protein by immobilized-metal affinity chromatography (IMAC) The fusion protein was largescale overexpressed with optimized conditions and utilized for the purification process Fig showed the SDS-PAGE analysis of the recombinant protein purified through the IMAC column Most of the proteins of the host strain were in the unbound fraction (lane 2) and the wash fraction (lane 3) Lanes 4-10 showed the protein fractions after applying the elution buffer containing 250 mM Imidazole The arrow pointed to the expected full-length protein The interested protein eluted with the high amount as judged by Coomassie staining Thus, we concentrated and desalted the elution fractions for antibodies production Fig Agglutination test and dot blot analysis using rabbit anti-fusion protein sera (A) agglutination test of rabbit sera (the last bleeding) to the antigen pAbs-1, pAbs2: the antisera from the first and the second immunization rabbit, respectively (B) dot blot analysis of the rabbit sera to the antigen (-): H2O 1-5: serial dilutions of the ZmDREB2.7 fusion protein ranging from mg/ml to mg/ml, respectively March 2019 • Vol.61 Number Vietnam Journal of Science, Technology and Engineering 27 Life Sciences | Agriculture response than that from the second one It was supposed that immunized rabbits produced pAbs to the thioredoxinhis6-ZmDREB2.7 fusion protein Therefore, we harnessed the anti-fusion protein serum from the first rabbit for dot blot analysis to confirm the specificity of the serum As the result shows, the pAbs generated in rabbit serum can efficiently recognize the recombinant ZmDREB2.7 fusion protein (Fig 4B) Discussion The E coli expression system has been exploited for the production of a variety of proteins Even though there are some drawbacks, such as lack of post-translation modification, the bacterial expression system remains faster and cheaper for producing eukaryote proteins Therefore, we adopted an E coli expression system and did optimization of components involved in the protein expression process to obtain the high expression level of the ZmDREB2.7 fusion protein Even though the ZmDREB2.7 gene contains few rare codons to E coli, it has a high GC content (70%) Meanwhile, the GC content in the E coli genome was about 50.5% [14] Additionally, the maize-derived gene shows a low codon adaptation index in E coli which is 0.68 (the acceptable figure is from 0.8 to 1.0) The difference in codon bias between maize and E coli normally causes early termination and produces truncated versions of the heterologous protein Due to such limitations in the gene sequence, we harnessed the E coli strain Rosetta and the protocol which gradually induces the heterologous protein expression The Rosetta strain has many advantages for enhanced protein expression [15] The strain as a BL21 derivation is deficient in protease Lon and OmpT which could increase the stability of expressed recombinant proteins In addition, Rosetta harbors a compatible plasmid which produces tRNAs for rare codons AUA, AGG, AGA, CGG, CUA, CCC, and GGA Then, the tRNA pool can compensate for the difference in codon bias between E coli and the original source of the interested gene Therefore, it was not necessary to optimize codon usage of the ZmDREB2.7 gene to ensure that the heterologous protein was expressed in full length When a eukaryote protein expresses at a high level in the bacteria cell, it may be found in inclusion bodies due to inappropriate folding To overcome this issue, the ZmDREB2.7 gene was conjugated with the TrxA in the vector pET-32a TrxA normally located in E coli cytoplasm is a compact, highly soluble, and thermally stable protein These properties allow trxA to serve as a molecular chaperone Therefore, when ZmDREB2.7 N-terminally fused with trxA protein, the recombinant protein could avoid forming an inclusion body [16] Additionally, theoretically, slowing 28 Vietnam Journal of Science, Technology and Engineering down the production rate can help the newly synthesized proteins fold more properly [10] It is also reported that sometimes inducing at low temperature facilitates soluble thioredoxin-fused protein [17] In the study, we induced the fusion protein at 30°C for five hours as there was no significant difference of the protein expression level between 30°C and 37°C (Fig 2B) Because the expression levels of the fusion protein were nearly the same at a range of inducer concentration (Fig 2C), the lowest concentration of inducer (0.05 mM IPTG) was the optimum choice to increase the protein production In addition, the ZmDREB2.7 was fused with the his6 sequence to enable purification using IMAC system The his6 tag at N-terminal guarantees that the translation process initiates in the correct position As expected, the induced protein bound to the Ni column was the full-length one with the molecular weight of approximately 55.7 kDa There are several factors to consider when raising pAbs in laboratory animals In fact, rabbits are commonly used for reasons of cost-effectiveness, ease of handling, and high amount of serum compared to mice We used the young rabbits because immune function peaks at puberty and declines with age [12] There were several reports of batchto-batch variants when producing pAbs by immunizing animals, so two rabbits per antigen are recommended In our study, two rabbits responded differently as the agglutination test exhibited more white precipitations with the antiserum from the first one (Fig 4A) The number of injections and the amount of the ZmDREB2.7 fusion protein were tightly controlled We used three booster doses that were double, triple, and four times the priming dose, respectively In addition, the adjuvant was added to induce a high titer of antibodies without any side effects to the animal A high quantity of anti-ZmDREB2.7 fusion protein serum was obtained from the raising pAbs experiment Conclusions In conclusion, we successfully cloned the ZmDREB2.7 gene into the pET-32a vector The expression vector worked well in the E coli Rosetta that the thioredoxinhis6-ZmDREB2.7 fusion protein was overexpressed The optimized conditions for the production of the interested protein were five hours at 30°C using 0.05 mM of IPTG The fusion protein was purified by IMAC column and used to raise pAbs in the rabbit The obtained antiserum can specifically bind to the ZmDREB2.7 fusion protein ACKNOWLEDGEMENTS The present research was supported by a grant from the Vietnam Ministry of Agriculture and Rural Development (MARD) named “Isolating genes related to drought March 2019 • Vol.61 Number Life Sciences | Agriculture tolerance and constructing vectors for maize improvement” The authors declare that there is no conflict of interest regarding the publication of this article REFERENCES [1] S Liu, X Wang, H Wang, H Xin, X Yang, J Yan, F Qin (2013), “Genome-wide analysis of ZmDREB genes and their association with natural variation in drought tolerance at seedling stage of Zea mays L”, PLOS Genet., 9(9), e1003790 [2] Y Sakuma, K Maruyama, Y Osakabe, F Qin, M Seki, K Shinozaki, K Yamaguchi-Shinozaki (2006a), “Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in droughtresponsive gene expression”, Plant Cell, 18, pp.1292-1309 [3] Y Sakuma, K Maruyama, F Qin, Y Osakabe, K Shinozaki, K Yamaguchi-Shinozaki (2006b), “Dual function of an Arabidopsis transcription factor DREB2A in water-stress-responsive and heatstress-responsive gene expression”, Proc Natl Acad Sci USA, 103, pp.18822-18827 active eukaryotic proteins through bacterial expression systems: a review of the existing biotechnology strategies”, Mol Cell Biochem., 307(1-2), pp.249-264 [9] D.M Francis, R Page (2010), “Strategies to optimize protein expression in E coli”, Curr Protoc Protein Sci., 61(1), pp.5-24 [10] G.L Rosano, E.A Ceccarelli (2014), “Recombinant protein expression in Escherichia coli: advances and challenges”, Front Microbiol., 5, p.172 [11] A.R Gomes, S.M Byregowda, B.M Veeregowda, V Balamurugan (2016), “An overview of heterologous expression host systems for the production of recombinant proteins”, Adv Anim Vet Sci., 4(7), pp.346-356 [12] H.F Stills (2012), “Polyclonal antibody production”, The Laboratory Rabbit, Guinea Pig, Hamster, and Other Rodents, pp.259274 [13] J Sambrook, D.W Russell (2001), Molecular cloning: a laboratory manual, Cold Spring Harb Lab Press Cold Spring Harb NY, 999 [4] J.Q Chen, X.P Meng, Y Zhang, M Xia, X.P Wang (2008), “Over-expression of OsDREB genes lead to enhanced drought tolerance in rice”, Biotechnol Let., 30(12), pp.2191-2198 [14] S Mann, Y.P.P Chen (2010), “Bacterial genomic G+C composition-eliciting environmental adaptation”, Genomics, 95(1), pp.7-15 [5] J Chen, X Xia, W Yin (2009), “Expression profiling and functional characterization of a DREB2-type gene from Populus euphratica”, Biochem Biophys Res Commun., 378(3), pp.483-487 [15] R Novy, D Drott, K Yeager, R Mierendorf (2001), “Overcoming the codon bias of E coli for enhanced protein expression”, Innovations, 12, pp.1-3 [6] B Pandey, P Sharma, M Saini, D.M Pandey, I Sharma (2014), “Isolation and characterization of dehydration-responsive element-binding factor (DREB2) from Indian wheat (Triticum aestivum L.) cultivars, Aust J Crop Sci., 8(1), p.44 [7] F Yesilirmak, Z Sayers (2009), “Heterelogous expression of plant genes”, Int J Plant Genomics, 2009, ID 296482 [8] S Sahdev, S.K Khattar, K.S Saini (2008), “Production of [16] Y Li (2009), “Carrier proteins for fusion expression of antimicrobial peptides in Escherichia coli”, Biotechnol Appl Biochem., 54(1), pp.1-9 [17] X Xu, F Jin, X Yu, S Ji, J Wang, H Cheng, W Zhang (2007), “Expression and purification of a recombinant antibacterial peptide, cecropin, from Escherichia coli”, Protein Expr Purif., 53(2), pp.293-301 March 2019 • Vol.61 Number Vietnam Journal of Science, Technology and Engineering 29 ... applying the elution buffer containing 250 nM Imidazole The arrow indicates the interested protein Raising of anti-ZmDREB2.7 fusion protein polyclonal antibodies Fig Expression of the thioredoxin-his6- ZmDREB2.7... Pierce™ Unstained Protein Molecular Weight Marker The arrow indicates the interested protein Purification fusion protein of the The protein after the purification step was used for injection into two... thioredoxin-his6- ZmDREB2.7 fusion protein was five hours of induction using 0.05 mM IPTG at 30°C (Fig 2D) Fig Purification of the thioredoxin-his6- ZmDREB2.7 fusion protein using HisTrap™ HP columns