SUBJECT MICROFLUIDICS

Vietnam National University Ho Chi Minh City University of Science FACULTY OF MATERIALS SCIENCE & TECHNOLOGY    Instructor D.Sc LE VIET HAI GROUP NGUYEN THI HONG YEN 1619302 SEMINAR SUBJECT: BIOSENSES TOPIC: MICROFLUIDICS NGUYEN NHAT XUAN AN 1619001 Insert image of colony flower Insert image of colony tree BASIC CONCEPTS IN MICROFLUIDICS MICROFLUIDIC TECHNOLOGY: Insert image of colony bird HOW TO BUILD A MICROFLUIDIC CHIP CHAPTER I THE STRUCTURE AND OPERATION MECHANISM OF MICROFLUIDICS CHAPTER III Insert image of famous person CHAPTER II APPLICATIONS OF MICROFLUIDICS CONTENTS CHAPTER IV 1.1 The development of microfluidics In the early 1990ies, The field of lab-on-a-chip systems has evolved dramatically The main vision being to develop entire bio/chemical laboratories on the surface of silicon or polymer chips Polymer-based lab-on-a-chip systems have emerged the recent years, and these systems promise CHAPTER I: BASIC CONCEPTS cheaper and faster production cycles The study of fluid motion in microsystems is denoted IN MICROFLUIDICS microfluidics 1.2 Definitions  Microfluidics The science which studies the behavior of fluids through micro-channels and the technology of manufacturing microminiaturized devices containing chambers and tunnels through which fluids flows or are confined CHAPTER I: BASIC CONCEPTS IN MICROFLUIDICS Deal with very small volumes of fluids (fL) 1.2 Definitions  A microfluidic chip  A pattern of micro-channels, molded or engraved This network of micro-channels incorporated into the microfluidic chip is linked to the macro-environment by several CHAPTER I: BASIC CONCEPTS holes of different dimensions hollowed out through the chip It is through these pathways that fluids are injected into IN MICROFLUIDICS and evacuated from the microfluidic chip  A microfluidic chip is a device that enables a tiny amount of liquid to be processed or visualized The chip is usually transparent and its length or width are from 1cm (0.5″) to 10cm (4″) The chip thickness ranges from about 0.5mm (1/64″) to 5mm (1/4″) 1.1 Structure A microfluidic chip is a set of micro-channels etched or molded into a material (glass, silicon or polymer such as PDMS, for Poly Dimethyl Siloxane) They are connected together in order to achieve the desired features (mix, pump, sort, or control the biochemical environment) CHAPTER II: THE STRUCTUREAND OPERATION MECHANISM OF MICROFLUIDICS This network of micro-channels trapped into the microfluidic chip is connected to the outside by inputs and outputs pierced through the chip, as an interface between the macro- and micro-world It is through these holes that the liquids (or gases) are injected and removed from the microfluidic chip (through the tubing, syringe adapters or even simple holes in the chip) with external active systems (pressure controller, push-syringe or peristaltic pump) or passive ways (e.g hydrostatic pressure) 1.2 How does microfluidics work? Microfluidics systems work by using a pump and a chip Different types of pump precisely move liquid inside the chip with the rate of μL/minute to 10,000 μL/minute) Inside the chip, there are microchannels that allow the processing of the liquid such as mixing, chemical or physical reactions The CHAPTER II: THE STRUCTUREAND OPERATION MECHANISM OF MICROFLUIDICS liquid may carry tiny particles such as cells or nanoparticles The microfluidic device enables the processing of these particles, for example, trapping and collection of cancer cells from normal cells in the blood 1.1 Fabrication materials The materials make it possible to design microfluidic chips with new features like specific optical characteristics, biological or chemical compatibility, faster prototyping or lower production costs, the possibility of electro sensing, etc The final choice depends on the application Polymers (e.g PDMS), ceramics (e.g glass), semiconductors (e.g silicon) and metal chapterIII: MICROFLUIDIC Nowadays, a lot of researchers use PDMS and soft lithography due to their easiness of use and fast process They allow TECHNOLOGY: HOWTO BUILD A researchers to rapidly build prototypes and test their applications/setups, instead of wasting time in laborious fabrication MICROFLUIDIC CHIP protocols 1.2 The fabrication of a simple microfluidic chip requires several steps The design of microfluidic channels with dedicated software (AUTOCAD, Illustrator, LEDIT…) Transferred on a photomask: chrome coated glass plates or plastic films for the most common templates (dedicated manufacturers or in a clean room for glass masks) The micro-channels are printed with UV opaque ink (if the substrate is a plastic film) or etched in chromium (if the substrate is a glass plate) chapterIII: MICROFLUIDIC TECHNOLOGY: HOWTO BUILD A MICROFLUIDIC CHIP chapterIII: MICROFLUIDIC 1.3 The fabrication of microfluidic mold by photolithography TECHNOLOGY: HOWTO BUILD A MICROFLUIDIC CHIP (1) Resin is spread on a flat surface (often a silicon wafer) with the desired thickness (which determines the height of microfluidic channels) (2) The resin, protected by the photomask with the microchannel pattern, is then partially exposed to UV light (3) The mold is developed in a solvent that etches the areas of resin that were not exposed to UV light (4) We obtain a microfluidic mold with a resin replica of the patterns from the photomask (future micro-channels make “reliefs” on the mold) chapterIII: MICROFLUIDIC 1.4 The molding of microfluidic chips: TECHNOLOGY: HOWTO BUILD A MICROFLUIDIC CHIP (1) The molding step allows mass production of microfluidic chips from a mold (2) A mixture of PDMS (liquid) and cross-linking agent (to cure the PDMS) is poured into the mold and heated at a high temperature (3) Once the PDMS is hardened, it can be taken off the mold We obtain a replica of the micro-channels on the PDMS block Microfluidic device completion: (4) To allow the injection of fluids for future experiments, the inputs and outputs of the microfluidic device are punched with a PDMS puncher of the size of future connection tubes (5) Finally, the face of the block of PDMS with micro-channels and the glass slide are treated with plasma (6) The plasma treatment allows PDMS and glass bonding to close the microfluidic chip chapterIII: MICROFLUIDIC TECHNOLOGY: HOWTO BUILD A 1.5 Integration of complex functions: MICROFLUIDIC CHIP Many microfluidic devices incorporate other features that require the integration of electrodes, nanostructures or surface functionalization This type of additional steps uses generally standard techniques of micro and nanotechnology (thin film deposition, plasma etching, self-assembled monolayers) 1.1 Glucose biosensor based on open-source wireless microfluidic potentiostat 1.1.1 Structure CHAPTER IV:APPLICATIONS OF MICROFLUIDICS Figure : Simplified schematic of automated microuidic wireless potentiostat system: (A) carbon electrode, (B) PEGDGE, (C) MWCNTs, (D) Os(bpy)PVI, (E) FADGDH, (F) wireless potentiostat, (G) wireless data transfer to internet based server, (H) data viewed using in Glucose biosensor 1.1.2 Priciple: Automate liquid flow and direction include a report The driving force is supplied by compressed nitrogen, Integrate automated microfluidic flow and direction by on a Bluetooth enabled microfluidic liquid via desktop computer for a multiplexed photonic with the iMED handling system that utilized a microcontroller, crystal solenoid valves, and pneumatic pressure Priciples of IMED operation: The entire iMED platform is designed to operate without a desktop computer The iMED uses over the air updates (OTA) mechanism which allows the potentiostat to update itself based on data received while the normal firmware is running (for example, over WiFi) The use of the iMED using an electrochemical enzyme-amplified biosensor 1.1.3 Application: The extraction of nucleic acids rotating disc based analysis of infectious disease, flow cytometry, magnetic stirring, genetic stability with multiplexed PCR, chemiluminescence detection and protein immunoblotting Detection of glucose concentrations in solution The system capability was demonstrated by application to a bead-based HIV1 p24 sandwich immunoassay on a multi-layer polydimethylsiloxane (PDMS) chip Glucose biosensor 1.2 Detection of cancer antigens (CA-125) using gold nano particles on interdigitated electrode-based microfuidic biosensor: 1.2.1 Structure: The interdigitated electrodes were patterned using a photolithography process A silicon wafer with an oxide layer was used as the substrate A positive tone photoresist A gold layer 95 nm thick was deposited on top of the Titanium coated silicon substrate using high vacuum e-beam metal evaporator CHAPTER IV:APPLICATIONS OFMICROFLUIDICS Figure : AFM image of the plain electrodes 1.2.2 Priciples : The antigen detection under shear flow condition during self-driven flow of antigen solution, when immobilized with the gold nano particles (GNPs) The capacitive signal response of the gold nano particle coated interdigitated electrodes compared to the plain interdigitated electrodes during the antigen–antibody The biosensor was exposed to CA-125 antigens in both the static and microfluidic flow conditions Detection of cancer antigens Figure : Schematic representation at various stages of biosensor fabrication: (i) Bare electrodes (ii) SAM layer on the bare electrodes (iii) immobilized gold nano particles on the SAM layer (iv) Antibody immobilization on the electrodes (v) antigen–antibody 1.2.3 Application The feasibility of expanding the sensor to multiplex assay to detect the panel of protein biomarkers that minimize the false positive and false negative scenarios in cancer diagnosis which commonly arise from measuring a single biomarker Detection of cancer antigens 1.3 A microfluidic biosensor using graphene oxide and aptamerfunctionalized quantum dots for peanut allergen detection: 1.3.1 Structure:   The Ara h aptamer synthesis 80 base pairs sequence: 5′TCGCACATTCCGCTTCTACCGGGGGGGTCGAGCGAGTGAGCGAATCTGTGGGTGGGCCGTA AGTCCGTGGTG CGAA 3′(the 5′ end was modified with biotin) CHAPTER IV:APPLICATIONS OF MICROFLUIDICS        Ara h 1, Ara h 2, Ara h standards The Ara h ELISA kit CdSe Qdots modified with covalently attached streptavidin Polydimethylsiloxane Graphene oxide Phosphate-buffered saline (PBS) Chemicals and solvents 1.3.2 Priciple: The fluorescence quenching and recovering properties of GO through the adsorption and desorption of QDots-conjugated aptamers The fluorescence signals were measured on a miniaturized optical detector Fluorescence of Qdots is quenched via FRET process between the Qdots-aptamer probes and GO due to their selfassembly through specific π–π interaction A microfluidic biosensor Figure : (A) Schematic of the sensing mechanism of the Qdots-aptamer-GO quenching system (B) Schematic diagram of microfluidic chip design (not to scale) The microfluidic chip had two inlets for loading the Qdots-aptamer-GO probe mixture and the Ara h1 sample 1.3.3 Application: A microfluidic system integrated with a quantum dots (Qdots) aptamer functionalized graphene oxide (GO) nano-biosensor for simple, rapid, and sensitive food allergen detection Quantitative detection of Ara h 1, one of the major allergens appearing in peanuts A microfluidic biosensor THANK YOU ... production cycles The study of fluid motion in microsystems is denoted IN MICROFLUIDICS microfluidics 1.2 Definitions  Microfluidics The science which studies the behavior of fluids through micro-channels... CHAPTER III Insert image of famous person CHAPTER II APPLICATIONS OF MICROFLUIDICS CONTENTS CHAPTER IV 1.1 The development of microfluidics In the early 1990ies, The field of lab-on-a-chip systems... tree BASIC CONCEPTS IN MICROFLUIDICS MICROFLUIDIC TECHNOLOGY: Insert image of colony bird HOW TO BUILD A MICROFLUIDIC CHIP CHAPTER I THE STRUCTURE AND OPERATION MECHANISM OF MICROFLUIDICS CHAPTER