Veterinary Immunology and Immunopathology 157 (2014) 87–96 Contents lists available at ScienceDirect Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm Research paper Immune responses of orange-spotted grouper, Epinephelus coioides, against virus-like particles of betanodavirus produced in Escherichia coli Yu-Xiong Lai a , Bao-Lei Jin a , Yu Xu a , Li-jie Huang a , Run-Qing Huang a , Yong Zhang a , Jimmy Kwang b,∗∗ , Jian-Guo He a,c , Jun-Feng Xie a,∗ a State Key Laboratory of Biocontrol/MOE Key Laboratory of Aquatic Product Safety, School of Life Sciences, Sun Yat-sen University, Guangzhou 510275, China b Animal Health Biotechnology, Temasek Life Sciences Laboratory, National University of Singapore, 117604 Singapore, Singapore c School of Marine Sciences, Sun Yat-sen University, Guangzhou 510275, China a r t i c l e i n f o Article history: Received 28 May 2013 Received in revised form October 2013 Accepted October 2013 Keywords: Betanodavirus Virus-like particle Humoral immune response Cellular and innate immune responses Vaccine Grouper a b s t r a c t Betanodaviruses are the causative agents of viral nervous necrosis (VNN), a serious disease of cultured marine fish worldwide Virus-like particles (VLPs) are one of the good novel vaccine candidates to control this disease Until now, betanodavirus vaccine studies mainly focused on the humoral immune response and mortality after virus challenge However, little is known about the activation of genes responsible for cellular and innate immunity by vaccines In the present study, VLPs of orange-spotted grouper nervous necrosis virus (OGNNV) were produced in prokaryotes and their ability to enter Asian sea bass cells was the same as native virus, suggesting that they possess a similar structure to OGNNV VLPs immunogenicity was then determined by intramuscularly vaccinating Epinephelus coioides at different concentrations (1.5 or 15 g g−1 fish body weight, FBW) and immunizing frequencies (administration once, twice and thrice) A single vaccination with the dosage of 1.5 g g−1 FBW is enough to provoke high titer antibodies (average fold higher than that of negative control) with strong neutralizing antibody titer as early as week post immunization Furthermore, quantitative PCR analysis revealed that eleven genes associated with humoral, cellular and innate immunities were up-regulated in the liver, spleen and head kidney at 12 h post immunization, correlating with the early antibody response In conclusion, we demonstrated that VLP vaccination induced humoral immune responses and activated genes associated with cellular and innate immunity against betanodavirus infection in orange-spotted grouper © 2013 Elsevier B.V All rights reserved Introduction Viral nervous necrosis (VNN), also called viral encephalopathy and retinopathy (VER), is one of the ∗ Corresponding author Tel.: +86 20 39332970; fax: +86 20 84113229 ∗∗ Corresponding author Tel.: +65 68727470; fax: +65 68727007 E-mail addresses: kwang@tll.org.sg (J Kwang), xiejf@mail.sysu.edu.cn (J.-F Xie) 0165-2427/$ – see front matter © 2013 Elsevier B.V All rights reserved http://dx.doi.org/10.1016/j.vetimm.2013.10.003 most detrimental viral diseases in aquaculture, and continues to cause mass mortality in more than 39 marine fish species (Nakai et al., 2009) primarily at the larval and juvenile stages (Munday et al., 2002; Mori et al., 1992), resulting in serious economic losses among high value fish species Nervous necrosis virus (NNV), the pathogen of VNN, is classified in the genus Betanodavirus of the family Nodaviridae Betanodaviruses are small, spherical, non-enveloped viruses with a bipartite single-stranded (+) RNA genome The betanodavirus named OGNNV isolated 88 Y.-X Lai et al / Veterinary Immunology and Immunopathology 157 (2014) 87–96 from orange-spotted grouper, Epinephelus coioides (Ep coioides) was identified to be of the red-spotted grouper nervous necrosis virus (RGNNV) genotype, the most frequently isolated betanodavirus in Asia (Grotmol et al., 2000) OGNNV is the main pathogen that reduces the quantity and quality of grouper larvae in China To efficiently control NNV infections, vaccination against betanodavirus is a pivotal strategy with general acceptance and several types of vaccines have been reported Prokaryotically expressed recombinant proteins and synthetic peptides derived from the coat protein were employed to vaccinate several fish species but only elicited partial or poorly protective immunity (Husgard et al., 2001; Tanaka et al., 2008; Yuasa et al., 2002) It was demonstrated that vaccination of young grouper (Chen, 2005; Yamashita et al., 2009a,b) and Asian sea bass (Pakingking et al., 2009) by intramuscular injection with inactivated RGNNV (genotype) vaccine could induce the production of neutralizing antibodies, provide protection against an experimental challenge with the homologous virus and suppress viral replication in the brains and kidneys of immunized fish To simplify the procedure, inactivated betanodaviruses with or without nano-encapsulation were used to inoculate grouper larvae by bath immunization, resulting partial protection efficiency (Kai and Chi, 2008) Furthermore, the inactivated betanodaviruses were also used to immunize the broodstocks of grouper to reduce the risk of vertical transmission of NNV from broodfish (Kai et al., 2010) Another type of vaccines constituting viruslike particles (VLPs) expressed by the baculovirus (Thiery et al., 2006) or Escherichia coli (Liu et al., 2006) system provides relatively high protective immunity against NNV in several fish species and is as efficient as inactivated betanodaviruses VLPs, which are highly structured particles, can assemble spontaneously from single or multiple structure proteins in particular conditions (Ziyaad et al., 2011; Charline et al., 2011) Theoretically, they are not infectious and safer than attenuated vaccines because they not contain viral genomes It is widely accepted that VLPs are one of the most promising candidates in vaccine research and virology study VLPs can be produced eukaryotically and prokaryotically, of which the prokaryotic system is easier to manipulate, has higher yields and is faster and cheaper In the present study, OGNNV VLPs were produced in E coli and their ability to invade sensitive cells was identified Furthermore, VLPs were used as vaccine to immunize orange-spotted grouper larvae We determined the best vaccination dosage as well as the ideal immunization procedure Also, the antibody response and expression profiles of immune-related genes after vaccination were investigated Materials and methods 2.1 Fish, virus and cell line Orange-spotted grouper, Ep coioides, with an average body weight of 0.36 g were maintained in flow-through seawater at room temperature, aerated with an air pump and acclimated to the system for days, at which time tissues were collected from 10 random fish for virus-free testing and as control samples before injection (0 h) Feeding was suspended 24 h before vaccination and sampling A viral template was prepared from the Hainan strain of OGNNV, isolated from dying grouper larvae in China, and used for VLP construction Asian sea bass (SB) cell is a fibroblast cell line derived from Lates calcarifer larvae (Chong et al., 1987) which is sensitive to OGNNV SB cells were a gift from J Kwang and were used for invading experiments and neutralization assays The cells were grown at 26 ◦ C in minimal essential medium (MEM, Gibco) supplemented with 10% FBS (Hyclone) 2.2 Vector construction Primers CP-Hind-R (5 -CCCAAGCTTTTAGTTTTCCGAGTCAACCCTG-3 ) and CP-Eco-RBS-F (5 -GGAATTCATTAAAGAGGAGAAATTAACTATGGTACGCAAAGGTGAGAAG3 ) were used to amplify the CP gene (accession number: AF534998) from cDNA of RNA2 and the product was then inserted into pQE30 (QIAGEN) using EcoRI and HindIII sites The resulting plasmid without His-tag, designating as pQE-CP, was used for VLP production in M15 E coli host 2.3 VLP production VLPs were produced as described (Lu et al., 2003) with modification A volume of 80 ml seed culture grown overnight at 37 ◦ C was inoculated equally into flasks of l LB-broth medium supplemented with 100 g ml−1 ampicillin When the cell density reached 0.3–0.4 (OD600), the culture was cooled down to 30 ◦ C and 0.9 mM IPTG was added for induction After induction for h at 30 ◦ C, cells were harvested by centrifugation (5000 × g, ◦ C, 20 min), resuspended in 100 ml PBS (pH 8.0) with 1% Triton X-100 and mM PMSF, lysed by sonication and centrifuged at 40,000 × g for 20 Collected supernatant was ultracentrifuged at 250,000 × g (Beckman Optima L-100XP) for h against a 30% sucrose cushion The pellet was resuspended in ml of PBS (pH 8.0) and further purified using a 10–40% (w/w) sucrose gradient at 250,000 × g for h Fractions of various buoyancies were collected and examined by SDSPAGE and immunoblotting The shape, size and integrity of the VLPs were confirmed by negative staining and electron microscopy (JOEL JEM-1400) The fractions containing fine structured and highly pure VLPs were diluted with PBS and ultracentrifuged at 250,000 × g for h to remove the sucrose The pellets were resuspended with PBS and the VLPs structure was verified again by electron microscopy Purified VLPs were stored at −80 ◦ C until use 2.4 OGNNV and VLPs invasion assay SB cells were grown to 80% confluence on coverslip at 26 ◦ C VLPs (0.3 g l−1 ) or OGNNV (1011 TCID50 ml−1 ) diluted in MEM were incubated with SB cells at ◦ C for h for attachment and invasion synchronization After thorough washing with PBS to remove excess virus or VLP, SB cells received fresh medium and were switched to 26 ◦ C to trigger invasion At different incubation times (0, 15, Y.-X Lai et al / Veterinary Immunology and Immunopathology 157 (2014) 87–96 30, 45, 60, 120 min), the medium was removed, cells were fixed with 4% paraformaldehyde for 30 and then permeabilized for in 0.2% Triton X-100 in PBS at room temperature for indirect-immunofluorescence assay (IFA) (Fenner et al., 2006a) Cells were washed with phosphatebuffered saline with 0.05% Tween20 (PBST) and blocked with PBS with 5% FBS IFA was performed by incubating cells with 1:500 primary antibodies (polyclonal mouse anti-VLP antibody produced in-house) for h at room temperature Cells were washed again and treated with 1:1000 dilution of Alexa Fluor 488-labeled goat anti-mouse IgG antibody (Life technologies) as secondary antibody for h at room temperature Cells were washed and the cell nuclei were counterstained in blue with Hoechest 33342 (Sigma) Confocal fluorescent microscopy was carried out with a Leica TCS SP5 confocal inverted microscope and images were analyzed using Leica LAS AF Lite software (V1.8.1 build 1390) to determine the location of virions 2.5 Vaccination VLPs were injected intramuscularly (IM) with the dosages of 15 g g−1 fish body weight (FBW, high concentration, H) or 1.5 g g−1 FBW (low concentration, L) into the dorsum of anesthetized Ep coioides Including PBS injected controls (negative controls), there were three groups of grouper (40 fish per group) in total including high concentration VLPs (V.H.), low concentration VLPs (V.L.) and PBS To determine the impact of immunization times to the vaccination efficiency, three independent trials were conducted, immunizing the grouper IM once, twice or thrice with a one-week-interval between multiple boosters For antibody detection, ten fish from each group in each trial were randomly selected, and their bloods were collected from the caudal vein at indicated sampling time points (every week) post immunization (PI) Antibody titers of anti-VLPs sera were determined by antigen-capture ELISA 2.6 Antigen-capture ELISA Antigen-capture ELISA was performed as described (Fenner et al., 2006b) to determine the antibody titers of anti-VLP sera (total immunoglobulin) In brief, 50 l of diluted fish sera (1:100) were coated in a well of 96-well microtiter plate at ◦ C overnight The plate was conducted to room temperature and washed three times with 200 l PBS After blocking with 5% bovine serum albumin (BSA) in PBS for h and washing three times with PBS containing 1% Tween20 (PBST, all washes below indicated three times with 200 l PBST), ng VLPs was added to each well and incubated for h After wash, the plate was incubated with in-house produced mouse anti-VLP antiserum at a dilution of 1:1000 in PBST for h The plate was washed and peroxidase-conjugated goat anti-mouse IgG (Sigma) at a dilution of 1:3000 in PBST was added and incubated for h Following thorough washes (five times), 100 l of OPD substrate (Sigma) was added and the color development was conducted at room temperature The reaction was stopped by the addition of M sulfuric acid and the absorbance at 492 nm was determined 89 2.7 Neutralization assay At 1, 7, 10 weeks PI, sera from six groupers immunized with one shot of low concentration VLPs or six PBS injected groupers were collected SB cells were cultured as a monolayer on a 96-well plate Aliquots of 300 l sera of immunized or non-immunized groupers were serially three-fold diluted (from 50× to 109,350×) with MEM and mixed with an equal volume of OGNNV (107 TCID50 ml−1 ) After incubation at room temperature for h, aliquots of each mixture were inoculated into six wells of the SB cells The SB cells treated with sera from PBS injected groupers served as negative control, while SB cells without grouper antisera were designated as positive control The infected SB cells were cultured in MEM supplemented with 3% FBS at 26 ◦ C for days After culturing, media were removed and IFA was performed as described above to determine the NNV positive wells by fluorescent signal in cells The neutralizing antibody titer was calculated according to Reed–Muench (Reed and Muench, 1938) and Spearman–Karber method (Hamilton et al., 1977) 2.8 Quantification of several immune related genes stimulated by VLPs Eight groupers that had received one injection of V.L or PBS (60 fish per group) were sacrificed at the indicated time points and organs (spleen, liver, head kidney, eyes and brain) were collected Total RNA was isolated from pooled samples using the RNeasy Mini Kit (Qiagen) and reverse-transcribed into cDNA using the First Strand cDNA Synthesis Kit (Toyobo) according to the manufacturer’s instructions Expressions levels of eleven selected genes (Table 1) were determined by the Perfect Real-Time SYBR Green Master Mix Kit (Takara) following the manufacturer’s instructions using Light Cycler 480 real-time PCR system (Roche) The PCR conditions were as follows: 95 ◦ C for min, followed by 40 cycles of 94 ◦ C for 15 s, 62 ◦ C for 30 s and 70 ◦ C for s Original data were analyzed using the 2−CT method The expression data of eleven genes were normalized with that of 18 S rRNA Fold units were calculated by dividing the normalized expression values of VLP immunized samples with that of PBS injected controls Primers used are listed in Table 2.9 Statistical analysis Statistical differences of titers or expression profiles from the different groups were assessed by analysis of variance (ANOVA) and paired Student’s t-tests Numerical results are presented as mean ± standard deviation with 95% confidence intervals and p < 0.05 was considered statistically significant Results 3.1 Production and characterization of OGNNV VLP The sequence of OGNNV RNA2 was verified and the capsid protein (CP) coding region was cloned and expressed in E coli VLPs, which assemble automatically from CP 90 Y.-X Lai et al / Veterinary Immunology and Immunopathology 157 (2014) 87–96 Table List of primers used in this work Gene Primer name Primer sequence (5 –3 ) Primers used in vector construction CP-Hind-R CP CP-EcoR-RBS-F CCCAAGCTTTTAGTTTTCCGAGTCAACCCTG GGAATTCATTAAAGAGGAGAAATTAACTATGGTACGCAAAGGTGAGAAG Primers used in real-time quantitative PCR 18S-F29 18s 18S-R142 GACGGACGAAAGCGAAAGCATT AGTTGGCATCGTTTATGGTCGG CCC3 CCC3-F95 CCC4-R227 AGTGAGGGTGGAAGGGTTTACAG GTGCGGATAACTCAGGAATGTGC CD4 CD4-F60241 CD4-R394 TGGACTGATGGCAATGAACTGA GCAGCGGAGTGGATGGTTTC CD8a CD8a-F82 CD8a-R199 GTAAAGGAAGGGCAGCGGAT TGATGCTGAAAGATGCGATGAAT HSP90 HSP90-F2023 HSP90-R2135 ACCCACTCCAACCGCATCTACAG AGGGGAGGAATCTCATCTGGGAC IgM IgM-F181 IgM-R282 GGAAAAGGACTGGAGTGGATTG GCTGTTGTCTGTGGAGATGGTG ISP16 ISP16-F63 ISP16-R155 CACAGTGGGCTCTCTGAAACAA TGAGTCTTCTGACCGTTCACAAA MHCIa MHCIa-F65 MHCIa-R154 CCTCGGCAATGACTCACTCTCT CAACCAACCCAACAACCACAAA MHCIIa MHCIIa-F5 MHCIIa-R136 TGAAGATGATGGTGGTCCTGGT TCTCCTCACCATCCAGAGCGTA Mx MX-F501 MX-F594 GTTCATCACAAGACAAGAAACCATC CACCTCCTGTGCCATCTTCAAA TCR TCR-F558 TCR-R638 ACACAGTCTGGCTCCCGTTGAA GGGTCCCGCTCAGTGATTGG TNFR14 TNFR14-F53 TNFR15-F162 GGCTGTGCTGTCGTGAAAAGGA CCGTGTGCCTGACTCTGTTGTG monomers in suitable situation, were successfully purified by sucrose gradient ultracentrifugation after sonication There were two bands at a density of 1.07 g cm−3 (fraction I) and 1.13 g cm−3 (fraction II) in the ultracentrifuge tube, as shown in Fig 1A The size of VLPs in fraction II was between 28 and 32 nm while the VLPs in fraction I were smaller (20–25 nm) as shown in electron microscopy The shape and integrity of VLPs in fraction II were better than that in fraction I and were more close to that of native virus Fraction I contained intact and stain-permeable particles while most of the VLPs in fraction II were intact (Fig 1A) In both fractions, the molecular mass of proteins (37 kDa) was the same as the native virus in SDS-PAGE and the purity of proteins was more than 95% (Fig 1B) Additionally, the proteins were verified as CP by immunoblotting (Fig 1B) The morphology of VLPs in fraction II are the same as native NNV Therefore, the high quality VLPs (fraction II) with fine icosahedral structure were used for the further study 3.2 Characterization of invasion ability of VLPs Although VLPs cannot propagate in cells as they lack the viral genome, they possess the similar structure, invasion ability and immunogenicity as natural virus To verify the entry process of VLPs, NNV sensitive SB cells were incubated with VLPs, and OGNNV served as positive control The Fig Characterization of gradient-purified OGNNV VLPs (A) Two fractions of VLPs (F I and F II) were observed in sucrose gradient purification Electron microscopy of negatively stained VLPs (including fraction I and II) and OGNNV (WT) are shown (bar = 100 nm) (B) SDS-PAGE and Immunoblotting of VLPs and OGNNV As indicated, a strong protein band could be found at 37 kD and a weak band at 111 kD (maybe CP trimer) in SDS-PAGE These two bands of proteins were verified as OGNNV CP by immunoblotting (IB) with mouse anti-VLP antibody (M = protein marker) Y.-X Lai et al / Veterinary Immunology and Immunopathology 157 (2014) 87–96 91 Fig OGNNV and VLP invasion of SB cells observed by confocal microscopy SB cells were incubated with OGNNV or VLPs at ◦ C for h and switched to 26 ◦ C after a thorough wash At different time points post-incubation, OGNNV or VLPs were labeled with green fluorescence by IFA using self-made mouse anti-VLPs antibody as primary antibody and Alexa fluor 488-labeled goat anti-mouse IgG antibody while the cell nuclei were counterstained in blue with Hoechest White arrows indicate the attachment of particles to the cell membrane while red arrows show the gathering of particles near the cell nucleus The invasion track and timing of VLPs are the same as that of OGNNV (bar = 25 m) particles were visualized by indirect immune-fluorescent assay at different time points As shown in Fig 2, VLPs and OGNNV attached at the membrane of SB cells evenly at min, showing that the low temperature (0 ◦ C) treatment at attachment stage reduced the membrane mobility, inhibited the rapid entry of the particles and synchronized the invasion of the particles When the cells were switched to normal culturing temperature (25 ◦ C), VLPs invaded into SB cells quickly and aggregated near the nucleus within 60 Almost all particles accumulated at certain endosomes near the nucleus at 120 In OGNNV infected cells, the virus particles migrated into SB cells at the same rate as VLPs except that the fluorescence signal was weaker because of the lower protein level of wild type virus The invading capability into SB cells and its timing were the same for VLPs and native OGNNV, showing that VLPs are similar to native OGNNV in structure and rapid invasion ability This indicates that VLPs are a potential vaccine candidate The results also suggested that NNV entry into sensitive cells was determined only by the capsid proteins 3.3 Humoral immune response elicited by VLPs To determine the immune response in Ep coioides against OGNNV VLP, the fish were immunized with VLPs in dosages of 15 g g−1 FBW (high concentration, V.H.) and 1.5 g g−1 FBW (low concentration, V.L.) Three trials with different injection frequencies, including one shot, two shots and three shots with a one-week interval between multiple boosters, were studied Fish sera from vaccinated and control groupers were collected every week and the NNV-specific antibody response was determined by antigen-capture ELISA As shown in Fig 3, both V.H and V.L stimulated levels of NNV specific antibodies that were significantly higher than those of PBS control in all three trials (p < 0.01) Furthermore, VLPs successfully induced an antibody response as early as week PI, which was earlier than the response induced by partial betanodavirus capsid protein (3–12 weeks PI) reported by others (Yuasa et al., 2002; Tanaka et al., 2008), indicating that the 3D structure of the protrusion surface of the VLP is important for stimulating the host immune system Although the average antibody titer of V.H (3.6) was higher than that of V.L (3.5), there was no significant difference (p > 0.05) between these two concentrations of VLP vaccine Therefore, the VLP vaccine Fig Humoral immune responses of orange-spotted grouper stimulated by injecting IM VLPs VLPs in dosages of 15 g g−1 FBW (high concentration, V.H.) and 1.5 g g−1 FBW (low concentration, V.L.) were injected IM into Ep coioides (40 fish per group) once (A), twice (B) and thrice (C) with a one-week-interval between multiple boosters PBS was used as negative control Antisera from ten randomly selected fish were collected every week after the last immunization and subjected to antigen-capture ELISA The weeks post injection represent the time elapsed from the last immunization Absorbance values at each sampling time were the mean of ELISA triplicate readings from 10 individual and antibody titers (fold change) represents that the data from vaccinated fish were normalized with that of PBS injected fish The error bars indicate standard deviation The asterisks indicated that the antibody responses of V.L and V.H were significantly higher than that of PBS control (**p < 0.01) 92 Y.-X Lai et al / Veterinary Immunology and Immunopathology 157 (2014) 87–96 Table Neutralization titer of anti-VLP sera from grouper Fish Potency (1:) week PI Fig Neutralizing titers of anti-VLP sera from groupers Sera from groupers immunized with one shot of V.L at 1, and 10 weeks PI were collected, serially three-fold diluted with MEM medium, premixed with OGNNV (107 TCID50 ml−1 ) in an equal volume and incubated with SB cells After culturing for days, media were removed and IFA was performed to determine the virus infection in cells The neutralizing titers (mean) were shown above the bars and the error bars indicate standard deviation at a dosage of 1.5 g g−1 FBW (V.L.) is enough to stimulate a high titer of specific antibodies The curve of one shot of V.L rose gradually, peaked at and weeks PI and descends at 10 weeks PI (Fig 3A) The temporary drop at weeks PI reflected the normal fluctuation and downward trend of the antibody response Similarly, the curves of two or three injections of V.L (Fig 3B and C) rose quickly, reached the peak at or weeks PI and maintained at a high level from to 10 weeks PI Accordingly, multiple injections did not provoke a much stronger antibody response compared to a single shot, but prolonged the duration of the high level of antibody titer OGNNV VLPs were thus demonstrated to elicit humoral immunity 3.4 Neutralizing antibody titer To detect the neutralizing ability of antibody from fish serum is one of the methods to show the vaccine efficiency It is often difficult to evaluate vaccine efficacy against betanodavirus only using the mortality after experimental challenge because mortalities of grouper, sea bass and other fish species caused by betanodavirus (RGNNV type) were different depending on the developmental stages of fish used or the infection methods (Munday et al., 2002; Pakingking et al., 2009) Here, we investigated the neutralizing antibody titers of vaccinated or unvaccinated fish instead of calculating the relative percentage of survival after challenge As shown in Fig and Table 2, one shot of V.L increased the neutralization titer from 1:1050 ± 465 at week PI to a maximum level of 1:8100 ± 4437 at weeks PI and decreased to 1:3150 ± 1394 at 10 weeks PI, whereas the control sera (unvaccinated and negative control) had no neutralization titer (less than 1:50) According to the lowest neutralization titer at week PI, it was estimated that weeks PI V.L PBS 1350 1350 450 450 1350 1350 50 30 30 30 30 30 Mean SD 1050 465 33 V.L 10 weeks PI PBS V.L PBS 4050 12,150 12,150 4050 4050 12,150 30 50 50 30 30 30 4050 1350 4050 1350 4050 4050 30 30 30 30 30 30 8100 4437 37 10 3150 1394 30 Sera from groupers immunized with one shot of V.L at 1, and 10 weeks PI were collected, serially three-fold diluted with MEM medium, premixed with OGNNV (107 TCID50 ml−1 ) in an equal volume and incubated with SB cells After culturing for days, media were removed and IFA was performed to determine the virus infection in cells The neutralizing potency (antibody titer) was calculated according to Reed and Muench (1938) and Spearman–Karber method (Hamilton et al., 1977) the antibody titer elicited by a single injection of V.L could neutralize more than 108 TCID50 ml−1 of virus Therefore, one injection of V.L could be an economical immunization procedure for orange-spotted grouper 3.5 Quantification of 11 immune-related genes stimulated by VLPs To evaluate the activation of genes related to humoral, cellular and innate immunities, the expression variations of eleven immune-related genes were measured by QPCR, as shown in Fig The RNAs obtained from spleen, liver, head kidney, eyes and brain of fish vaccinated with one injection of V.L and control fish were reverse transcribed into cDNA and then subjected to QPCR In the spleen, the humoral immunity factors (IgM, CD4, MHCIIa) and cellular immunity factors (TCR-, CD8a, MHCIa) showed similar temporal kinetics, with a remarkable increase (41.8 fold, 11.1 fold, 22.9 fold, 5.2 fold, 6.1 fold and 35.1 fold respectively) at dPI before decreased Antiviral pathway related proteins ISP16 (7 fold), Mx (5.2 fold) and TNFR14 (5.4 fold) had a modest increase at day PI And the molecular chaperone HSP90 showed a different expression kinetic, with a steady increase from hPI (15 fold) till 12 hPI (38.4 fold), followed by a temporary decrease and a weaker peak at dPI (20.2 fold) CCC3 did not show a significant increase during all sampling times In the liver, HSP90 and CCC3 changed sharply HSP90 had a modest increase and hPI (about 10 fold), and a remarkable increase (405.6 fold) at 12 hPI, followed by a decrease CCC3 showed a potent expression at dPI (257.9 fold) Among the other genes, TCR- (9.8 fold), CD8a (52.9 fold), MHCIa (12.1 fold), IgM (31.6 fold), Mx (16.9 fold) and TNFR14 (25 fold) all had a significant peak increase (>10 fold) around 12 hPI CD4, MHCIIa and ISP16 did not show a significant increase during all sampling times In the head kidney, ISP16 (7.1 fold), Mx (7.8 fold), TNFR14 (7.5 fold) and HSP90 (29.7 fold) had their peak expression at 12 hPI, while IgM (5.2 fold) reached its peak at dPI For MHCIa, two expression peaks were recorded Y.-X Lai et al / Veterinary Immunology and Immunopathology 157 (2014) 87–96 93 at 12 hPI (6.6 fold) and dPI (8.4 fold) TCR-, CD8a, CD4, MHCIIa and CCC3 did not show a significant increase during all sampling times In the eyes, CD4 and HSP90 showed a relative high expression level, with an increase of 28.9 fold at hPI and 25.4 fold at 12 hPI respectively, and lower expression levels at other sampling times Mx (6.1 fold) and TNFR14 (6.7 fold) had a modest increase at 12 and 24 hPI The other genes did not show a significant increase In the brain, on the other hand, all the eleven immune genes showed relatively low expression levels compared to those found in the other four organs Discussion Vaccination has become an important strategy to prevent and control fish diseases in aquaculture, especially VNN infection (Kai and Chi, 2008; Gomez-Casado et al., 2011; Plant and LaPatra, 2011) In this study, OGNNV VLPs were produced and the potential for provoking humoral and cellular immunity was investigated VLPs are very similar to natural virus in their structure, infectivity and immunogenicity (Lu et al., 2003) Hence they can stimulate the host immune system and induce stronger immune responses compared to their negative control Immunization studies revealed that the V.H vaccine candidate elicited the highest average antibody titers However, based on statistical analysis there was no significant difference among the antibody titers provoked by V.H and V.L regardless of the vaccination times (p > 0.05) Although no further increase was observed in the antibody titers after multiple immunizations, prolonged high antibody titers were present until the late stage In addition, overdose of vaccines induced a slightly increase in antibody titers after the third immunization, which was different from previous results (Liu et al., 2006; Sommerset et al., 2005) This could have been due to the strength of the overdose effects or the dosages of vaccines used to trigger the overdose effects Additional factors might have been the purity of the vaccines, the methods used to determine protein concentration or the fish used As proved by the neutralization assay, the high titer antibody against OGNNV from antisera of one week PI could neutralize more than 108 TCID50 ml−1 of virus The strong neutralizing titer of antisera was also seen in the study of DGNNV VLPs (Liu et al., 2006) Although we did not perform the virus challenge to validate the immune protection of VLP vaccine, the high relative percent survival (RPS) could be expected because the relationship between the antibody neutralizing titer (in vitro) and RPS study after lethal Fig Transcriptional changes of immune-related genes in five organs after VLPs immunization on Ep coioides VLPs (1.5 g g−1 FBW) were IM injected once into Ep coioides with PBS as control (60 fish per group) The expression raw data of 11 genes and 18S control were determined by SYBR green method of QPCR Data were analyzed using the 2−CT method Fold units were calculated by dividing the expression values of vaccinated tissues by that of control once normalized with the 18S expression Values at each indicated sampling time are the mean of triplicate readings The error bars indicate standard deviation 94 Y.-X Lai et al / Veterinary Immunology and Immunopathology 157 (2014) 87–96 challenge (in vivo) was found in brown-marbled grouper (Pakingking et al., 2010) and Asian sea bass (Pakingking et al., 2009) Nevertheless, the challenge study after vaccination of OGNNV VLPs should be carried out to address the issue Taken together, one immunization with V.L was sufficient to elicit a high and lasting immune response and could be a cost-effective choice In the transcription analysis, eleven immune-related genes of grouper larvae were investigated by Q-PCR after one immunization with V.L The results showed that most of the humoral immunity genes were upregulated after vaccination as quickly as 12 hPI, indicating a noticeable immune-potentiation CD4, MHCIIa and certain immunoglobulins are often used as the markers of humoral immunity (Bowen and Walker, 2005) In this study, the expression of CD4, MHCIIa was significantly up-regulated in spleen tissue IgM, the direct indicator of humoral immunity, showed a potent transcription in spleen, liver and head kidney, which agreed with our results of the high titer antibody response Similarly, IgM was found up-regulated when grouper, sea bass and Atlantic halibut suffered from betanodavirus infection (Wu et al., 2012; Scapigliati et al., 2010; Grove et al., 2006) Like humoral immunity, cellular immunity plays an important role in host antiviral response TCR- is an important T-cell marker which usually cooperates with CD8/MHCIa complex to mediate cytotoxic T-lymphocyte response (Nakanishi et al., 1999, 2011; Randelli et al., 2008) Previously several researchers have reported that the expression of TCR-, CD8a and/or MHCI was up-regulated during infection (Somamoto et al., 2006; Øvergård et al., 2011; Utke et al., 2007; Boudinot et al., 2001; Landis et al., 2008; Park et al., 2009), indicating that these molecules may play an important role in anti-viral immunity Accordingly, we observed significant up-regulation of TCR- and CD8a in spleen and liver, as well as MHCIa in spleen, liver and head kidney Normally, the interferon signaling pathway is activated first when vertebrates suffer viral infection In NNVzebrafish infection model, the interferon pathway was involved both in acute and persistent infection (Lu et al., 2008) Mx and ISP16 are the interferon pathway factors that have shown antiviral activity (Chen et al., 2008; Chin and Cresswell, 2001; Lenschow et al., 2007) During betanodavirus infection, a strong Mx up-regulation was observed in several fish models (Lu et al., 2008; Poisa-Beiro et al., 2008) Furthermore, injection of interferon could rescue the infected fish (Lu et al., 2008) In the present study, upregulation of Mx and ISP16 was observed, indicating the involvement of the interferon pathway when grouper larvae received VLP vaccination The activation of the genes involved in interferon signaling pathway as well as cellular immunity may possibly provide temporary protection against betanodavirus to reduce mortality, yet detailed experiments should be conducted to directly detect upregulation and activation of factors involved in cellular and innate immunity During stress, viruses induce a heat shock response and HSP90 is generally involved in stress-induced cytoprotection (Sreedhar et al., 2004; Cho et al., 1997; Wang et al., 2006; Lo et al., 2004; Gao et al., 2008) HSP90AB was up-regulated following nodavirus infection (Chen et al., 2010), however, HSP90 was also found to contribute in virus infection or replication (Hung et al., 2002; Castorena et al., 2007; Burch and Weller, 2005; Chase et al., 2008), but the mechanism remains unknown In our study, the peak value of HSP90 expression was more than 25 fold compared to the control group in spleen, liver, head kidney, and eyes Especially in liver collected at 12 hPI, HSP90 expression showed an increase of up to 405.6 fold, suggesting an important role of HSP in the host’s anti-viral immunity The complement system, another part of innate immunity, was also activated by VLP vaccination as indicated by the potent expression of CCC3 in the liver at dPI Also, the results of highest expression of CCC3 in liver and the lowest in spleen were similar to the previous reports (Engstad et al., 1992) In conclusion, OGNNV VLPs were produced and retained the characteristics features of the native virus As an effective vaccine, the optimized dosage of OGNNV VLPs is a single administration of 1.5 g g−1 FBW VLPs can induce a specific, high-titer antibody response which could efficiently neutralize betanodavirus as well as activate genes associated with cellular and innate immunity These data provide new information for VLP vaccine development and also for host responses to wild type virus infection Further studies on VLPs will be needed to address the issue of purification procedures and the development of VLP-based polyvalent vaccines in the future Competing interests The authors declare that they have no competing interests Author contribution Y Lai participated in all the experiments and prepared this manuscript Y Xu, B Jin and L Huang were involved in the production of VLP, vaccination of groupers and real-time PCR detection of gene expression J Xie constructed the expression vector of VLP, designed and guided all the experiments and prepared this manuscript J Kwang offered the SB cell line and thoroughly reviewed and revised this manuscript J He offered the experimental funding and condition and revised this manuscript All authors approved the final version of the manuscript Acknowledgments This work was supported by National 863 Program of China (No 2012AA10A407); the Fundamental Research Funds for the Central Universities (No 3161079); the State Scholarship Fund (No 2008109931); Science and Technology Projects of Guangdong Province (No 2011A020102002); National Science and Technology Pillar Program (2007BAD29B05) We gratefully acknowledge Daya Bay Fisheries Development Center in Guangdong Province, China for fish providing and culturing Y.-X Lai et al / Veterinary Immunology and Immunopathology 157 (2014) 87–96 References Boudinot, P., Boubekeur, S., Benmansour, A., 2001 Rhabdovirus infection induces public and private T cell responses in teleost fish J Immunol 167, 6202–6209 Bowen, D.G., Walker, C.M., 2005 Adaptive immune responses in acute and chronic hepatitis C virus infection Nature 436, 946–952 Burch, A.D., Weller, S.K., 2005 Herpes simplex virus type DNA polymerase requires the mammalian chaperone hsp90 for proper localization to the nucleus J Virol 79, 10740–10749 Castorena, K.M., Weeks, S.A., Stapleford, K.A., Cadwallader, A.M., Miller, D.J., 2007 A functional heat shock protein 90 chaperone is essential for efficient flock house virus RNA polymerase synthesis in Drosophila cells J Virol 81, 8412–8420 Charline, G., Nathalie, C., Laurence, B., 2011 Cellular kinases incorporated into HIV-1 particles: passive or active passengers? Retrovirology 8, 71 Chase, G., Deng, T., Fodor, E., Leung, B.W., Mayer, D., Schwemmle, M., Brownlee, G., 2008 Hsp90 inhibitors reduce influenza virus replication in cell culture Virology 377, 431–439 Chen, X.Y., 2005 Advances in nervous necrosis virus of fish Prog Vet Med 5, Chen, Y.M., Kuo, C.E., Wang, T.Y., Shie, P.S., Wang, W.C., Huang, S.L., Tsai, T.J., Chen, P.P., Chen, J.C., Chen, T.Y., 2010 Cloning of an orange-spotted grouper Epinephelus coioides heat shock protein 90AB (HSP90AB) and characterization of its expression in response to nodavirus Fish Shellfish Immunol 28, 895–904 Chen, Y.M., Su, Y.L., Shie, P.S., Huang, S.L., Yang, H.L., Chen, T.Y., 2008 Grouper Mx confers resistance to nodavirus and interacts with coat protein Dev Comp Immunol 32, 825–836 Chin, K.C., Cresswell, P., 2001 Viperin (cig5), an IFN-inducible antiviral protein directly induced by human cytomegalovirus Proc Natl Acad Sci U S A 98, 15125–15130 Cho, W.J., Cha, S.J., Do, J.W., Choi, J.Y., Lee, J.Y., Jeong, C.S., Cho, K.J., Choi, W.S., Kang, H.S., Kim, H.D., Park, J.W., 1997 A novel 90-kDa stress protein induced in fish cells by fish rhabdovirus infection Biochem Biophys Res Commun 233, 316–319 Chong, S.Y., Ngoh, G.H., Ng, M.K., Chu, K.T., 1987 Growth of lymphocystis virus in a sea bass, Lates calcarifer (Bloch) cell line Singapore Vet J 11, 78–85 Engstad, R.E., Robertsen, B., Frivold, E., 1992 Yeast glucan induces increase in lysozyme and complement-mediated haemolytic activity in Atlantic salmon blood Fish Shellfish Immunol 2, 287–297 Fenner, B.J., Thiagarajan, R., Chua, H.K., Kwang, J., 2006a Betanodavirus B2 is an RNA interference antagonist that facilitates intracellular viral RNA accumulation J Virol 80, 85–94 Fenner, B.J., Du, Q., Goh, W., Thiagarajan, R., Chua, H.K., Kwang, J., 2006b Detection of betanodavirus in juvenile barramundi, Lates calcarifer (Bloch), by antigen capture ELISA J Fish Dis 29, 423–432 Gao, Q., Zhao, J., Song, L., Qiu, L., Yu, Y., Zhang, H., Ni, D., 2008 Molecular cloning, characterization and expression of heat shock protein 90 gene in the haemocytes of bay scallop Argopecten irradians Fish Shellfish Immunol 24, 379–385 Gomez-Casado, E., Estepa, A., Coll, J., 2011 A comparative review on European-farmed finfish RNA viruses and their vaccines Vaccine 29, 2657–2671 Grotmol, S., Nerland, A.H., Biering, E., Totland, G.K., Nishizawa, T., 2000 Characterisation of the capsid protein gene from a nodavirus strain affecting the Atlantic halibut Hippoglossus hippoglossus and design of an optimal reverse-transcriptase polymerase chain reaction (RT-PCR) detection assay Dis Aquat Organ 39, 79–88 Grove, S., Johansen, R., Reitan, L.J., Press, C.M.L., Dannevig, B.H., 2006 Quantitative investigation of antigen and immune response in nervous and lymphoid tissues of Atlantic halibut (Hippoglossus hippoglossus) challenged with nodavirus Fish Shellfish Immunol 21, 525–539 Hamilton, M.A., Russo, R.C., Thurston, R.V., 1977 Trimmed Spearman–Karber method for estimating median lethal concentrations in toxicity bioassays Environ Sci Technol 11, 714–719 (Correction 1978, 12, 417) Hung, J.J., Chung, C.S., Chang, W., 2002 Molecular chaperone Hsp90 is important for vaccinia virus growth in cells J Virol 76, 1379–1390 Husgard, S., Grotmol, S., Hjeltnes, B.K., Rodseth, O., Biering, E., 2001 Immune response to a recombinant capsid protein of striped jack nervous necrosis virus (SJNNV) in turbot Scophthalmus maximus and Atlantic halibut Hippoglossus hippoglossus, and evaluation of a vaccine against SJNNV Dis Aquat Organ 45, 33–44 95 Kai, Y.H., Chi, S.C., 2008 Efficacies of inactivated vaccines against betanodavirus in grouper larvae (Epinephelus coioides) by bath immunization Vaccine 26, 1450–1457 Kai, Y.H., Su, H.M., Tai, K.T., Chi, S.C., 2010 Vaccination of grouper broodfish (Epinephelus tukula) reduces the risk of vertical transmission by nervous necrosis virus Vaccine 28, 996–1001 Landis, E.D., Purcell, M.K., Thorgaard, G.H., Wheeler, P.A., Hansen, J.D., 2008 Transcriptional profiling of MHC class I genes in rainbow trout infected with infectious hematopoietic necrosis virus Mol Immunol 45, 1646–1657 Lenschow, D.J., Lai, C., Frias-Staheli, N., Giannakopoulos, N.V., Lutz, A., Wolff, T., Osiak, A., Levine, B., Schmidt, R.E., García-Sastre, A., Leib, D.A., Pekosz, A., Knobeloch, K.P., Horak, I., Virgin 4th., H.W., 2007 IFNstimulated gene 15 functions as a critical antiviral molecule against influenza, herpes, and Sindbis viruses Proc Natl Acad Sci U S A 104, 1371–1376 Liu, W., Hsu, C.H., Chang, C.Y., Chen, H.H., Lin, C.S., 2006 Immune response against grouper nervous necrosis virus by vaccination of virus-like particles Vaccine 24, 6282–6287 Lo, W.Y., Liu, K.F., Liao, I.C., Song, Y.L., 2004 Cloning and molecular characterization of heat shock cognate 70 from tiger shrimp (Penaeus monodon) Cell Stress Chaperones 9, 332 Lu, M.W., Chao, Y.M., Guo, T.C., Santi, N., Evensen, Ø., Kasani, S.K., Hong, J.R., Wu, J.L., 2008 The interferon response is involved in nervous necrosis virus acute and persistent infection in zebrafish infection model Mol Immunol 45, 1146–1152 Lu, M.W., Liu, W., Lin, C.S., 2003 Infection competition against grouper nervous necrosis virus by virus-like particles produced in Escherichia coli J Gen Virol 84, 1577–1582 Mori, K.I., Nakai, T., Muroga, K., Arimoto, M., Mushiake, K., Furusawa, I., 1992 Properties of a new virus belonging to nodaviridae found in larval striped jack (Pseudocaranx dentex) with nervous necrosis Virology 187, 368–371 Munday, B., Kwang, J., Moody, N., 2002 Betanodavirus infections of teleost fish: a review J Fish Dis 25 (3), 127–142 Nakai, T., Sugaya, T., Nishioka, T., Mushiake, K., Yamashita, H., 2009 Current knowledge on viral nervous necrosis (VNN) and its causative betanodaviruses Isr J Aquacult Bamid 61, 198–207 Nakanishi, T., Aoyagi, K., Xia, C., Dijkstra, J., Ototake, M., 1999 Specific cell-mediated immunity in fish Vet Immunol Immunopathol 72, 101–109 Nakanishi, T., Toda, H., Shibasaki, Y., Somamoto, T., 2011 Cytotoxic T cells in teleost fish Dev Comp Immunol 35, 1317–1323 Øvergård, A.C., Nerland, A.H., Fiksdal, I.U., Patel, S., 2011 Atlantic halibut experimentally infected with nodavirus shows increased levels of Tcell marker and IFN␥ transcripts Dev Comp Immunol 37, 139–150 Pakingking Jr., R., Bautista, N.B., de Jesus-Ayson, E.G., Reyes, O., 2010 Protective immunity against viral nervous necrosis (VNN) in brownmarbled grouper (Epinephelus fuscogutattus) following vaccination with inactivated betanodavirus Fish Shellfish Immunol 28, 525–533 ˜ D.L., Mori, K., Yamashita, H., Nakai, Pakingking Jr., R., Seron, R., Pena, T., 2009 Immune responses of Asian sea bass, Lates calcarifer Bloch, against an inactivated betanodavirus vaccine J Fish Dis 32, 457–463 Park, K.C., Osborne, J.A., Montes, A., Dios, S., Nerland, A.H., Novoa, B., Figueras, A., Brown, L.L., Johnson, S.C., 2009 Immunological responses of turbot (Psetta maxima) to nodavirus infection or polyriboinosinic polyribocytidylic acid (pIC) stimulation, using expressed sequence tags (ESTs) analysis and cDNA microarrays Fish Shellfish Immunol 26, 91–108 Plant, K.P., LaPatra, S.E., 2011 Advances in fish vaccine delivery Dev Comp Immunol 35, 1256–1262 Poisa-Beiro, L., Dios, S., Montes, A., Aranguren, R., Figueras, A., Novoa, B., 2008 Nodavirus increases the expression of Mx and inflammatory cytokines in fish brain Mol Immunol 45, 218–225 Randelli, E., Buonocore, F., Scapigliati, G., 2008 Cell markers and determinants in fish immunology Fish Shellfish Immunol 25, 326–340 Reed, L.J., Muench, H., 1938 A simple method of estimating fifty per cent endpoints Am J Hyg 27, 493–497 Scapigliati, G., Buonocore, F., Randelli, E., Casani, D., Meloni, S., Zarletti, G., Tiberi, M., Pietretti, D., Boschi, I., Manchado, M., Martin-Antonio, B., Jimenez-Cantizano, R., Bovo, G., Borghesan, F., Lorenzen, N., EinerJensen, K., Adams, S., Thompson, K., Alonso, C., Bejar, J., Cano, I., Borrego, J.J., Alvarez, M.C., 2010 Cellular and molecular immune responses of the sea bass (Dicentrarchus labrax) experimentally infected with betanodavirus Fish Shellfish Immunol 28, 303–311 Somamoto, T., Yoshiura, Y., Sato, A., Nakao, M., Nakanishi, T., Okamoto, N., Ototake, M., 2006 Expression profiles of TCR and CD8␣ mRNA correlate with virus-specific cell-mediated cytotoxic activity in ginbuna crucian carp Virology 348, 370–377 96 Y.-X Lai et al / Veterinary Immunology and Immunopathology 157 (2014) 87–96 Sommerset, I., Skern, R., Biering, E., Bleie, H., Fiksdal, I.U., Grove, S., Nerland, A.H., 2005 Protection against Atlantic halibut nodavirus in turbot is induced by recombinant capsid protein vaccination but not following DNA vaccination Fish Shellfish Immunol 18, 13–29 Sreedhar, A.S., Kalmár, É., Csermely, P., Shen, Y.F., 2004 Hsp90 isoforms: functions, expression and clinical importance FEBS Lett 562, 11–15 Tanaka, S., Mori, K., Arimoto, M., Iwamoto, T., Nakai, T., 2008 Protective immunity of sevenband grouper, Epinephelus septemfasciatus Thunberg, against experimental viral nervous necrosis J Fish Dis 24, 15–22 Thiery, R., Cozien, J., Cabon, J., Lamour, F., Baud, M., Schneemann, A., 2006 Induction of a protective immune response against viral nervous necrosis in the European sea bass Dicentrarchus labrax by using betanodavirus virus-like particles J Virol 80, 10201–10207 Utke, K., Bergmann, S., Lorenzen, N., Köllner, B., Ototake, M., Fischer, U., 2007 Cell-mediated cytotoxicity in rainbow trout Oncorhynchus mykiss, infected with viral haemorrhagic septicaemia virus Fish Shellfish Immunol 22, 182–196 Wang, B., Li, F., Dong, B., Zhang, X., Zhang, C., Xiang, J., 2006 Discovery of the genes in response to white spot syndrome virus (WSSV) infection in Fenneropenaeus chinensis through cDNA microarray Mar Biotechnol 8, 491–500 Wu, M.S., Chen, C.W., Lin, C.H., Tzeng, C.S., Chang, C.Y., 2012 Differential expression profiling of orange-spotted grouper larvae, Epinephelus coioides (Hamilton), that survived a betanodavirus outbreak J Fish Dis 35, 215–225 Yamashita, H., Mori, K., Nakai, T., 2009a Protection conferred against viral nervous necrosis by simultaneous inoculation of aquabirnavirus and inactivated betanodavirus in the sevenband grouper, Epinephelus septemfasciatus (Thunberg) J Fish Dis 32, 201–210 Yamashita, H., Mori, K., Kuroda, A., Nakai, T., 2009b Neutralizing antibody levels for protection against betanodavirus infection in sevenband grouper, Epinephelus septemfasciatus (Thunberg), immunized with an inactivated virus vaccine J Fish Dis 32, 767–775 Yuasa, K., Koesharyani, I., Roza, D., Mori, K., Katata, M., Nakai, T., 2002 Immune response of humpback grouper, Cromileptes altivelis (Valenciennes) injected with the recombinant coat protein of betanodavirus J Fish Dis 25, 53–56 Ziyaad, V.O., Ann, M., Enid, S., Anna-Lise, W., Edward, R., 2011 Abrogation of contaminating RNA activity in HIV-1 Gag VLPs Virol J 8, 462 ... these two concentrations of VLP vaccine Therefore, the VLP vaccine Fig Humoral immune responses of orange-spotted grouper stimulated by injecting IM VLPs VLPs in dosages of 15 g g−1 FBW (high... injection of V.L could neutralize more than 108 TCID50 ml−1 of virus Therefore, one injection of V.L could be an economical immunization procedure for orange-spotted grouper 3.5 Quantification of 11 immune- related... the 3D structure of the protrusion surface of the VLP is important for stimulating the host immune system Although the average antibody titer of V.H (3.6) was higher than that of V.L (3.5), there