DSpace at VNU: Genetic variation of FUT2 in a Vietnamese population: identification of two novel Se enzyme-inactivating mutations

ORIGINAL ARTICLE Genetic variation of FUT2 in a Vietnamese population: identification of two novel Se enzyme–inactivating mutations _3485 Mikiko Soejima, Ryo Fujimoto, Tetsuro Agusa, Hisato Iwata, Junko Fujihara, Haruo Takeshita, Tu Binh Minh, Pham Thi Kim Trang, Pham Hung Viet, Tamiko Nakajima, Joji Yoshimoto, Shinsuke Tanabe, and Yoshiro Koda BACKGROUND: The human FUT2 gene encodes a secretor-type a(1,2)fucosyltransferase, and many population-specific polymorphisms have been reported in the coding region STUDY DESIGN AND METHODS: Direct sequencing, real-time polymerase chain reaction, and high-resolution melt (HRM) analysis were done to detect singlenucleotide polymorphism (SNPs) and copy number variations (CNVs) in a Vietnamese population The impacts of two novel mutations on the encoded enzyme were examined by a transient expression study RESULTS: The major nonfunctional allele in the 294 Vietnamese was se357,385, whereas no CNV was detected Two novel SNPs, 818C>A (Thr273Asn) and 853G>A (Ala285Thr), distributed at low frequency, were shown to remarkably affect the enzyme activity CONCLUSION: The allelic polymorphism of FUT2 in Vietnamese is similar to that of other East and Southeast Asian populations This result may reflect the history and gene flow of this population In addition, HRM analysis seems to be a simple and effective method for screening rare SNPs of FUT2 in a large number of samples [Correction statement added after online publication 21-Dec-2011: Thr273Ala has been updated to Thr273Asn throughout.] T he secretor-type a(1,2)fucosyltransferase, encoded by FUT2, regulates the expression of the H antigen (essential precursor of A and B antigens) not on red blood cells but on the surface of mucosa and in body fluids and hence determines the secretor status of the ABO(H) antigens Secretors who have the antigens in saliva and other body fluids have at least one functional FUT2 allele (Se), while homozygotes of nonfunctional FUT2 alleles (se) become nonsecretors who not express the antigens in saliva and other body fluids.1,2 As shown in Table 1, many single-nucleotide polymorphisms (SNPs) and genetic recombination in the coding ABBREVIATIONS: CNV(s) = copy number variation(s); DHPLC = denaturing high-performance liquid chromatography; HRM = high-resolution melt; SIFT = Sorting Intolerant From Tolerant; SNP(s) = single-nucleotide polymorphism(s) From the Department of Forensic Medicine and Human Genetics, Kurume University School of Medicine, Kurume, Japan; the Center for Marine Environmental Studies (CMES), Ehime University, Matsuyama, Japan; the Department of Legal Medicine, Shimane University Faculty of Medicine, Izumo, Japan; the Center for Environmental Technology and Sustainable Development (CETASD), Hanoi University of Science, Vietnam National University, and the Vietnam Environment Administration (VEA), Ministry of Natural Resources and Environment (MONRE), Hanoi, Vietnam; and the Department of Legal Medicine, Gunma University, Graduate School of Medicine, Maebashi, Gunma, Japan Address reprint requests to: Yoshiro Koda, Department of Forensic Medicine and Human Genetics, Kurume University School of Medicine, Kurume 830-0011, Japan; e-mail: ykoda@ med.kurume-u.ac.jp This work was supported by grants-in-aid for Scientific Research from the Ministry of Education, Science, Culture and Sports of Japan Received for publication July 18, 2011; revision received October 16, 2011, and accepted October 28, 2011 doi: 10.1111/j.1537-2995.2011.03485.x TRANSFUSION **;**:**-** Volume **, ** ** TRANSFUSION SOEJIMA ET AL TABLE Characteristic FUT2 SNPs and alleles in several populations Allele Functional Se Se40 Se278,357 Prevalence Reference 40A>G 278C>T 357C>T No change Ile14Val Ala93Val Many populations Africans Iranians, Sri Lankans, Israelis 357C>T 357C>T 480C>T No change No change 375A>G No change 400G>A 481G>A Val134Ile Asp161Asn Many populations Africans, South and West Asians, Europeans New Guineans, African, Samoans New Guineans, Samoans Africans Koda et al.9,10 Liu et al.,11 Soejima et al.21 Koda et al.,7 Soejima and Koda,18 Storry et al.22 Koda et al.9,10 Liu et al.,11 Soejima et al.21 Se357 Se357,480 Se375 302C>T Ile101Pro South Asians se357,385 385A>T Ile129Phe East and Southeast Asians se357,571 357C>T 571C>T Arg191Ter Samoans, Taiwanese se357,480,778del se428 357C>T 480C>T 778delC 428G>A plus Frame shift 259, 275Ter Trp143Ter 628C>T 849G>A Arg210Ter Trp283Ter Africans Europeans, Iranians, Africans, South and West Asians Japanese, Thai, Taiwanese Taiwanese Se400 Se481 Nonfunctional se302 se628 se849 Recombinant sefus sedel sedel2 sedel3 SNP Amino acid change Hybrid of Sec1 and FUT2 Japanese Alu-Alu recombinations Alu-Alu recombinations Alu-Alu recombinations South Asians Samoans, New Guineans Chinese region of the FUT2 locus have been identified, and some of them appear in a population-specific manner.3-24 Polymerase chain reaction (PCR)–high-resolution melt (HRM) is based on the analysis of melting properties of formed heteroduplexed amplicons and is similar to other heteroduplex detection-based techniques such as denaturing high-performance liquid chromatography (DHPLC).25 We previously introduced DHPLC for FUT2 genotyping.18,21 Compared to DHPLC, HRM analysis is a closed-tube post-PCR method without optimization of column temperature for each amplicon and is suitable for high-throughput assays because of its rapidity and simplicity In this study, we analyzed the genetic variation in the FUT2 coding region in Vietnamese, a Southeast Asian population, to further understanding of the allelic variation of FUT2 In addition, we introduced and evaluated HRM analysis as a method for genotyping the FUT2 gene Koda et al.7 Koda et al.7 Liu et al.,11 Soejima et al.,21 Pang et al.,15 Soejima and Koda15,18,19 Chang et al.,4 Koda et al.,6 Liu et al.,12 Pang et al.,16 Peng et al.17 Henry et al.,5 Pang et al.,15 Yu et al.23,24 Liu et al.,11 Soejima et al.,21 Koda et al.,10 Liu et al.,11 Oriol et al.14 Chang et al.,3,4 Koda et al.6 Yu et al.23,24 Koda et al.,6 Liu et al.,12 Mitani et al.13 Koda et al.,8 Pang et al.15 Koda et al.,8 Pang et al.15 Soejima and Koda20 were obtained from 294 randomly selected Vietnamese individuals in rural areas of Hoa Hau and Liem Thuan in Ha Nam Province; Thach Hoa, Thanh Van, and Son Dong in Ha Tay Province; and Van Phuc in Hanoi in the Red River Delta, Vietnam.26 All samples were kept at -25°C in a freezer of the Environmental Specimen Bank (es-BANK) in Ehime University.27 Genomic DNAs were isolated by using blood kits (Gentra Puregene, Qiagen, Tokyo, Japan) PCR amplification of coding region of FUT2 and sequence analysis The PCR amplification and subsequent direct sequencing of FUT2 were performed as described previously.28 The copy number variations (CNVs) including deletion alleles (sedel, sedel2, and sedel3) and sefus were detected by real-time PCR (TaqMan, Applied Biosystems, Tokyo, Japan), as described previously.20 We also examined four known CNVs by conventional PCR using three sets of primers, as described previously.6,8,15,20 MATERIALS AND METHODS DNA samples This study protocol was approved by the ethical committees of Ehime University and Kurume University School of Medicine Because only DNA samples were available, we could not examine either the secretor status or the Lewis phenotypes of the subjects in this study Blood samples TRANSFUSION Volume **, ** ** Genotyping of 385A>T by TaqMan SNP genotyping assay The TaqMan predesigned SNP genotyping assay (Assay ID C_8832449_10, Life Technologies, Tokyo, Japan) was applied for genotyping of 385A>T of 294 Vietnamese persons The PCR procedure was carried out in a 96-well FUT2 IN VIETNAM plate with 20-mL volume composed of 10 mL of universal probe master (FastStart, Roche Diagnostics, Tokyo, Japan), 0.5 mL probe-primer mix, and approximately 10 ng of DNA PCR conditions included 95°C for 10 minutes, followed by 45 cycles of 95°C for 15 seconds and 60°C for 60 seconds To monitor the progression of amplification, we measured the fluorescence at the end of each cycle using a real-time PCR system (Mx3000P, Agilent Technologies, Tokyo, Japan) equipped with excitation-emission filters of 492-516 nm (FAM) or 535-555 nm (VIC) Data were collected and analyzed using computer software (MxPro, Version 4.10; Agilent Technologies, Tokyo, Japan) PCR-HRM assay and analysis To screen new mutations and SNPs with low frequencies, we performed HRM analysis The primer pairs used are listed in Table Fragment was scanned for the 143-bp region including 628C>T and Fragment for the 116-bp region including 818C>A, 849G>A, and 853G>A The 20-mL PCR procedure contained approximately 10 ng of genomic DNA, 10 mL of high resolution melting master (LightCycler 480, Roche Diagnostics), 2.5 mmol/L MgCl2, and 250 nmol/L each primer The amplification was performed on a real-time PCR platform (LightCycler 480 instrument II, Roche) and entailed an initial denaturation step at 95°C for 10 minutes, followed by 45 cycles of denaturation at 95°C for 10 seconds and annealing at 60°C for minute Before the HRM step, the products were heated to 95°C for minute and cooled to 60°C for minute allowing heteroduplex formation HRM was carried out and the data were collected over the range from 65 to 96°C, increasing at 0.02°C/sec with 25 acquisitions/sec Gene scanning software (LightCycler 480, Roche Diagnostics) was used for analysis of the melting curves obtained Briefly, the raw melting curve data were normalized by manual adjustment of linear regions before (pre- or 100% fluorescence) and after (post- or 0% fluorescence) the melting transition Temperature shifting was automatically performed using a default temperature shift threshold of 5% and 0.3 as the internal instrument sensitivity settings Samples with heterozygous SNPs can be distinguished from homozygous by the different shapes of normalized and temperature-shifted melting curves The curves were further automatically subtracted from assigned reference curves to generate difference plots that were automatically clustered into separate groups All samples of groups differentiated from the reference group were further confirmed by PCR direct sequencing of the full length of the coding region of FUT2, as mentioned above Determination of FUT2 haplotypes To determine the FUT2 haplotypes of the individuals who were heterozygous for newly found mutations, we performed PCR cloning as described previously.28 Transient expression of FUT2 alleles To examine the functional significance of the two novel nonsynonymous mutations, transient expression study was performed as described previously except the flow cytometer used.28 The FUT2 alleles carrying newly found mutations of FUT2 (818C>A and 853G>A), Se357 (wild-type allele), or se357,385 (weak-secretor allele) were inserted into pcDNA3.1(+) These constructs together with the pGL3 Promoter were then transfected into COS-7 cells The cells were immunostained using anti-H 1E3 antibody, which is specific for H Type antigen,29 and H antigen expression on cell surfaces was examined using a flow cytometer (FACSCanto II, Becton Dickinson, Franklin Lakes, NJ) Transfection efficiency in each experiment was checked by luciferase luminescence intensity The experiments were repeated eight times Prediction of effects of SNPs on enzyme activity We also predicted the effect of each newly identified amino acid substitution on protein by using PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/)30 and Sorting Intolerant From Tolerant (SIFT; http://sift.jcvi.org/).31 PolyPhen-2 is a tool that predicts the possible impact of an amino acid substitution on the structure and function of a human protein using straightforward physical and comparative considerations SIFT uses sequence and/or structure to predict the effect of an amino acid substitution on protein function RESULTS Sequence variation in FUT2 We encountered five SNPs including two novel SNPs, 818C>A (T273N) and 853G>A (A285T), in the coding region of FUT2 by direct DNA sequencing in 94 randomly selected Vietnamese persons (Table 3) [Correction statement TABLE Amplified regions, primers used, and residing SNPs for HRM analysis Region Fragment Fragment Name FUT2HRM-545F FUT2HRM-687R FUT2HRM-778F FUT2HRM-893R Sequence (5′ to 3′) GCACCTTTGTAGGGGTCCAT CACGAAGATGAGGGAGCTGT CCTGCCAAAGATTTTGCTCTA TAATTGGCCAGGTAGATGGTG 545 668 778 873 Position in FUT2 to 564 bp to 687 bp (antisense) to 798 bp to 893 bp (antisense) Residing SNPs 571C>T, 628C>T 818C>A, 849G>A, 853G>A Volume **, ** ** TRANSFUSION SOEJIMA ET AL added after online publication 21-Dec-2011: T273A has been updated to T273N.] We then determined the FUT2 haplotypes of the individuals with 818C>A (Thr273Asn) and 853G>A (Ala285Thr) inserting them into a plasmid The results suggested that 818C>A (Thr273Asn) was on the Se357 allele with 357C>T synonymous substitution, while 853G>A (Ala285Thr) was on wild-type Se allele As mentioned below, functional analysis suggested both alleles to be nonfunctional Therefore, we designated these two alleles as se357,818 and se853, respectively HRM analysis for FUT2 SNP detection To evaluate the detection of three SNPs (818C>A, 853G>A, and 849G>A) by HRM, we amplify a 116-bp region (Fragment 2) from 778 to 893 (Table 2) in 94 randomly selected TABLE Allele frequency of FUT2 in 94 Vietnamese Allele frequency Functional alleles Se Se357 Nonfunctional alleles se357,385 se849 se357,818 se853 n 73 21 52 115 111 1 (%) (38.8) (11.2) (27.7) (61.2) (59.0) (0.5) (0.5) (1.1) Vietnamese persons The normalized temperature-shifted melting curves and difference plot are shown in Fig After the normalization procedure, we could discriminate the two groups of se853/Se and se357,385/se849 (Group A), and se357,818/Se357 (Group B) from the reference group Because se853/Se and se357,385/se849 showed the same pattern (Group A), we cannot distinguish 853G>A (Ala285Thr) and 849G>A (Trp283Ter) substitutions in melting curve patterns Subsequently, we performed this assay on 200 additional Vietnamese individuals, and two samples were ascribed to group A The direct sequencing of total coding region of these two individuals showed the genotypes of se357,385/se849 and se628/se849 Because we encountered the previously reported 628C>T mutation (Arg210Ter) in one sample (se628/se849), we then designed an HRM assay protocol to detect this SNP The amplicon (Fragment 1) encompassed the 143-bp region from 545 to 687 (Table 2) As shown in Fig 1, we detected one group was distinguishable from the other We then observed five additional samples with same melting curve as the se628/se849 sample, and sequencing showed that all of them were heterozygous for 628C>T (two se357,385/se628, one se357/se628, and two Se/se628) After we added the seven individuals mentioned above, we encountered seven alleles and six SNPs in 101 Vietnamese persons by direct sequencing of the entire coding region of FUT2 (Table 5) Fig PCR-HRM analysis of two partial coding regions of the FUT2 gene Typical results for Fragment and Fragment are shown Normalized and temperature-shifted melting curves (top) and normalized and temperature-shifted difference plot (bottom) TRANSFUSION Volume **, ** ** FUT2 IN VIETNAM Functional analyses of alleles containing two novel nonsynonymous mutations The expression of H antigen in the COS-7 cells transfected with pcDNA3.1-se357,818 (1.65 Ϯ 0.45%) and pcDNA3.1se853 (1.65 Ϯ 0.45%) was almost undetectable, as was the expression in COS-7 cells transfected with plasmid pcDNA3.1 (1.76 Ϯ 0.96%, n = 8, negative control) Under the same conditions, the percentage of H-antigen– positive cells of transfectants of pcDNA3.1-Se357 and pcDNA3.1-se357,385 were 30.54 Ϯ 3.11% (wild type, positive control) and 6.13 Ϯ 1.70%, respectively (n = 8) The mean values of the luciferase luminescence intensities (relative light unit) representing transfection efficiency did not show significant difference: 86201, 62047, 88420, 52461, and 77753 for pcDNA3.1-se357,818, pcDNA3.1-se853, pcDNA3.1, pcDNA3.1-Se357, and pcDNA3.1-se357,385, respectively These results suggested that both of se357,818 and se853 were nonsecretor alleles constitute recombination-promoting motifs, have probably played an important role in initiating homologous recombination events involving the FUT2 locus.32,33 By using a TaqMan probe–based CNVs assay, however, we found no known CNVs including sefus, sedel, sedel2, and sedel3 and other possible recombinants in the present population To estimate the proportion of nonfunctional alleles and nonsecretors (weak secretors), we determined genotypes of 385A>T (Ile129Phe) by TaqMan SNP genotyping assay of 294 individuals The result obtained by this assay was fully consistent with that by PCR direct sequencing for 101 (the first 94 randomly selected plus the additional seven) samples The number of individuals with A/A, A/T, and T/T were 65, 139, and 90, respectively Together from the results of HRM analysis, we observed 257 secretor (43.7%), 319 weak secretor (54.3%), and 12 nonsecretor alleles (2.0%), respectively From the genotyping results, we estimated 197 secretors (67.0%), 97 weak secretors (32.7%), and nonsecretor (0.3%) in this population Significance of novel nonsynonymous mutations The results of transient expression studies suggested that both 818C>A (Thr273Asn) and 853G>A (Ala285Thr) are expected to result in amino acid changes in the catalytic domain of the enzyme and inactivate or at least significantly reduce the encoded enzyme activity In addition, both changes may give rise to a difference in polarity and are predicted to be “probably damaging” by PolyPhen2 (http://genetics.bwh.harvard.edu/pph2/)30 and as “affecting protein function” by SIFT (http://sift.jcvi.org/; Table 4).31 These results also supported the results of the transient expression study of the FUT2 allele containing two new mutations Haplotype variation at FUT2 In total, six FUT2 alleles were inferred in 94 Vietnamese individuals (Se, Se357, se357,385, se849, se357,818, and se853) and the major nonfunctional allele is se357,385 (Table 3), which is the predominant allele in other East and Southeast Asian populations.4,6,10,12,17 In addition, FUT2 had at least four recombination alleles (Table 1) For the formation of these recombination alleles, local DNA sequences that are capable of forming non–B-DNA conformations, or which DISCUSSION In this study, we seemed to successfully detect several rare SNPs using this HRM analysis, although there is a possibility of failing to detect the homozygotes of a mutant allele because of the difficulty in differentiation by melting curve analysis However, to increase the sensitivity of the assay, homozygote mutants can be differentiated from wild-type and heterozygote mutant samples by spiking the sample with low amounts (10%-20%) of wild-type DNA Therefore, HRM analysis seems to be a simple and effective method of screening for rare SNPs of the FUT2 gene in a large number of samples We compared the frequencies of the polymorphisms observed in this study with that of the geographically closer populations already studied (Table 5) The FUT2 gene shows genetic variation in a population-specific manner and that of Vietnam also may reflect the present geographic location and the history of human migration As discussed previously, the frequencies of nonsecretor (or weak secretor) status in inhabitants of low latitudes are much higher than in inhabitants of high latitudes.28 Recent studies also suggested that the frequency of weak TABLE Novel SNPs identified in this study and their putative effects on encoded enzymes SNPs CG site 818C>A 853G>A CG Amino acids Domain Amino acid change from to Thr273Asn Catalytic Polar Polar Ala285Thr Catalytic Nonpolar Polar PolyPhen-2 prediction28 (score) Probably damaging (0.999) Probably damaging (0.968) SIFT prediction29 (score) Affect protein function (0.00) Affect protein function (0.00) Allele se357,818 se853 Expression level (%) (n = 8) 1.65 Ϯ 0.45 1.88 Ϯ 0.81 [Correction statement added after online publication 21-Dec-2011: Amino acid change columns have been updated PolyPhen-2 prediction (score) for 818C>A has been updated to 0.999 and the SIFT prediction (score) has been updated to 0.00.] Volume **, ** ** TRANSFUSION ACKNOWLEDGMENTS We thank Ms Kimiko Kimura for helpful suggestions and techni- 0.9 0.7 0 cal assistance and Ms Katherine Ono for the English editing of the manuscript The authors thank the staff of the CETASD, Hanoi University of Science, for their help in sample collection 1.2 685-687 688-690 818 C>A 0.5 0.2 849 G>A 0.5 0.5 1.6 0.9 6.8 1.5 0 853 G>A 1.1 0.3 Reference This study (direct sequencing) This study (real-time PCR) Chang et al.3 Liu et al.12 Chang et al.3 Chang et al.3 Chang et al.3 Pang et al.16 secretor allele (se357,385) seems to be increased relative recently by nonneutral evolution such as a directional selection.10,34 Nonsecretors have an increased incidence of Crohn’s disease, urinary tract infections, and vaginal candidiasis, but a reduced incidence of infection by certain genotypes of noroviruses and Helicobacter pylori, and they usually have a slow disease progression of human immunodeficiency virus Type infection.35-40 These results suggested that a mixture of secretors and nonsecretors (and/or weak secretors) may be advantageous for human survival during different pathogen outbreaks, and weak secretors, particularly in inhabitants of low latitudes, may have the benefits of both secretors and nonsecretors 0.3 658 C>T CONFLICT OF INTEREST 628 C>T 1.0 0 0.4 0 There are no conflicts of interest to declare 571 C>T 0.7 1.0 0.6 13.3 3.3 1.2 428 G>A 0 0 0 2.4 posing that the Se gene is a structural gene closely linked to the H gene Am J Hum Genet 1981;33:421-31 Chang JG, Ko YC, Lee JC, Chang SJ, Liu TC, Shih MC, Peng Clausen H, Hakomori S ABH and related histo-blood group antigens; immunochemical differences in carrier TRANSFUSION Volume **, ** ** * 685-687 = 685-687GTG>del 688-690 = 688-690GTC>del † Blank cells represent site not explored 0.6 0 84.4 83.1 88.9 85.5 89.3 92.9 Han-South (1) Han-South (2) (Guangzhou) Thai Filipino Indonesian (1) Indonesian (2) (Surabaya) Sample size (2N) 188 588 154 308 530 234 270 84 302 C>T † 357 C>T 87.2 isotypes and their distribution Vox Sang 1989;56:1-20 Oriol R, Danilovs J, Hawkins BR A new genetic model pro- 385 A>T 59.0 54.3 43.5 48.1 50.94 34.19 48.52 63.1 REFERENCES Population Vietnamese TABLE Frequencies of derived state of substitutions in FUT2 in Vietnamese and neighboring Asian populations SOEJIMA ET AL CT Molecular analysis of mutations and polymorphisms of the Lewis secretor type alpha(1,2)-fucosyltransferase gene reveals that Taiwan aborigines are of Austronesian derivation J Hum Genet 2002;47:60-5 Chang JG, Yang TY, Liu TC, Lin TP, Hu CJ, Kao MC, Wang NM, Tsai FJ, Peng CT, Tsai CH Molecular analysis of secretor type alpha(1,2)-fucosyltransferase gene mutations in the Chinese and Thai populations Transfusion 1999;39: 1013-7 Henry S, Mollicone R, Lowe JB, Samuelsson B, Larson G A second nonsecretor allele of the blood group alpha(1,2) fucosyl-transferase gene (FUT2) Vox Sang 1996;70:21-5 Koda Y, Soejima M, Liu Y, Kimura H Molecular basis for secretor type alpha(1,2)-fucosyltransferase gene deficiency in a Japanese population: a fusion gene generated by unequal crossover responsible for the enzyme deficiency Am J Hum Genet 1996;59:343-50 Koda Y, Ishida T, Tachida H, Wang B, Pang H, Soejima M, Soemantri A, Kimura H DNA sequence variation of the FUT2 IN VIETNAM human ABO-secretor locus (FUT2) in New Guinean MJ, Yahalom V, Levene C, Fujita C, Castilho L, Hustinx H, populations: possible early human migration from Africa Hum Genet 2003;113:534-41 Olsson ML Identification of six new alleles at the FUT1 and FUT2 loci in ethnically diverse individuals with Koda Y, Soejima M, Johnson PH, Smart E, Kimura H An Alu-mediated large deletion of the FUT2 gene in individuals with the ABO-Bombay phenotype Hum Genet 2000; 106:80-5 Koda Y, Soejima M, Kimura H The polymorphisms of fucosyltransferases Leg Med 2001;3:2-14 10 Koda Y, Tachida H, Pang H, Liu Y, Soejima M, Ghaderi AA, group alpha(1,2)fucosyltransferase gene (FUT2) Vox Sang 1999;76:115-9 an African (Xhosa) population of South Africa Hum Genet 1998;103:204-10 12 Liu YH, Koda Y, Soejima M, Pang H, Wang BJ, Kim DS, Oh HB, Kimura H The fusion gene at the ABO-secretor locus (FUT2): absence in Chinese populations J Hum Genet 1999;44:181-4 13 Mitani T, Tsujita H, Sonoda S, Akane A Se genotyping following allele-specific polymerase chain reaction amplification Leg Med (Tokyo) 2002;4:193-6 14 Oriol R, Candelier JJ, Mollicone R Molecular genetics of H Vox Sang 2000;78 Suppl 2:105-8 15 Pang H, Fujitani N, Soejima M, Koda Y, Islam MN, Islam AK, Kimura H Two distinct Alu-mediated deletions of the human ABO-secretor (FUT2) locus in Samoan and Bangladeshi populations Hum Mutat 2000;16:274 16 Pang H, Koda Y, Soejima M, Fujitani N, Ogaki T, Saito A, Kawasaki T, Kimura H Polymorphism of the human ABOsecretor locus (FUT2) in four populations in Asia: indication of distinct Asian subpopulations Ann Hum Genet 2001;65:429-37 17 Peng CT, Tsai CH, Lin TP, Perng LI, Kao MC, Yang TY, 21 22 populations Transfusion 2001;41:1279-84 24 Yu LC, Lee HL, Chu CC, Broadberry RE, Lin M A newly identified nonsecretor allele of the human histo-blood Kimura H Extensive polymorphism of the FUT2 gene in 20 alpha(1,2)-fucosyltransferase gene in various Taiwanese phisms at the ABO-secretor gene (FUT2) and plasma alpha(1,3)fucosyltransferase gene (FUT6) in human populations Genetics 2001;158:747-56 19 46:2149-55 23 Yu LC, Chu CC, Chan YS, Chang CY, Twu YC, Lee HL, Lin M Polymorphism and distribution of the secretor Takenaka O, Kimura H Contrasting patterns of polymor- 11 Liu Y, Koda Y, Soejima M, Pang H, Schlaphoff T, duToit ED, 18 Bombay and Para-Bombay phenotypes Transfusion 2006; Wang NM, Liu TC, Lin SF, Chang JG Molecular characterization of secretor type alpha(1, 2)-fucosyltransferase gene deficiency in the Philippine population Ann Hematol 1999;78:463-7 Soejima M, Koda Y Denaturing high-performance liquid chromatography-based genotyping and genetic variation of FUT2 in Sri Lanka Transfusion 2005;45:1934-9 Soejima M, Koda Y Molecular mechanisms of Lewis antigen expression Leg Med 2005;7:266-9 Soejima M, Koda Y TaqMan-based real-time polymerase chain reaction for detection of FUT2 copy number variations: identification of novel Alu-mediated deletion Transfusion 2011;51:762-9 Soejima M, Pang H, Koda Y Genetic variation of FUT2 in a Ghanaian population: identification of four novel mutations and inference of balancing selection Ann Hematol 2007;86:199-204 Storry JR, Johannesson JS, Poole J, Strindberg J, Rodrigues 25 Vossen RH, Aten E, Roos A, den Dunnen JT Highresolution melting analysis (HRMA): more than just sequence variant screening Hum Mutat 2009;30: 860-6 26 Agusa T, Iwata H, Fujihara J, Kunito T, Takeshita H, Minh TB, Trang PT, Viet PH, Tanabe S Genetic polymorphisms in AS3MT and arsenic metabolism in residents of the Red River Delta, Vietnam Toxicol Appl Pharmacol 2009;236: 131-41 27 Tanabe S Environmental Specimen Bank in Ehime University (es-BANK), Japan for global monitoring J Environ Monit 2006;8:782-90 28 Soejima M, Nakajima T, Fujihara J, Takeshita H, Koda Y Genetic variation of FUT2 in Ovambos, Turks, and Mongolians Transfusion 2008;48:1423-31 29 Nakajima T, Yazawa S, Miyazaki S, Furukawa K Immunochemical characterization of anti-H monoclonal antibodies obtained from a mouse immunized with human saliva J Immunol Methods 1993;159:261-7 30 Sunyaev S, Ramensky V, Koch I, Lathe W 3rd, Kondrashov AS, Bork P Prediction of deleterious human alleles Hum Mol Genet 2001;10:591-7 31 Ng PC, Henikoff S Predicting the effects of amino acid substitutions on protein function Annu Rev Genomics Hum Genet 2006;7:61-80 32 Chen JM, Cooper DN, Ferec C Local DNA sequence determinants of FUT2 copy number variation Transfusion 2011; 51:1359-61 33 Chen JM, Ferec C Role of non-B DNA conformations in initiating the nonallelic homologous recombinationderived Se allele and the interlocus gene conversionderived Sec1-FUT2-Sec1 hybrid allele Transfusion 2008;48: 1522-3; author reply 3-4 34 Ferrer-Admetlla A, Sikora M, Laayouni H, Esteve A, Roubinet F, Blancher A, Calafell F, Bertranpetit J, Casals F A natural history of FUT2 polymorphism in humans Mol Biol Evol 2009;26:1993-2003 35 Boren T, Falk P, Roth KA, Larson G, Normark S Attachment of Helicobacter pylori to human gastric epithelium mediated by blood group antigens Science 1993;262: 1892-5 36 Franke A, McGovern DP, Barrett JC, Wang K, Radford- Volume **, ** ** TRANSFUSION SOEJIMA ET AL Smith GL, Ahmad T, Lees CW, Balschun T, Lee J, Roberts Hinkula J, Svensson L A nonsense mutation (428G–>A) in R, Anderson CA, Bis JC, Bumpstead S, Ellinghaus D, Festen EM, Georges M, Green T, Haritunians T, Jostins L, Latiano the fucosyltransferase FUT2 gene affects the progression of HIV-1 infection AIDS 2006;20:685-9 A, Mathew CG, Montgomery GW, Prescott NJ, Ray- 39 Lindesmith L, Moe C, Marionneau S, Ruvoen N, Jiang X, chaudhuri S, Parkes M et al Genome-wide meta-analysis Lindblad L, Stewart P, LePendu J, Baric R Human suscep- increases to 71 the number of confirmed Crohn’s disease susceptibility loci Nat Genet 2010;42:1118-25 tibility and resistance to Norwalk virus infection Nat Med 2003;9:548-53 37 Hurd EA, Domino SE Increased susceptibility of secretor 40 Sheinfeld J, Schaeffer AJ, Cordon-Cardo C, Rogatko A, Fair factor gene Fut2-null mice to experimental vaginal candidiasis Infect Immun 2004;72:4279-81 38 Kindberg E, Hejdeman B, Bratt G, Wahren B, Lindblom B, TRANSFUSION Volume **, ** ** WR Association of the Lewis blood-group phenotype with recurrent urinary tract infections in women N Engl J Med 1989;320:773-7  ... Nonfunctional se3 02 se6 28 se8 49 Recombinant sefus sedel sedel2 sedel3 SNP Amino acid change Hybrid of Sec1 and FUT2 Japanese Alu-Alu recombinations Alu-Alu recombinations Alu-Alu recombinations South Asians... variations: identification of novel Alu-mediated deletion Transfusion 2011;51:762-9 Soejima M, Pang H, Koda Y Genetic variation of FUT2 in a Ghanaian population: identification of four novel mutations and... the FUT2 allele containing two new mutations Haplotype variation at FUT2 In total, six FUT2 alleles were inferred in 94 Vietnamese individuals (Se, Se3 57, se3 57,385, se8 49, se3 57,818, and se8 53)