DSpace at VNU: Differentiating of banked human umbilical cord blood-derived mesenchymal stem cells into insulin-secretin...
In Vitro Cell.Dev.Biol.—Animal (2011) 47:54–63 DOI 10.1007/s11626-010-9356-5 Differentiating of banked human umbilical cord blood-derived mesenchymal stem cells into insulin-secreting cells Pham Van Phuc & Truong Hai Nhung & Dang Thi Tung Loan & Doan Chinh Chung & Phan Kim Ngoc Received: 20 May 2010 / Accepted: 18 October 2010 / Published online: 17 November 2010 / Editor: J Denry Sato # The Society for In Vitro Biology 2010 Abstract Umbilical cord blood (UCB)-derived mesenchymal stem cells (MSCs) are multipotent cells They are able to differentiate into functional cells from not only mesoderm but also endoderm Many researches showed that cells derived from fresh human UCB could transdifferentiate into insulinsecreting cells In this study, transdifferentiating potential of cryopreserved human UCB-derived MSCs into insulinsecreting cell was investigated Fresh human UCB was enriched the mononuclear cells by Ficoll–Paque centrifugation The mononuclear cell population was cryopreserved in cryomedium containing Iscove’s modified Dulbecco’s media (IMDM) with 10% DMSO at −196°C for yr After thawing, mononuclear cells were cultured to isolate MSCs in medium IMDM with 20% FBS supplemented with growth factors At the fifth passages, MSCs were confirmed by flow cytometry about expression of CD13, CD14, CD34, CD45, CD166, and HLA-DR markers; after that, they were induced to differentiate into adipocytes and osteoblasts After inducing with specific medium for islet differentiation, there were many clusters of cell like islet at day 14–28 Using real-time reverse transcription polymerase chain reaction (RT-PCR) to analyze the expression of functional genes, the result showed that Nestin, Pdx-1, Ngn3, Ils-1, Pax6, Pax4, Nkx2.2, Nkx6.1, Glut-2, Insulin genes expressed The results showed that MSCs derived from banked cord blood can differentiate into functional pancreatic islet-like cells in vitro If human MSCs, especially MSCs from banked cord blood of diabetes patients themselves can be isolated, proliferated, differentiated into functional pancreatic P V Phuc (*) : T H Nhung : D T T Loan : D C Chung : P K Ngoc Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, Hanoi, Vietnam e-mail: pvphuc@hcmuns.edu.vn islet-like cells, and transplanted back into them (autologous transplantation), their high-proliferation potency and rejection avoidance will provide one promising therapy for diabetes Keywords Cryopreserved umbilical cord blood Mesenchymal stem cells insulin-secreting cells Umbilical cord blood Introduction Diabetic mellitus (DM) caused by an absolute insulin deficiency due to the destruction of insulin secreting pancreatic cells (type DM) or by a relative insulin deficiency due to decreased insulin sensitivity (type DM) is one of the leading reasons of morbidity and mortality in many countries In recent years, cell replacement therapy for DM, especially type DM, has received much more attention However, although islet transplantation could render many patients free from exogenous insulin injections, there are no sufficient organ donors and the recipients may face the risk of anti-rejection therapies (Ryan et al 2001) Today, significant effort is being given to find alternative means to treat diabetes through stem cell therapy Several reports have been published concerning the differentiation of many kinds of stem cells into insulin-producing pancreas islet beta cells, including embryonic stem cells (ESCs; Bonner-Weir et al 2000; Shapiro et al 2000; Zulewski et al 2001), bone marrow-derived MSCs (Petropavlovskaia and Rosenberg 2002), pancreatic stem cells (Lumelsky et al 2001; Gao et al 2003; Leon-Quinto et al 2004), and umbilical cord blood (UCB stem cells; Sun et al 2007; Gao et al 2008) DIFFERENTIATING OF BANKED HUMAN UMBILICAL CORD BLOOD ESCs have been assumed to be able to differentiate into any kind of cell lineages However, ethical impediments and limited resource are obstacles of research on ESCs Furthermore, even though insulin-secreting cells were produced by ESCs, teratoma formation was reported after transplantation into animals (Jahr and Bretzel 2003) Adult stem cells, such as bone marrow mesenchymal stem cells and pancreatic stem cells, have high immunogenic property Fetal stem cells, especially cord blood stem cells, have advantages to become a tool for stem cells therapy in clinic, mainly because of their low immunogenic property and relatively simple collecting resource As the use of autologous or allogeneic hematopoietic stem cell transplantation in the treatment of various diseases has grown rapidly in recent years, the idea of UCB banking for future use has drawn great interest More than 100,000 units of UCB have been collected, frozen, and stored worldwide in anticipation of their clinical use Study on the potential of cryopreserved UCB is of great importance for its future clinical use and we have made an attempt to investigate the capabilities In this research, we report that mononuclear cell fractions from cryopreserved UCB contained stem cells MSCs and they could be differentiated into insulin-secreting cells The success of this research will open a new hope to apply umbilical cord blood in diabetic treatment using stem cell therapy, especially banked umbilical cord blood Material and Methods UCB collection and banking UCB collection Human UCB was obtained from Hung Vuong Hospital, HCM city, Vietnam UCB was collected from the umbilical cord vein with informed consent of the mother A bag system containing 17 ml of anticoagulant (citrate, phosphate, and dextrose) was used All UCB units were processed within h after delivery Isolation of mononuclear cells To isolate mononuclear cells (MNCs), each UCB unit was diluted 1:1 with phosphate-buffered solution (PBS) and carefully loaded onto Ficoll–Hypaque solution (1.077 g/ml, Sigma-Aldrich Co, USA) After density gradient centrifugation at 800×g for 16 at room temperature, MNCs were removed from the interphase, washed twice with PBS, and resuspended in Iscove’s modified Dulbecco’s media (IMDM) medium MNCs were resuspended in cryo-medium (IMDM, 10% DMSO) at 107–108 cells/ml was cryopreserved Banking The sample was transferred to a controlled rate freezer (Planer, Kryo 10, series III; Middlesex, UK) that was pre-cooled to 0°C The sample was then cooled at 1°C/min 55 to −12°C, cooled at 20°C/min to −60°C, followed by warming of the sample at 15°C/min to −18°C, cooled at 1°C/min to −60°C and finally, 3°C/min to −100°C After completion of the freezing protocol, the units were removed from the controlled rate freezer and stored in the vapor phase of nitrogen Isolation and culture of banked UCB After year cryopreservation, the mononuclear cells were thawed by putting the cryotube into water bath 37°C Prior to further processing, samples were drawn from every unit for viability assessment After that, cell suspension was transferred to T25 culture flask with ml IMDM 20% FBS, 10 ng/ml FGF, 20 ng/ml EGF, 1% antibioticmycotic (all bought from Sigma-Aldrich, St Louis, MO) Cultures were maintained at 37°C in a humidified atmosphere containing 5% CO2 and the medium was changed d later When fibroblast-like cells at the base of the flask reached confluence, they were harvested with 0.25% trypsin EDTA (Sigma-Aldrich, St Louis, MO) and subcultured at 1:3 dilution as passage one In vitro differentiation Osteogenic differentiation For differentiation into osteogenic cells, the UCB-MSCs at fifth passage were plated at 1×104 cells/well in 24-well plates At 70% confluence, the cells were cultured for 14–21 d in IMDM supplemented with 10% FBS, 10 −7 mol/L dexamethasone (Sigma-Aldrich), 50 μmol/L ascorbic acid-2 phosphate (Sigma-Aldrich) and 10 mmol/L βglycerol phosphate (Sigma-Aldrich; Lee et al 2004) Osteogenic differentiation was confirmed by RT-PCR for osteocalcin and osteopontin gene expression Adipogenic differentiation For differentiation into adipogenic cells, the cells at fifth passage were plated at 1×104 cells/well in 24-well plates At 70% confluence, the cells were cultured for 14–21 d in IMDM supplemented with 0.5 mmol/L 3-isobutyl1-methylxanthine (Sigma-Aldrich), μmol/L dexamethasone, 0.1 mmol/L indomethacin (Sigma-Aldrich) and 10% FBS (Lee et al 2004) Adipogenic differentiation was evaluated by observing the cells containing lipid oil under microscope Pancreatic endocrine differentiation For pancreatic endocrine differentiation, expanded MSCs from fifth passage were allowed to reach 80–90% confluence and induced to differentiate into insulin secreting cells by an enhanced three-step protocol (Gao et al 2008) In step 1, the cell monolayer was treated for 24 h with high glucose DMEM (H-DMEM, 25 mmol/L glucose) supplemented with 10% FBS and 10−6 mol/L retinoic acid (Sigma-Aldrich), then the medium was changed to H-DMEM with only 10% FBS for d In step 2, the medium was changed to L-DMEM, supplemented with 10% FBS, 10 mmol/L nicotinamide (Sigma-Aldrich) and 20 ng/ml epidermal growth factor 56 PHUC ET AL (EGF, Sigma-Aldrich) for d In step 3, to mature the insulin-secreting cells, the low glucose medium was supplemented with 10% FBS and 10 nmol/L exendin-4 (Sigma-Aldrich) for d Cellular differentiation was monitored by observation of three-dimensional formation of islet like cell clusters, the expression of genes related to pancreatic endocrine cell development and insulin production As a control group, cells were cultured in L-DMEM containing only 10% FBS Reverse transcription real-time polymerase chain reaction RNA isolation Cell suspensions were centrifuged at 3,000 rpm, 22°C for Supernatant was poured away and discarded Of the of TRI Reagent (Sigma), ml was added into each 1.5 ml tube and mixed by trituration Then, tubes were centrifuged at 3,000 rpm, 22°C for The supernatant was collected from each tube and transferred into another new tube In each new tube, 200 μl of chloroform was added into each tube with the concentration of 0.2 ml/ml of TRI reagent The tubes were incubated at 4°C for before being centrifuged at 12,000 rpm, 4°C for 15 of The upper aqueous phase, 150 μl was collected and transferred into a new tube Isopropyl alcohol (500 μl) was added into each tube and incubated at room temperature for 10 for precipitation of RNA After the incubation period, tubes were centrifuged at 12,000 rpm, 4°C for 10 Supernatant was poured away and discarded into waste beaker To each tube, 1,000 μl of 75% ethanol was added, of which the gel-like RNA pellet was resuspended in Tubes were centrifuged again at 12,000 rpm, 4°C for and the supernatant obtained was removed and discarded RNA sample was left to air dry briefly for After drying, 20 μl of nuclease-free water was added to dissolve the RNA pellet RT-PCR RT-PCR reaction carried out by real-time PCR one step-one tube using SYBR (QR0100, SYBR Green Quantitative RT-PCR Kit, Sigma) The primer sequences were as follows: GAPDH (573 bp), and forward: 5′AT C A C C AT C T T C C A G G A G C G - ′ , r e v e r s e : ′ GTTCTTCCACCACTTCGTCC-3′; insulin (263 bp): forward GCAGCCTTTGTGAACCAACA, reverse GTTGCAG TAGTTCTCCAGGTG; Ngn3 (313 bp): forward GGTA G A A A G G AT G A C G C C T C ; r e v e r s e C C G A G T T GAGGTCGTGCAT; Pax4 (496 bp): forward AGGAGGAC CAGGGACTACCGT; reverse, TTTAGGTGGGGTGT CACTCAG; Glut-2 (298 bp) forward GTACAATGACA GAAGATAAG; reverse TGCTACTAACATGGCTTTGA; Pdx-1 (220 bp) forward GGATGAAGTCTACCAAAGCT CACGC; reverse, CCAGATCTTGATGTGTCTCTCGGTC; Pax6 (81 bp): forward TGCGACATTTCCCGAATTCT; reverse GATGGAGCCAGTCTCGTAATACCT; Isl-1 (493 bp): forward AGCATCAATGTCCTCTCAACTTCC; reverse TGTTTGGCAAGGCAATGACC; Nkx6.1 (84 bp): forward TCTTCTGGCCCGGAGTGA; reverse CCAA CAAAATGGATCCTTGATGA; Nkx2.2 (154 bp) forward T C TA C G A C A G C A G C G A C A A C ; r e v e r s e TTGTCATTGTCCGGTGACTC; NeuroD1 (450 bp) forward TCG TTC AGA CGC TTT GCA AG; reverse AGA TTG ATC CGT GGC TTT GG; osteocalcin (266 bp): forward AGG GCA GCG AGGTAG TGA AGA; reverse AAG GGCAAG GGG AAG AGG AAA GAA; osteopontin (330 bp): forward CTAGGCATCACCTGTGCCATACC; reverse CTACTTAGACTACTTGACCAGTGAC nestin (495 bp): forward AGAGGGGAATTCCTGGAG; reverse CTGAGGACCAGGACTCTCTA CORNING® 8-strip PCR tubes were labeled with the respective genes of interest In each tube, the following was added: to a total volume of 25:12.9 μl of PCR Master Mix, 9.6 μl of nuclease-free water, 0.5 μl of forward primer (gene of interest), 0.5 μl of reverse primer (gene of interest), 1.5 μl of RNA template After complete addition of all the components, tubes were centrifuged at 3,000 rpm, 4°C for Tubes were then loaded into the Eppendorf realplex4 Mastercycler epgradient S real-time PCR machine according to the template created using the realplex® program PCR was carried out for 35 cycles, which consisted of pre-soak for at 94°C, denaturing for 30 s at 94°C, annealing for 30 s at 55–60°C, and extension for at 72°C, with additional 7-min incubation at 72°C after completion of the cycle Immunohistochemistry and flow cytometry Immunohistochemistry Induced cells were fixed in 4% paraformaldehyde and washed three times by PBS, then incubated with PBS containing 0.3% Triton X-100 (Sigma) and 10% normal serum for 40 at room temperature Especially for nuclear antigens, the concentration of TritonX-100 was adapted to 0.5% and incubation time to h The cells were then incubated with the primary antibody: mouse anti-human Cpeptide antibody (Abcam) and further incubated with the respective secondary antibody: fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (Abcam) In all immunochemistry assays, negative staining controls were carried out by omitting the primary antibody Nuclei were detected by Hoescht 33342 (Sigma) staining Images were captured using Carl Zeiss microscope Cell Observer with monochromatic cool camera (Carl Zeiss) Flow cytometry Antibodies against human antigens CD13, CD14, CD34, CD45, CD166, and HLA-DR were purchased from BD Sciences (San Jose, CA) A total of × 105 cells were resuspended in 200 μl PBS and incubated with FITC- or phycoerythrin (PE)-conjugated antibodies for 20 at room temperature The fluorescence intensity of the cells was evaluated by flow cytometry using a DIFFERENTIATING OF BANKED HUMAN UMBILICAL CORD BLOOD 57 flow cytometer (FACScan; BD Sciences) and the data were analyzed with the CELLQUEST Pro software (BD Sciences) Diabetic mice model and transplantation Prior to transplantation, streptozotocin (STZ, Sigma) was injected i.p at 40 mg/kg/d into 4–6-wk-old mice for d to induce experimental diabetes Blood glucose was measured by Glucometter from snipped tail Only mice with blood glucose levels stably above 200 mg/dL after the STZ injections were used in these transplantation experiments For transplantation, about 1×106 differentiated cells in the final induction stage were injected into the pancreas region near to spleen Results Isolation and characterization of human UCB-MSCs The duration of storage in frozen state for UCB was yr, and there were no differences in viability depending on the storage duration When thawed, UCB-derived cells were recovered with more than 90% viability Frozen UCBderived mononuclear cells were plated at a density of 3×105 cells/cm2 and formed adherent heterogeneous cell populations after 4–7 d in culture, which consisted of round and spindleshaped cells In the initial passage of culture, the cells proliferated slowly and gave rise to confluence in 14–21 d When subcultured, the heterogeneous cell populations changed into a homogeneous one with flat and fibroblast-like shape Figure shows that the UCB-derived cells closely resembled BM-MSCs in morphology Immunophenotypic characterization of UCB-derived MSCs Fibroblast-like, rapidly dividing cells (Fig 1) arising from limiting dilution were extensively expanded, and characterization by flow cytometry revealed that the cells isolated by the described method were negative for CD14 (monocyte), CD34 (heamatopoietic stem cell), CD45 (leukocyte common antigen), indicating these cells are not of hematopoietic origin Cells were also negative for HLA-DR UCB-derived cells were found to be positive for matrix receptors CD166 (Fig 2) In vitro differentiation of osteocytes and adipocytes from banked UCB-derived MSCs To investigate the osteogenic potential of the banked UCB-derived cells, fifth- to seventh-passage cells were plated at a density of 3×103 cells/cm2 and cultured under conditions appropriate for inducing differentiation for each lineage When induced to differentiate under serum-free osteogenic conditions, the spindle shape of UCB-derived cells flattened and broadened with increasing time of induction (Fig 3B) The osteoblastic phenotype was also shown by the expression of marker Figure Phase contrast images of MSCs from human banked UCB UCB-derived cells at 12–14 d (A) 24–27 d (B) Cells were isolated by direct adherence in our culture medium and pictured after two passages All experiments were performed in triplicate genes osteopontin (hOSP) and osteocalcin (hOC) expression (Fig 3D) After 21 d of induction, cells were positive for real-time PCR for osteopontin, osteocalcin (Fig 3D) UCBderived cells also can be differentiated into adipocytes with lipid vacuoles in cytoplasm (Fig 3B) compare to undifferentiated cells (Fig 3A) In vitro differentiation of UCB-MSC to insulin-secreting cells Morphological changes of MSC differentiation Under inversed microscope, undifferentiated MSCs were typical of adherent spindle and fibrocyte like However, underdifferentiation, these spindle-like cells changed rapidly into round or oval types with confluence These cells were abundant in endocrinal granules, similar to those differentiated islet cells from ES cells These grape-like cells lasted for at least wk Some cells changed into neuron-like cells with typical processes Some methods differentiated MSC from fresh UCB successfully Therefore, we tried the similar method to 58 PHUC ET AL Figure Immunophenotyping of MSCs from human cryopreserved UCB Cells were labeled with FITC- or PE-conjugated antibodies and examined by flow cytometry Histograms demonstrating the expression of surface molecules were plotted against control (anti-IgG) The immunophenotypical profile of the UCB-MSCs were positive for MSC-specific markers such as CD166 (ALCAM), CD13 while negative for CD14 (monocyte antigen), CD34 (HSCs antigen), and CD45 (leukocyte common antigen) and HLA-DR All experiments were performed in triplicate induce the banked UCB stem cells into b-like cells without nestin-positive cells selection After 5–7 d, treated by a differentiation medium, some cells gathered together and formed the pancreatic island-like structure (Fig 4A, B) Immunostaining was applied for detecting the expression of insulin (Fig 4E; green color) These islet-like structures were positive for insulin staining UCB-MSCs were induced to transform into insulin secreting cells by a three-step protocol At step 1, changes in cell morphology could not be observed During further culturing, the rate of cell proliferation decreased and these spindle-like cells became short and conversed to round epithelial like cells by the end of step 2—around d after differentiation Meanwhile, some new islet-like clusters started to appear, ranging from 200 to 350 μm in diameter At step 3, more islet like clusters were formed (Fig 5) assessed by real-time RT-PCR After differentiation, all of clusters expressed some genes such as: Nestin, Pdx-1, Ngn3, Isl-1, Pax6, Pax4, Nkx2.2., Nkx6.1, Glut-2, and Insulin Gene expression analysis To determine whether UCBMSCs had differentiated into insulin-secreting cells, clusters of cells were identified for gene expression profiles for pancreatic β-cell differentiation markers were Insulin-producing cell transplantation The diabetes treatment potential of insulin-producing cells (IPCs) was tested in vivo in STZ induced diabetes mouse model The blood sugar level of the mice was over 200 mg/dL and did not decreased in 20 d after the last STZ injection These mice were used for the next experiment Three diabetes mice were grafted with 5×106 IPCs in 0.01 ml PBS The blood sugar level of IPCs grafted mice decreased after d (third d=287.3±31 mg/dl compared to 0th d=306±0 mg/dl); whereas the blood sugar level of PBS-injected diabetes mice continued to increase (third d= 390.7±39.4 mg/dl compared to 0th d=306±0 mg/dL) In the 30 d after graft, although the IPCs grafted mice’s blood sugar level did not decrease to the normal blood sugar level (