Experimental Gerontology 64 (2015) 1–7 Contents lists available at ScienceDirect Experimental Gerontology journal homepage: www.elsevier.com/locate/expgero Anti-inflammatory effect of resveratrol in old mice liver Bui Thanh Tung a,b,1, Elisabeth Rodríguez-Bies a, Elena Talero b, Enrique Gamero-Estévez a, Virginia Motilva b, Plácido Navas a, Guillermo López-Lluch a,⁎ a b Centro Andaluz de Biología del Desarrollo (CABD), Universidad Pablo de Olavide CSIC, CIBERER-Instituto de Salud San Carlos III, Carretera de Utrera Km 1, 41013 Sevilla, Spain Departmento de Farmacología, Facultad de Farmacia, Universidad de Sevilla, 41012 Sevilla, Spain a r t i c l e i n f o Article history: Received 18 January 2015 Accepted February 2015 Available online 14 February 2015 Section Editor: B Grubeck-Loebenstein Keywords: Aging Resveratrol Inflammation Cytokines Liver a b s t r a c t Inflammation is a hallmark of aging Caloric restriction and resveratrol (RSV) have shown important effects on prevention of oxidative stress and inflammation Here, we investigate the progression of proinflammatory markers in liver during aging and the effect of RSV on inflammation markers in the liver of old male C57BL/6J mice Young (2 months), mature (12 months) and old (18 months) mice were fed during months with RSV Levels of IL-1β, IL-6, IL-10, IL-17 and TNF-α were evaluated by ELISA in mice liver Levels of pro-inflammatory cytokines, IL-1β, IL-6, IL-17 and TNF-α and also their respective mRNA increased in the liver from old mice However, RSV decreased these levels in the case of IL-1β and TNF-α but only in old mice showing no effect on young and mature animals This reduction was also found at the mRNA level Levels of mRNA of the components of NALP-3 inflammasome, ASC, CASP-1, NALP-1 and NALP-3, also showed an age-dependent increase that was reversed by RSV Furthermore, cyclooxygenase levels, a marker of proinflammatory innate immune activity, were also upregulated in aged liver and reversed again by RSV In conclusion, our study confirms that aging is accompanied by an increase in the proinflammatory pattern in the liver and that RSV reduces this pattern in old mice liver © 2015 Elsevier Inc All rights reserved Introduction According to the free radical theory of aging, free radicals are responsible for the declining function and efficiency of biological systems in aging (Harman, 1956) One of the main sources of systemic oxidative stress is inflammatory reactions (Chung et al., 2011) and strong evidences support that chronic low-grade systemic inflammation is a common manifestation of aging (Brüünsgaard and Pedersen, 2003) Higher levels of circulating pro-inflammatory cytokines such as IL-6 and TNF-α, and acute phase proteins such as C-reactive protein and serum amyloid A, are typical of aged people even in the absence of chronic disease (Brüünsgaard and Pedersen, 2003) In this systemic inflammatory status, the liver has being indicated as playing a central role This is because, the liver not only contains the greatest concentration of the body's resident tissue macrophages, the Kupffer cells, but hepatocytes can also be a main source of a variety of proinflammatory cytokines (Glasgow et al., 2007) The key players in the inflammatory reaction are nuclear factor-κB (NF-κB), interleukin-1β (IL-1β), IL-6, IL-17 and IL-18, tumor necrosis factor-α (TNF-α), cyclooxygenase (COX-2) and inducible nitric ⁎ Corresponding author at: Centro Andaluz de Biología del Desarrollo, Universidad Pablo de Olavide, Carretera de Utrera Km 1, 41013 Sevilla, Spain E-mail address: glopllu@upo.es (G López-Lluch) Currently at the: School of Medicine and Pharmacy, Vietnam National University, Hanoi, 144 Xuan Thuy, Cau Giay, Hanoi, Viet Nam http://dx.doi.org/10.1016/j.exger.2015.02.004 0531-5565/© 2015 Elsevier Inc All rights reserved oxide synthase (iNOS) It has been demonstrated that expression of these pro-inflammatory factors is enhanced by redox-sensitive transcription factor NF-κB (Chung et al., 2006) indicating an important role of oxidative stress in chronic inflammation during aging (Jung et al., 2009) Among these factors, IL-6 is a cytokine with pleiotropic effects and its increase is associated with chronic inflammations, autoimmune diseases, and hematopoietic disorders (Wunderlich et al., 2010) TNF-α is also a pro-inflammatory multifunctional cytokine that also contributes to the production of IL-6 (Williams et al., 2008) and IL-1 (IL-1α and IL-1β) plays a critical role in acute and chronic inflammation (Di Iorio et al., 2003) A cytoplasmic multiprotein complex known as inflammasome participates in the production of proinflammatory cytokines (Agostini et al., 2004) The NALP-3 inflammasome is composed of the NALP-3 (NACHT, leucine-rich-repeat (LRR), and pyrin domain-containing protein 3), apoptosis-associated speck-like protein (ASC) and caspase-1 (CASP-1) (Martinon et al., 2006; Schroder et al., 2010) CASP-1 is responsible for the conversion of pro-IL-1β, pro-IL-18 and pro-IL-33 to their mature forms (Ye and Ting, 2008) In the liver, inflammasomes are expressed in both parenchymal and non-parenchymal cells and are involved in various forms of liver diseases (Szabo and Csak, 2012) Resveratrol (RSV) (3,5,4′-trihydoxy-trans-stilbene) is a polyphenol found in a large number of plant species such as mulberries, peanuts, and grapes, and is present in red wine (Rivera et al., 2009) This polyphenol has been reported to exert multiple biological activities against inflammation, oxidative stress, tumor initiation and progression, B.T Tung et al / Experimental Gerontology 64 (2015) 1–7 platelet aggregation, atherosclerosis and aging (Baur et al., 2006; Saiko et al., 2008; Szkudelska and Szkudelski, 2010) This polyphenol modulates the expression of many genes and modifies the activity of many molecules, including NF-κB (Shakibaei et al., 2009) It has been suggested that RSV produces these beneficial effects by reducing expression of several cytokines including IL-6 (Zhong et al., 1999), IL-12, IL2, and IFN-γ (Gao et al., 2001) or TNF-α (Feng et al., 2004) However, due to the many targets associated to the activity of RSV, the mechanisms involved in the anti-inflammatory activity of this polyphenol are not yet completely understood Although the anti-inflammatory activity of RSV has been well documented in many studies, its effect on the liver of aging has not been established This organ is considered one of the main sources of proinflammatory cytokines in chronic systemic inflammation associated with aging and related to chronic age-related diseases (Aravinthan et al., 2014; Glasgow et al., 2007) In the present work, we study the effect of RSV in systemic inflammation as a function of age in mouse liver and assess whether RSV modulates these effects The levels of different proinflammatory cytokines, IL-1β, IL-6, IL-17 and TNF-α, and their mRNA expression were evaluated in this study The level of expression of COX-2 was also determined Furthermore, we also study the regulation of liver NALP-3 inflammasome components to assess the change produced by aging and the effect of RSV in the old group mice Material and methods 2.1 Animals and feeding regimens Male Swiss C57BL/6J mice were used for these experiments They were divided in three age groups, months (young group), 12 months (mature group) and 18 months (old group) A total of 10 mice per age group were used Animals were housed into enriched environmental conditions in groups of animals per polycarbonate cage in a colony room under a 12 h light/dark cycle (12:00 AM–12:00 PM) with temperature (22 ± °C) and humidity controlled All animals were maintained according to a protocol approved by the Ethical Committee of the University Pablo de Olavide and following the international rules for animal research Just before starting, animals were randomly divided in two groups: Control and RSV The control group was provided with water containing 0.18% ethanol used as vehicle for RSV (180 μl ethanol/100 ml H2O) whereas to the group treated with RSV, water containing RSV (180 μl of g/10 ml trans-RSV in ethanol/100 ml H2O) (Cayman Chemicals, USA) was provided in opaque bottles to avoid light-dependent decomposition of RSV As animals drank around 4–5 ml/day and weight around 30 g, the calculated dose of RSV was around 20 μg/animal/day (24 mg/kg/day) 2.2 Measurement of cytokines Frozen livers were homogenized in volumes of ice-cold tissue lysis buffer containing 150 mM sodium chloride, 1% NP-40, 50 mM Tris, pH 8.0 and mM PMSF with protease inhibitors (Sigma, Spain) Homogenates were centrifuged at 1000 ×g for 10 at °C to remove debris Single-use aliquots of the homogenates were stored at − 80 °C until measurements The levels IL-1β, IL-6, IL-10, IL-17 and TNF-α were determined with commercially available Enzyme-Linked ImmunoSorbent Assay (ELISA) (Thermo Fisher Scientific, USA) kits according to the manufacturers' instructions Data are reported as pg cytokine per mg of liver homogenate Briefly, 96-well plates where coated overnight at °C with 100 μl of monoclonal antibody against IL-1β (2.0 μg/ml), IL-6 (2.01 μg/ml), IL10 (2.0 μg/ml) IL-17 (1.0 μg/ml) or TNF-α (1.0 μg/ml) in PBS 1× buffer (pH 7.2) Plate was then washed four times with wash buffer (PBS + 0.05% Tween-20), blotted dry, and then incubated with blocking solution (PBS + 1% bovine serum albumin) for h After washing, 100 μl of each homogenate sample or standard was added Then the plate was incubated at room temperature for h, followed by washing, and addition of 100 μl of detection antibody IL-1β (0.5 μg/ml) or IL-6 (0.5 μg/ml) or IL-10 (0.5 μg/ml), IL-17 (0.25 μg/ml) or TNF-α (0.25 μg/ml) The antibody was incubated at room temperature for h Following additional washing, 100 μl of avidin-HRP conjugated (1:2000) was added to each well, followed by a 30 incubation After thorough washing, plate development was performed using liquid substrate, 2,2′-azinobis[3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt, solution and the color monitored using a microplate reader at 405 nm with wavelength correction set at 650 nm A standard curve for the ELISA was established by using murine standard IL-1β or IL-6 or IL-10 or IL-17 or TNF-α diluted in PBS 1× buffer All standard curves obtained an R2 value between 0.98 and Results were normalized to total protein content in the liver samples, determined by Bradford's (1976) method Data are reported as pmol cytokine/mg protein 2.3 Western blot analysis Equal amounts of protein homogenates were separated on a PAGESDS gel and transferred onto a nitrocellulose membrane Ponceau S staining of total protein loading was recorded for monitored transfer efficiency and quantification Then, the membrane was blocked with 5% skim milk dissolved in 0.5 mM Tris–HCl (pH 7.5), 150 mM NaCl, and 0.1% Tween-20 for h at room temperature The membranes were subsequently incubated with the primary antibody anti-CASP-1 (Thermo Fisher Scientific, USA) After three washes with Tris-buffered saline with 0.1% Tween-20 (TBST), blots were incubated with secondary horseradish peroxidase conjugated anti-(Fab)2-mouse antibody in TBST with 5% skim milk at a 1:1000 dilution for h at room temperature Blots were then washed three times in TBST and developed using an enhanced chemiluminescence detection substrate Immobilon Western Chemiluminescent HRP Substrate (Merck Millipore, Spain) Protein expression levels were corrected for whole protein loading determined by staining membrane with Red Ponceau Protein expressions were visualized by the ChemiDoc™ XRS + System and compiled with Image Lab™ 4.0.1 Software (Bio-Rad Laboratories, USA) 2.4 Real-time PCR analysis Total RNA was isolated using TRIzol reagent (Invitrogen, Life Technologies, Spain) according to the manufacturer's instructions and treated with RNase-free DNase (Deoxyribonuclease Amplification Grade, Sigma-Aldrich, Spain) to remove genomic DNA Briefly, about 50 mg tissue were homogenized in ml TRIzol and then extracted with chloroform by vortexing A small volume (1.2 ml) of aqueous phase after chloroform extraction of the TRIzol homogenate was adjusted to 35% ethanol and loaded onto an RNeasy column (Qiagen, USA) The column was washed and RNA was eluted RNA quantity and purity were determined using the UV Spectrophotometer NanoDrop® ND1000 (Thermo Scientific, USA) and the ratio between the absorbance values at 260 and 280 nm gives an estimate of RNA purity For the synthesis of cDNA, DNase-treated total RNA (0.5 μg) was reverse transcribed using iScript™ cDNA Synthesis (Bio-Rad, USA) kit The reaction was realized in the iCycler Thermal Cycler (Bio-Rad), following the protocol: at 25 °C, 45 at 42 °C, at 85 °C and at °C Real-time PCR primers were generated using Beacon Designer software (BioRad, USA), purchased to Eurofins MWG Synthesis GmbH, Germany and listed as in Table Quantitative RT-PCR was conducted in a CFX Connect™ Real-Time PCR Detection System using μl of cDNA mix, 500 nM of sense and antisense primers for specific mRNAs (Table 1) and μl of iTaq Universal SYBRđ Green Supermix (2ì) (BioRad) in 10 μl final volume PCR program began with 10 of incubation at 95 °C The reactions consisted of 45 cycles, using a denaturation temperature of 95 °C for 15 s and annealing and extension at 60 °C for 30 s and 72 °C for 30 s to determine B.T Tung et al / Experimental Gerontology 64 (2015) 1–7 3.2 RSV modulates cytokine levels in mouse liver Table qRT-PCR primer sequences used with SYBR Green Supermix Primers Forward sequence (5′–3′) Reverse sequence (3′–5′) IL-1β IL-6 IL-18 TNF-α NALP-1 NALP-3 CASP-1 ASC β-Actin AGTTGACGGACCCCAAAAG TGATGGATGCTACCAAACTGG GACAACACGCTTTACTTTATACCTGA CTGTAGCCCACGTCGTAGC CGCACCACAGCTCTACAGAA TGAAACAAAACGTGCCTTAGAA TGGTCTTGTGACTTGGAGGAC TCCAGGCCTTGAAGGAAATA TGACCGAGCGTGGCTACAG TTTGAAGCTGGATGCTCTCAT TTCATGTACTCCAGGTAGCTATGG GTGAAGTCGGCCAAAGTTGT TTTGAGATCCATGCCGTTG AATCCTAGGACTTCCACTTGACA GCCTACCAGGAAATCTCGAA AGAAACGTTTTGTCAGGGTCA TGTAGCTGGAAAAGATTCCTCAG GGGCAACATAGCACAGCTTCT the threshold cycle (Ct) value A melt curve was performed for all reactions to check for product integrity and primer–dimer formation Standard curves were generated for each gene of interest using dilutions of purified PCR products at known concentrations PCR primers showed efficiencies higher than the 95% Quantitative PCR using primers for βactin mRNA was conducted in each plate to provide a normalization reference The Ct for all genes was normalized to the Ct of β-actin Quantification of relative gene expression was calculated by the comparative Ct method (2−ΔΔCt), and the data are presented as fold change over the control All real-time RT-PCR were conducted at least three times from independent RNA preparations Double distilled H2O served as negative control 2.5 Statistical analysis All results are expressed as mean ± SE, n = 4, each group Serial measurements were analyzed by using Student's paired t-test and two-way ANOVA with Bonferroni's post hoc test using SigmaStat 3.5 program and figures were performed by using SigmaPlot 10.0 program (Systat Software Inc., USA) The critical significance level α was 0.05 and, then, statistical significance was defined as P b 0.05 Results 3.1 Proinflammatory cytokines increased in old liver To determine if inflammation increases during aging in mouse liver we studied the levels of proinflammatory cytokines in whole liver homogenates (Table 2) ELISA determination of cytokine levels in the whole homogenate demonstrated that the levels of IL-1β, IL-6 and TNF-α were significantly higher in livers from old mice In these mice, the levels of IL-1β, TNF-α and IL-6 nearly doubled than those found in young animals whereas mature mice showed intermediate levels IL-17 levels also showed a trend to increase as the age of the animals rise (Table 2) Surprisingly, the levels of the anti-inflammatory cytokine IL-10 also increased nearly twice in old animals The increase of proinflammatory cytokines was also accompanied by a rise in the levels of mRNA of IL-6, IL-1β and TNF-α in mouse liver This increase was significant in the case of TNF-α and IL-1β and nearly significant in the case of IL-6 (Fig 1) In order to determine if RSV modulates the proinflammatory frame found in old mice liver, we determined the levels of these cytokines in mice treated with RSV for six months (Fig 2) In general, we found a small decrease of around a 20% in the level of proinflammatory cytokines induced by RSV However, only in the case of IL-1β we found a significant decrease of cytokine levels The IL-1β levels reached in RSVtreated animals were similar to those found in young animals In the case of IL-17 and TNF-α, a trend to decrease was found whereas in the case of IL-6 no changes were found (Fig 2) A similar response was found with IL-10, with a trend to decrease due to RSV affecting mature and old animals (Fig 2) Interestingly, the levels of mRNA did not follow a similar pattern since we found a clear decrease induced by RSV in both IL-1β and TNF-α mRNA levels in liver in old animals (Fig 3) This could indicate different levels of regulation, one at the transcription level and the other affecting the process of cytokines 3.3 Inflammasome is also affected by age and modulated by RSV Proinflammatory cytokines such as IL-1β and IL-18 are processed by the inflammasome Then, we also determine the levels of mRNA of the components of inflammasome during aging Inflammasome components ASC, CASP-1, NALP-1 and NALP-3 mRNA level increased in the old group but not in mature animals (Fig 4A) On the other hand, in old animals RSV reduced significantly the mRNA levels of these components to around a 30% of the levels found in control old liver (Fig 4B) showing a similar pattern in all of them 3.4 Levels of COX-2 increased with age in mice liver and are downregulated by RSV Another marker of inflammation in tissues and organs is COX-2, an enzyme involved in the production of prostaglandins from arachidonic acid Levels of COX-2 increased along aging in mice liver reaching approximately a 60% more protein than in young mice liver (Fig 5A-B) RSV decreased COX-2 levels in old mice around a 40%, then, returned these levels to those found in both young and mature animals However, in the case of COX-2, RSV also reduced the protein levels in the other groups being the higher decrease in young animals (Fig 5C–D) Discussion Aging is associated with a variety of functional alterations affecting many organs and systems In the liver, the mechanisms of the agedependent degeneration are not completely defined yet (Schmucker, 1998) Inflammatory activity has been frequently proposed as a main contributor to biological aging and particularly in age-related changes in the liver (Gee et al., 2005) Thus, higher plasma levels of proinflammatory cytokines such as TNF-α and IL-6 are associated with aging (Bruunsgaard et al., 2000; Dobbs et al., 1999) Our data have also shown higher level of pro-inflammatory IL-1β, IL-6, IL-17 and TNF-α in old liver in comparison with organs from young and mature mice This indicates that the levels of pro-inflammatory cytokines in the liver increase during aging, confirming an important role on general Table Levels of cytokines in mice liver during aging Young Mature Old TNF-α IL-17 IL-10 IL-1β IL-6 13.74 ± 2.71 14.26 ± 0.92 25.02 ± 2.94⁎,# 7.05 ± 0.11 9.06 ± 0.45 9.99 ± 1.38 14.37 ± 0.94 25.98 ± 1.32 31.72 ± 4.77⁎ 101.29 ± 16.58 80.90 ± 14.41 249.47 ± 38.98⁎,# 14.75 ± 2.28 19.06 ± 2.21 32.54 ± 1.82⁎,# Data are indicated as pg/mg protein Data represent the mean ± SEM (n = 5) ⁎ Significant differences vs young group, p b 0.05 # Significant differences vs mature group, p b 0.05 4 B.T Tung et al / Experimental Gerontology 64 (2015) 1–7 B 2.5 2.0 IL-1β mRNA levels (related to young group) IL-6 mRNA levels (related to young group) A 1.5 1.0 0.5 0.0 YOUNG C MATURE OLD YOUNG D 1.4 1.2 TNF-α mRNA levels (related to young group) IL-18 mRNA levels (related to young group) * 1.0 0.8 0.6 0.4 MATURE OLD *,# 0.2 0.0 YOUNG MATURE YOUNG OLD MATURE OLD Fig Levels of mRNA of IL-6, IL-1β, IL-18 and TNF-α in mice liver in young, mature and old animals Levels of mRNA of IL-6 (A), IL-1β (B), IL-18 (C) and TNF-α (D) quantified by RT-PCR Levels of mRNA are expressed as the fold increase vs levels of young livers *Significant differences vs young group; #Significant differences vs mature group, p b 0.05 A 300 B * * 25 200 # 150 100 TNF- α levels (pmol/mg protein) 250 IL-1β levels (pmol/mg protein) 30 20 15 10 50 0 CTRL RSV CTRL RSV CTRL RSV CTRL RSV C CTRL RSV D 40 40 * * * 30 IL-10 levels (pmol/mg protein) 30 IL-6 levels (pmol/mg protein) CTRL RSV 20 20 10 10 0 CTRL RSV CTRL RSV CTRL RSV CTRL RSV CTRL RSV CTRL RSV Fig Levels of IL-1β (A), TNF-α (B), IL-6 (C), IL-10 (D) in young, mature and old animals fed with RSV Cytokine levels were determined in whole liver homogenate by ELISA Control group (empty bar), RSV fed group (gray bar) *Significant differences vs young control group, p b 0.05 #Significant differences vs respective age-matched control group B.T Tung et al / Experimental Gerontology 64 (2015) 1–7 B A 1.2 1.4 1.0 1.2 IL-1β mRNA levels (related to control) TNF-α mRNA levels (related to control) 0.8 0.6 * 0.4 0.2 1.0 0.8 * 0.6 0.4 0.2 0.0 0.0 CTRL CTRL RSV RSV Fig Effect of RSV on TNF-α and IL-1β mRNA levels in old mice liver Levels of mRNA are expressed as the fold increase vs levels of control non-trained animals Control group (empty bar), RSV group (gray bar) *Significant differences vs control group, #Significant differences vs resveratrol group, p b 0.05 chronic inflammation However, these higher levels of cytokines can be related to protective mechanisms during aging since TNF-α has been associated not only with hepatotoxicity but also to the restoration of functional liver mass by driving hepatocyte proliferation and liver regeneration (Schwabe and Brenner, 2006) Interestingly, we have also found that cytokine IL-10 also increased in the old group mice compared with the other groups IL-10 is well known for its immunosuppressive activity reducing the extent of hepatic damage caused by aging (de Vries, 1995) That could indicate that higher levels of some cytokines can be protective mechanism to compensate the effect of higher levels of the inflammatory cytokines Our study indicates that RSV reduces the proinflammatory profile found in aged liver The anti-inflammatory properties of RSV have been also demonstrated in some studies although the information is very scarce Fulgenzi et al (2001) showed that RSV reduced TNF-αmediated vascular leakage in a mouse liver perfusion model (1 μM) Our data also agree with a recent study showing that RSV induces a reduction of IL-17 production in a concentration-dependent manner in an in vitro model of inflammation (Lanzilli et al., 2012) RSV has been also shown to inhibit inflammatory responses through the inhibition of synthesis of various pro-inflammatory mediators, modulation of prostaglandin synthesis, and through the inhibition of factors such as NF-κB, COX-2 and iNOS (Shakibaei et al., 2009) The anti-inflammatory activity of RSV may be also explained by the inhibition of COX-2 as well by its antioxidant effects (Martinez and Moreno, 2000; Subbaramaiah et al., 1998) In agreement with these studies, we have also found a decrease *,# B *,# *,# *,# CASP-1 ASC NALP-1 NALP-3 Inflammasome components mRNA levels (fold changes vs control non-trained) Inflammasome components mRNA levels (fold changes vs young group) A in the protein levels of COX-2 in mouse liver RSV is also able to inhibit NF-κB, and AP-1 activation supplying an additional mechanism for inactivation of COX-2 since it is stimulated by both transcription factors (Subbaramaiah and Dannenberg, 2003) One of the main mediators of proinflammatory profile is the activation of the inflammasome The inflammasome is a cytosolic multiprotein complex implicated in recognizing certain no microbiological danger signals that, upon assembly with caspase 1, has the enzymatic ability to cleave pro-IL-1 and pro IL-18 into active cytokines (Vandanmagsar et al., 2011) Inflammasome can be activated in the liver in both liver-resident cells (Kupffer cells, hepatic stellate cells, sinusoidal endothelial cells), and immune cells (monocytes, macrophages, dendritic cells, natural killer cells) contributing to the apoptotic or necrotic demise of hepatocytes (Brenner et al., 2013) Several inflammasome complexes exist and among them, the NALP-3 inflammasome has been shown recently to be directly activated by the presence of sustained amounts of ROS (Zhou et al., 2010) Furthermore, the oxidative damage produced by free radicals also promotes the activation of NALP-3 inflammasome (Martinon, 2010) Moreover, the increase in the levels and activity of inflammasome has been associated to higher ROS levels produced in aged animals and the ROSinduced activation of NALP-3 has been clearly attributable to a priming step in NALP-3 activation (Bauernfeind et al., 2009) Interestingly, we have recently demonstrated that old livers show higher oxidative damage and that RSV decreases this damage and regulates the expression and activity of several antioxidant enzymes (Tung et al., 2013) 1.4 1.2 1.0 0.8 * 0.6 0.4 * 0.2 * * 0.0 CTRL RSV CTRL RSV CTRL RSV CTRL RSV Fig Inflammasome components of mRNA levels A) Liver mRNA levels of the components of inflammasome, CASP-1, ASC, NALP-1 and NALP-3 in young (white bars), mature (gray bars) and old (black bars) *Significant differences vs young group, p b 0.05 #Significant differences vs mature group, p b 0.05 B) Effect of exercise and/or RSV on mRNA levels of components of inflammasome Gray bars, RSV treated animals *Significant differences vs control group, p b 0.05 6 B.T Tung et al / Experimental Gerontology 64 (2015) 1–7 A B YOUNG MATURE 180 OLD * 160 75 50 - Ponceau COX-2 protein levels (related to young group) COX-2 140 120 100 80 60 40 20 YOUNG C 140 MATURE OLD D Ctrl Young Mature Old RSV COX-2 protein levels (arbitrary units) 120 100 80 * * 60 * 40 20 CTRL RSV YOUNG CTRL RSV MATURE CTRL RSV OLD Fig Induction of COX-2 levels during aging and its regulation by RSV A) Determination of COX-2 by WB in three representative homogenates of young, mature and old mice liver Ponceau staining to determine loading control B) Relative COX-2 levels in young, mature and old mice *Significant differences vs young group, p b 0.05 C) Determination of the effect of RSV on COX.2 levels by WB in young, mature and old mice liver A representative staining of three samples is indicated D) Quantification of COX-2 levels in old mice liver Levels found in non-treated animals were considered as 100 *Significant differences vs young group, p b 0.05 C) #Significant differences vs control animals, p b 0.05 Probably, the decrease of oxidative damaged molecules and ROS levels would be related to the decrease in inflammasome activity determined by the IL-1β levels found in old liver from animals treated with RSV NALP-3 activation was been also found in many age‐related diseases, e.g atherosclerosis, obesity and type diabetes We have shown that the expression of mRNA of genes that are directly related to the activity of the inflammasome, NALP-3, NALP-1, ASC, CASP-1 and IL-1β increased during aging and were reduced by RSV Probably, the induction of the NF-κB signal during aging by the increase of oxidative stress is a vital inducer of NALP-3 expression and enhances the priming and potentiation of the inflammasome activation (Salminen et al., 2012) The downregulation of the mRNA levels induced by RSV can be the result of lower induction of NF-κB pathway either by decreasing ROS (Tung et al., 2013) or by induction of SIRT-1 (Fu et al., 2013) Interestingly, to our knowledge, the effect of RSV on the inflammasome has been demonstrated only in cultured mesenchymal stem cells or macrophages (Fu et al., 2013; Huang et al., 2013) or in liver cells from mouse fed under high fat diet (Yang and Lim, 2014) In all the cases, RSV inhibits the NLRP-3 activation Then, we consider that our study shows for the first time that RSV demonstrated in-vivo anti-inflammasome activation in the liver of old animals of antioxidant enzymes found after RSV treatment and the reduction of oxidative damage found in old liver would explain a lower amount of ROS and the decrease of the proinflammatory pattern found in the liver Taken into consideration the importance of inflammation in the development of aging and the main role of liver in chronic inflammation, the use of bioactive compounds such as resveratrol in the diet can be strongly encouraged in older people Conclusion References Our findings show that the pro-inflammatory cytokines (TNF-α, IL1β, IL-6, IL-17), increase during aging in mice liver Treatment with RSV reduces this increase at least in the case of IL-1β Furthermore, RSV can decrease the expression of some proinflammatory cytokines The activity of inflammasome is higher in old liver and its activity can be reduced by RSV at the transcriptional and activity level The increase Agostini, L., Martinon, F., Burns, K., McDermott, M.F., Hawkins, P.N., Tschopp, J., 2004 NALP3 forms an IL-1beta-processing inflammasome with increased activity in Muckle–Wells autoinflammatory disorder Immunity 20, 319–325 Aravinthan, A., Shannon, N., Heaney, J., Hoare, M., Marshall, A., Alexander, G.J., 2014 The senescent hepatocyte gene signature in chronic liver disease Exp Gerontol 60C, 37–45 Bauernfeind, F.G., Horvath, G., Stutz, A., Alnemri, E.S., MacDonald, K., Speert, D., Fernandes-Alnemri, T., Wu, J., Monks, B.G., Fitzgerald, K.A., Hornung, V., Latz, E., 2009 Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors Acknowledgments The research group is financed by the Andalusian Government as the BIO177 group through FEDER funds (European Commission) The research has been financed by the Spanish Government grant DEP201239985 (Spanish Ministry of Economy and Competitiveness) Tung Bui Thanh received a fellowship from the AECID program (Spanish Ministry of Foreign Affair) ERB, PN and GLL are also members of the Centro de Investigación Biomédica en Red de Enfermedades Raras (CIBERER), Instituto Carlos III We would also like to thank Almudena Velazquez Dorado and Ana Sanchez Cuesta for their technical support B.T Tung et al / Experimental Gerontology 64 (2015) 1–7 license NLRP3 inflammasome activation by regulating NLRP3 expression J Immunol 183, 787–791 Baur, J.A., Pearson, K.J., Price, N.L., Jamieson, H.A., Lerin, C., Kalra, A., Prabhu, V.V., Allard, J.S., Lopez-Lluch, G., Lewis, K., Pistell, P.J., Poosala, S., Becker, K.G., Boss, O., Gwinn, D., Wang, M., Ramaswamy, S., Fishbein, K.W., Spencer, R.G., Lakatta, E.G., Le Couteur, D., Shaw, R.J., Navas, P., Puigserver, P., Ingram, D.K., De Cabo, R., Sinclair, D.A., 2006 Resveratrol improves health and survival of mice on a high-calorie diet Nature 444, 337–342 Bradford, M.M., 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding Anal Biochem 72, 248–254 Brenner, C., Galluzzi, L., Kepp, O., Kroemer, G., 2013 Decoding cell death signals in liver inflammation J Hepatol 59, 583–594 Brüünsgaard, H., Pedersen, B.K., 2003 Age-related inflammatory cytokines and disease Immunol Allergy Clin N Am 23, 15–39 Bruunsgaard, H., Skinhøj, P., Pedersen, A.N., Schroll, M., Pedersen, B.K., 2000 Ageing, tumour necrosis factor-alpha (TNF-α) and atherosclerosis Clin Exp Immunol 121, 255–260 Chung, H.Y., Sung, B., Jung, K.J., Zou, Y., Yu, B.P., 2006 The molecular inflammatory process in aging Antioxid Redox Signal 8, 572–581 Chung, H.Y., Lee, E.K., Choi, Y.J., Kim, J.M., Kim, D.H., Zou, Y., Kim, C.H., Lee, J., Kim, H.S., Kim, N.D., Jung, J.H., Yu, B.P., 2011 Molecular inflammation as an underlying mechanism of the aging process and age-related diseases J Dent Res 90, 830–840 de Vries, J.E., 1995 Immunosuppressive and anti-inflammatory properties of interleukin 10 Ann Med 27, 537–541 Di Iorio, A., Ferrucci, L., Sparvieri, E., Cherubini, A., Volpato, S., Corsi, A., Bonafè, M., Franceschi, C., Abate, G., Paganelli, R., 2003 Serum IL-1β levels in health and disease: a population-based study ‘The InCHIANTI study’ Cytokine 22, 198–205 Dobbs, R.J., Charlett, A., Purkiss, A.G., Dobbs, S.M., Weller, C., Peterson, D.W., 1999 Association of circulating TNF-alpha and IL-6 with ageing and Parkinsonism Acta Neurol Scand 100, 34–41 Feng, Y.H., Zhu, Y.N., Liu, J., Ren, Y.X., Xu, J.Y., Yang, Y.F., Li, X.Y., Zou, J.P., 2004 Differential regulation of resveratrol on lipopolysacchride-stimulated human macrophages with or without IFN-γ pre-priming Int Immunopharmacol 4, 713–720 Fu, Y., Wang, Y., Du, L., Xu, C., Cao, J., Fan, T., Liu, J., Su, X., Fan, S., Liu, Q., Fan, F., 2013 Resveratrol inhibits ionising irradiation-induced inflammation in MSCs by activating SIRT1 and limiting NLRP-3 inflammasome activation Int J Mol Sci 14, 14105–14118 Fulgenzi, A., Bertelli, A.A.E., Magni, E., Ferrero, E., Ferrero, M.E., 2001 In vivo inhibition of TNFα-induced vascular permeability by resveratrol Transplant Proc 33, 2341–2343 Gao, X., Xu, Y.X., Janakiraman, N., Chapman, R.A., Gautam, S.C., 2001 Immunomodulatory activity of resveratrol: suppression of lymphocyte proliferation, development of cellmediated cytotoxicity, and cytokine production Biochem Pharmacol 62, 1299–1308 Gee, J.R., Ding, Q., Keller, J.N., 2005 Modulation of apolipoprotein E and interleukin-1β in the aging liver Exp Gerontol 40, 409–415 Glasgow, S.C., Ramachandran, S., Blackwell, T.S., Mohanakumar, T., Chapman, W.C., 2007 Interleukin-1β is the primary initiator of pulmonary inflammation following liver injury in mice Am J Physiol 293, L491–L496 Harman, D., 1956 Aging: a theory based on free radical and radiation chemistry J Gerontol 11, 298–300 Huang, T.T., Lai, H.C., Chen, Y.B., Chen, L.G., Wu, Y.H., Ko, Y.F., Lu, C.C., Chang, C.J., Wu, C.Y., Martel, J., Ojcius, D.M., Chong, K.Y., Young, J.D., 2013 cis-Resveratrol produces antiinflammatory effects by inhibiting canonical and non-canonical inflammasomes in macrophages Innate Immun http://dx.doi.org/10.1177/1753425913507096 Jung, K.J., Lee, E.K., Yu, B.P., Chung, H.Y., 2009 Significance of protein tyrosine kinase/protein tyrosine phosphatase balance in the regulation of NF-kappaB signaling in the inflammatory process and aging Free Radic Biol Med 47, 983–991 Lanzilli, G., Cottarelli, A., Nicotera, G., Guida, S., Ravagnan, G., Fuggetta, M., 2012 Antiinflammatory effect of resveratrol and polydatin by in vitro IL-17 modulation Inflammation 35, 240–248 Martinez, J., Moreno, J.J., 2000 Effect of resveratrol, a natural polyphenolic compound, on reactive oxygen species and prostaglandin production Biochem Pharmacol 59, 865–870 Martinon, F., 2010 Signaling by ROS drives inflammasome activation Eur J Immunol 40, 616–619 Martinon, F., Pétrilli, V., Mayor, A., Tardivel, A., Tschopp, J., 2006 Gout-associated uric acid crystals activate the NALP3 inflammasome Nature 440, 237–241 Rivera, L., Morón, R., Zarzuelo, A., Galisteo, M., 2009 Long-term resveratrol administration reduces metabolic disturbances and lowers blood pressure in obese Zucker rats Biochem Pharmacol 77, 1053–1063 Saiko, P., Szakmary, A., Jaeger, W., Szekeres, T., 2008 Resveratrol and its analogs: defense against cancer, coronary disease and neurodegenerative maladies or just a fad? Mutat Res Rev Mutat Res 658, 68–94 Salminen, A., Kaarniranta, K., Kauppinen, A., 2012 Inflammaging: disturbed interplay between autophagy and inflammasomes Aging (Albany NY) 4, 166–175 Schmucker, D.L., 1998 Aging and the liver: an update J Gerontol A Biol Sci Med Sci 53A, B315–B321 Schroder, K., Zhou, R., Tschopp, J., 2010 The NLRP3 inflammasome: a sensor for metabolic danger? Science 327, 296–300 Schwabe, R.F., Brenner, D.A., 2006 Mechanisms of liver injury I TNF-α-induced liver injury: role of IKK, JNK, and ROS pathways Am J Physiol 290, G583–G589 Shakibaei, M., Harikumar, K.B., Aggarwal, B.B., 2009 Resveratrol addiction: to die or not to die Mol Nutr Food Res 53, 115–128 Subbaramaiah, K., Dannenberg, A.J., 2003 Cyclooxygenase 2: a molecular target for cancer prevention and treatment Trends Pharmacol Sci 24, 96–102 Subbaramaiah, K., Chung, W.J., Michaluart, P., Telang, N., Tanabe, T., Inoue, H., Jang, M., Pezzuto, J.M., Dannenberg, A.J., 1998 Resveratrol inhibits cyclooxygenase-2 transcription and activity in phorbol ester-treated human mammary epithelial cells J Biol Chem 273, 21875–21882 Szabo, G., Csak, T., 2012 Inflammasomes in liver diseases J Hepatol 57, 642–654 Szkudelska, K., Szkudelski, T., 2010 Resveratrol, obesity and diabetes Eur J Pharmacol 635, 1–8 Tung, B.T., Rodriguez-Bies, E., Ballesteros-Simarro, M., Motilva, V., Navas, P., Lopez-Lluch, G., 2013 Modulation of endogenous antioxidant activity by resveratrol and exercise in mouse liver is age dependent J Gerontol A Biol Sci Med Sci 69, 398–409 Vandanmagsar, B., Youm, Y.H., Ravussin, A., Galgani, J.E., Stadler, K., Mynatt, R.L., Ravussin, E., Stephens, J.M., Dixit, V.D., 2011 The NLRP3 inflammasome instigates obesityinduced inflammation and insulin resistance Nat Med 17, 179–188 Williams, L.M., Lali, F., Willetts, K., Balague, C., Godessart, N., Brennan, F., Feldmann, M., Foxwell, B.M.J., 2008 Rac mediates TNF-induced cytokine production via modulation of NF-κB Mol Immunol 45, 2446–2454 Wunderlich, F.T., Ströhle, P., Könner, A.C., Gruber, S., Tovar, S., Brönneke, H.S., JunttiBerggren, L., Li, L.-S., van Rooijen, N., Libert, C., Berggren, P.-O., Brüning, J.C., 2010 Interleukin-6 signaling in liver-parenchymal cells suppresses hepatic inflammation and improves systemic insulin action Cell Metab 12, 237–249 Yang, S.J., Lim, Y., 2014 Resveratrol ameliorates hepatic metaflammation and inhibits NLRP3 inflammasome activation Metabolism 63, 693–701 Ye, Z., Ting, J.P.-Y., 2008 NLR, the nucleotide-binding domain leucine-rich repeat containing gene family Curr Opin Immunol 20, 3–9 Zhong, M., Cheng, G.F., Wang, W.J., Guo, Y., Zhu, X.Y., Zhang, J.T., 1999 Inhibitory effect of resveratrol on interleukin release by stimulated peritoneal macrophages of mice Phytomedicine 6, 79–84 Zhou, R., Tardivel, A., Thorens, B., Choi, I., Tschopp, J., 2010 Thioredoxin-interacting protein links oxidative stress to inflammasome activation Nat Immunol 11, 136–140 ... Results 3.1 Proinflammatory cytokines increased in old liver To determine if in ammation increases during aging in mouse liver we studied the levels of proinflammatory cytokines in whole liver homogenates... enzyme involved in the production of prostaglandins from arachidonic acid Levels of COX-2 increased along aging in mice liver reaching approximately a 60% more protein than in young mice liver. .. IL-17 and TNF-α in old liver in comparison with organs from young and mature mice This indicates that the levels of pro -in ammatory cytokines in the liver increase during aging, confirming an important