DSpace at VNU: Prevalence ofEscherichia coliin surface waters of Southeast Asian cities

DSpace at VNU: Prevalence ofEscherichia coliin surface waters of Southeast Asian cities tài liệu, giáo án, bài giảng , l...

World J Microbiol Biotechnol DOI 10.1007/s11274-013-1376-3 ORIGINAL PAPER Prevalence of Escherichia coli in surface waters of Southeast Asian cities Kenneth Widmer • Nguyen Thi Van Ha • Soydoa Vinitnantharat • Suthipong Sthiannopkao • Setiawan Wangsaatmaja • Maria Angela Novi Prasetiati Nguyen Cong Thanh • Kasame Thepnoo • Arief Dhany Sutadian • Huynh Thi Thanh Thao • Deby Fapyane • Vibol San • Pierangeli Vital • Hor-Gil Hur • Received: 21 September 2012 / Accepted: 10 May 2013 Ó Springer Science+Business Media Dordrecht 2013 Abstract Surface water samples were collected from rivers which fed into large urban areas within Vietnam, Indonesia, Cambodia, and Thailand and were processed to enumerate Escherichia coli Selected isolates were further characterized using PCR to detect the presence of specific virulence genes Analyzing the four countries together, the approximate mean cfu/100 ml for E coli counts in the dry season were log 4.3, while counts in the wet season were log 2.8 Of the 564 E coli isolates screened for the presence of pathogenic genes, 3.9 % possessed at least one virulence gene The most common pathogenic types found were Shiga toxin-producing E coli isolates These results reinforce the importance of monitoring urban surface waters for fecal contamination, that E coli in these water environments may serve as opportunistic pathogens, and may help in determining the impact water usage from these rivers have on the public health of urban populations in Southeast Asia K Widmer (&) Á D Fapyane International Environmental Analysis and Education Center, Gwangju Institute of Science and Technology, 123 Cheomdan-Gwagiro, Bukgu, Gwangju 500-712, Republic of Korea e-mail: kwidmer@gist.ac.kr S Wangsaatmaja Á M A N Prasetiati Á A D Sutadian West Java Environmental Protection Agency, Indonesia, Jl, Naripan No 25, Bandung 40111, West Java, Indonesia N T Van Ha Ministry of Natural Resources and Environment, Ho Chi Minh City University for Natural Resources and Environment, 236B Le Van Sy Street, Ward 1, Tan Binh District, Ho Chi Minh City, Vietnam S Vinitnantharat Division of Environmental Technology, School of Energy, Environment and Materials, King Mongkut’s University of Technology Thonburi (KMUTT), 126 Prachauthit Road, Thungkru, Bangkok, Thailand Keywords Escherichia coli Á Pathogens Á Surface water Á Urban water quality Á Southeast Asia Á PCR Introduction Surface water not only serves as drinking water sources for metropolitan areas in Southeast Asia, they also serve to facilitate a great deal of economic activity and play an essential part in regional agriculture Because of the important role surface waters play in the economic and sustainable development of Southeast Asian countries, ensuring sufficient water quality in these water sources is N C Thanh International Center for Education Development T.H.T, 15 Thien Y St., Ward 4, Dalat City, Vietnam K Thepnoo Department of Drainage and Sewerage, Bangkok Metropolitan Administration, 123 Mitmaitri Road, Dindaeng District, Bangkok, Thailand H T T Thao Faculty of Environment, Ho Chi Minh City University of Technology, 268 Ly Thuong Kiet, District 10, Ho Chi Minh City, Vietnam S Sthiannopkao Department of Environmental Engineering, College of Engineering, Dong-A University, Pusan, Republic of Korea 123 World J Microbiol Biotechnol essential for many urban cities Fecal contamination of surface waters is an issue under greater scrutiny from regulatory agencies in both developed and developing countries (US-EPA 2002; Santo Domingo et al 2007) The impact of poor surface water quality on public health is compounded as contamination of irrigation water may also introduce pathogens to the food supply through contaminated agricultural products, as exemplified by outbreaks of pathogenic Escherichia coli in fresh produce in developed countries (Pakalniskiene et al 2009; CDC 2006; Ackers et al 1998; Wheeler et al 2005) As such, the monitoring of fecal contamination in water sources is a key issue in evaluating urban water quality and understanding the potential risk to urban populations Escherichia coli is a commensal organism in many mammals and has a broad range of hosts Although this organism is part of the normal gut flora of many mammals, it can act as opportunistic pathogens and may serve as an agent for enteric disease in humans (Nataro and Kaper 1998; Hunter 2003) Given these characteristics, fecal contamination of surface waters is a common route of spreading E coli within the environment (Field and Samadpour 2007; Simpson et al 2002) and as this bacterium can persist in the environment (Byappanahalli and Fujioka 1998; Solo-Gabriele et al 2000), fecal contamination of surface waters is of some interest for gauging overall water quality and its potential impact on public health Additionally, previous studies have demonstrated that bacterial pathogens may be found in surface waters (Ha et al 2008; Kobayashi et al 2003; Phan et al 2003) and well water (Vollaard et al 2005) within Southeast Asian countries Of particular interest to public health are pathogenic E coli, of which several types can induce diarrheagenic infections in humans, with some capable of causing more serious infections such as hemorrhagic colitis (Ohno et al 1997; Nataro and Kaper 1998) Determining potential risk to public health is problematic, however quantitative microbial risk assessment is a tool that policy makers can utilize to better manage fecal contaminated waters and predict the potential impacts on populations (Haas et al 1999) Some approaches have utilized models based on reported cases of E coli infections in relation to relative levels of fecal contaminants in surface waters (Soller et al 2010) Having access to empirical count data, combined with surveys of pathogenic types from these samples, may provide a more substantive base of information to create better predictive models This information may also be critical in establishing proper water quality indices, to better predict the impact human pathogens have on water usage Additionally if these waters are utilized for agricultural use with limited treatment, they may have a greater impact on public health than expected due to potential outbreaks of food-borne diseases The focus of this study was to enumerate E coli in urban surface waters within Southeast Asian countries, and further characterize isolates as either, enteroinvasive E coli (EIEC), Shiga toxin-producing E coli (STEC), enterotoxigenic E coli (ETEC), enteropahogenic E coli (EPEC), or enterohemorrhagic E coli (EHEC) (Yatsuyanagi et al 2003; Nataro et al 1987; Jerse and Kaper 1991; Sears and Kaper 1996) Further, enumeration data would be compared to determine if seasonal or urban land-use would have an impact on relative numbers of E coli in these surface waters Materials and methods Bacterial cultures Both cultures of E coli NCCP 10004 (ETEC) and E coli NCCP 13719 (EIEC) were obtained from commercial stocks supplied by the National Culture Collection for Pathogens, Korea A cultural isolate of E coli O157:H7 was obtained as generous donation by the Korean Centers for Disease Control and Prevention which served as a control for EPEC, STEC, and EHEC as it contained carried all target virulence genes for these pathogenic types Sampling sites, land use classification, and sample collection V San Department of Environmental Science, Royal University of Phnom Penh, Russian Federation Boulevard, Toul Kork, Phnom Penh 12157, Cambodia P Vital Natural Sciences Research Institute, University of the Philippines Diliman, 1101 Quezon City, Philippines H.-G Hur School of Environmental Science and Engineering, Gwangju Institute of Science and Technology, 123 Cheomdan-Gwagiro, Bukgu, Gwangju 500-712, Republic of Korea 123 Surface water samples were collected in four main rivers that flow through different major Southeast Asian cities Urban metropolitan sampling sites were selected based primarily on their proximity to high density population areas or close association with industrial activity As comparative sampling sites, more rural locations where surface waters were used for irrigation, aquaculture, or were fed agricultural runoff were also sampled The Citarum River in Bandung (West Java, Indonesia), the lower Chao Phraya in Bangkok (Thailand), the Saigon river in Ho Chi Minh City (Vietnam), and the Tonle Sap-Bassac in World J Microbiol Biotechnol Phnom Penh (Cambodia) were selected due to these rivers being within respective city boundaries and having a close association with areas of high metropolitan populations (over million, except for Phnom Penh which has a population of approximately 1.3 million) (Fig 1) Land use types for potential collection sites were characterized by runoff sources within 200 m of each location Sites were either characterized as: (1) agricultural/rural, indicating sparsely populated areas, or those with heavy agricultural activity, (2) urban, indicting urban developed locations with relatively high populations and domiciles within the metropolitan area, (3) industrial, considered sampling locations with sparse domestic populations and greater intensity of mining or manufacturing activities which produced substantial water runoff during operation, (4) mixed, being a relatively proportional combination of at least two of other land use types, and finally (5) water treatment sites, which were locations where both the influent and effluent from water treatment plants were sampled Additionally these treatment sites received minimal runoff from sources of urban populations and agricultural operations and were considered ideal locations for establishing a baseline of treated surface waters within each region Approximately 10–20 sites were sampled over a month period for both the dry and wet seasons of each respective country in 2010 An additional month seasonal sampling event was conducted for Thailand during the dry season in 2011 for a total of 157 samples from all four countries Both Vietnam and Thailand had up to two sampling events for each location over the month periods during each season, while Indonesia and Cambodia had a single sampling event during both the dry and wet seasons Similar sampling locations (within 20 m) were maintained as sample points throughout the study over the different seasons Approximately 100 ml grab samples of surface water were collected into sterilized polypropylene bottles at 30 cm depths from the center of the river channels either by boat or from bridge structures Samples were taken below the water surface to minimize floating debris and a head space of roughly cm was maintained in each sample bottle During sample collection, data for basic water quality based on physical (temperature and turbidity) and chemical characteristics (pH and TDS) were collected on site Samples were transported in an improvised ice box (kept under 10 °C), and processed within 6–8 h of collection in a local laboratory for each respective country Water sample processing and E coli isolation and enumeration Water samples were sequentially filtered through sterile, 0.45 lm, 47 mm filters (Pall Korea Ltd., Seoul, Korea) in 10, 1, and 0.1 ml volumes If the sample volume was under 10 ml, it was mixed with 10 ml sterile DI water to ensure an even sample distribution over the filter surface Filters were ascetically transferred to modified membrane Thermotolerant E coli (mTEC) agar plates (BD Scientific, Maryland, USA) and were initially incubated at 35 °C for h, and further incubated at 44.5 °C for 22–24 h (Yan et al 2007; Unno et al 2009) Colony counts were recorded and adjusted to per 100 ml based on the volume sampled Up to 10 atypical colonies (red to magenta) were transferred to plates of MacConkey medium with lactose (BD Scientific, Maryland, USA), incubated at 35 ± 0.5 °C for 24 h, and presumptive identification of E coli isolates were determined by the observation of light pink to red colonies (Byappanahalli et al 2007) E coli isolates obtained from Thailand and Vietnam were then transferred to tryptic soy agar (TSA) slants and maintained at °C until shipping and further processing in Korea These countries were selected to ship isolates due to better local facilities for long term storage and access to transportation resources to facilitate rapid shipping of isolates Shipped TSA slants from Vietnam and Thailand were further processed in Korea and E coli isolates were confirmed by streaking onto Eosin Methylene Blue (EMB) agar plates (Lab M Limited, Lancashire, UK) which were incubated at 35 °C for 24 h Plates which demonstrated typical colony morphology for E coli (blue to black colonies with a metallic green sheen) were transferred into 0.1 ml Luria–Bertani freezing medium (Zimmer and Verrinder Gibbins 1997) and incubated with moderate shaking for 24 h at 35 °C After sufficient incubation, isolates were then maintained at -70 °C E coli DNA extraction and PCR Escherichia coli cultures in Luria Betaini freezing medium were thawed, with a 50 ll aliquot removed and mixed with 50 ll 0.05 M NaOH, and then finally boiled at 95 °C for 15 This resulting lysate was then used directly as template for PCR (Unno et al 2009) PCR reactions were run as multiplex or single reactions To reduce variation with the different PCR reactions, a commercial master pre- mix was used (AccuPower HF PCR Mix, Bioneer, Daejeon, Korea) The primers for each reaction are provided in Table Each reaction was prepared using ll template and primers at concentrations of 0.5 lM for AL65/125 (ETEC), 0.25 lM for primer sets LTL/R (ETEC) and ipa III/IV (EIEC) (Toma et al 2003), and 0.25 lM of primer sets stx1F/R, stx2F/R (STEC), eaeAF/R (EPEC), and hlyAF/R (EHEC) (Paton and Paton 1998), with DI water added to bring each reaction volume up to 20 ll In addition to the samples, non-template controls (DI water) and ll template DNA extracted from the control strains were used as negative and positive 123 World J Microbiol Biotechnol Fig Sampling sites for the Saigon River, Vietnam (a), Tonle Sap-Bassac Rivers, Cambodia (b), Lower Chao Phraya River, Thailand (c), and the Citarum River, Indonesia (d) 123 World J Microbiol Biotechnol Fig continued controls, respectively Each reaction was run under previously published conditions (Toma et al 2003; Paton and Paton 1998) The exception being for the primer sets AL65/125 where an annealing temperature of 58 °C was used, as it was determined that this higher annealing temperature produced an improved yield of product using template from the control strain (data not shown) PCR products were analyzed by electrophoresis on % agarose gels stained with ethidium bromide Digital images were obtained after UV transillumination and the products were compared to both positive control strains and a commercial molecular weight standard Amplicons of the appropriate size were scored as positive identification of the respective pathogenic E coli gene, and extracted DNA from E coli isolate samples which demonstrated amplicons indicative of pathogenic genes were subjected to PCR analysis a second time to confirm the initial results E coli isolates were pathogen-typed based on the profile of amplicons, where the presence of est and/or elt were considered ETEC types, ipaH was considered EIEC types, the sole presence of stx1 and/or stx2 considered STEC types, hlyA being deemed EHEC types, and eaeA being classified as EPEC types Selected isolates that demonstrated expected sized fragments for virulence genes were cultured again onto EMB agar plates Genomic DNA was extracted from the cultured plates by transferring an isolated colony into 100 ll TE buffer and boiling the cell suspension at 95 °C for 15 This resulting lysate was then used directly as template for PCR as previously described, except that only a single set of primers were used to amplify expected PCR products (where multiple single primer reactions were run in place of multiplex PCR reactions) Amplicons were purified using a commercial kit (PCR Purification Kit, ELPIS-Biotech, Korea) and resulting purified DNA samples were sequenced by a commercial analysis service that employed an Applied Biosystems 3730xl DNA Analyzer instrument Further confirmation of these PCR sequences were determined by BLAST analysis 123 World J Microbiol Biotechnol Table PCR primer sets employed in this study Sequence displayed as 50 –30 a Toma et al (2003) b Paton and Paton (1998) Primer Sequence Gene Amplicon size (bp) AL65 TTAATAGCACCCGGTACAAGCAGG est 147a elt 322a ipaH 619a stx1 180b stx2 255b AL125 CCTGACTCTTCAAAAGAGAAAATTAC LTL TCTCTATGTGCATACGGAGC LTR CCATACTGATTGCCGCAAT ipaIII GTTCCTTGACCGCCTTTCCGATACCGTC ipaIV GCCGGTCAGCCACCCTCTGAGAGTAC stx1F ATAAATCGCCATTCGTTGACTAC stx1R AGAACGCCCACTGAGATCATC stx2F GGCACTGTCTGAAACTGCTCC stx2R TCGCCAGTTATCTGACATTCTG eaeAF eaeAR GACCCGGCACAAGCATAAGC CCACCTGCAGCAACAAGAGG eaeA 384b hlyAF GCATCATCAAGCGTACGTTCC hlyA 534b hlyAR AATGAGCCAAGCTGGTTAAGCT Table E coli counts based on season and general water quality characteristics (mean ± standard error) River Log CFU/100 ml Total Wet season a Dry season a Physical characteristics Chemical characteristics Temp (°C) pH Turbidity (NTU) TDS Tonle Sap-Bassac (22) 3.05 ± 0.07 3.05 ± 0.07 (11) 3.04 ± 0.12 (11) 28.9 ± 0.31 106.5 ± 18.2 7.2 51.2 ± 3.02 Citarum (20) 4.58 ± 0.05 4.49 ± 0.07 (10) 4.62 ± 0.05 (10) 25.1 ± 0.25 NA 7.2 144.5 ± 7.08 Lower Chao Phraya (74) Saigon (41) 3.94 ± 0.24 2.86 ± 0.2 1.95 ± 0.43 (27) 2.83 ± 0.29 (20) 5.08 ± 0.11 (47) 2.9 ± 0.27 (21) 29.9 ± 0.4 29.8 ± 0.33 26.7 ± 4.0 47.7 ± 10.4 7.2 6.4 2877.7 ± 924.25 2.5 ± 0.76 General water quality characteristics measured at time of sample collection Numbers in parenthesis are total number of samples collected NA not analyzed a Overall mean cfu/100 ml were significantly higher (p = 0.001) in the dry season [log 4.27 ± 0.14 (s.e.)] compared to the wet season [log 2.76 ± 0.22 (s.e.)] Data analysis Means of log E coli counts per 100 ml were analyzed to determine the normality of their distributions Based on Kolmogorov–Smirnov tests, it was deemed that non-parametric statistical tests (Wilcoxon ranked sum) would be more suitable to interpret differences in the observed means Surface waters associated with particular land use categories were compared through analysis of mean cfu/100 ml values for the urban, mixed land use, and industrial sites against the agricultural/rural sampling sites Statistical analysis was conducted using a commercially available program (SPSS 14.0, SPSS inc., Chicago, USA) Results E coli counts Mean cfu/100 ml E coli counts based on seasonal data are summarized in Table Sixty eight and 89 samples were 123 collected and processed for the wet and dry seasons, respectively, for all four countries, with an overall mean log 3.61 cfu/100 ml (±0.14 s.e.) for all 157 water samples The mean dry season counts were log 4.27 cfu/100 ml, roughly log 1.5 higher than the mean wet season counts of log 2.76 cfu/100 ml for all the land use types (including 12 samples from the treatment sites) Overall means of cfu/100 ml E coli counts ranged from log 2.66–4.58 for individual rivers, with both the Citarum (log 4.58) and Lower Chao Phraya (log 3.94) being approximately log or greater than the overall means of the Tonle Sap-Bassac (log 3.05) and Saigon rivers (log 2.86) Seasonal variations in the sites were not apparently different, except for the Lower Chao Phraya which had an almost log increase from average counts in the wet season (Table 2) Physical and chemical characteristics also varied for many of the rivers, especially TDS readings which had an average over 2,800 mg/l in the Lower Chao Phraya far exceeding the other averages within the other sampled rivers The Tonle SapBassac Rivers had the highest mean turbidity of 106 NTUs, almost double that of the Saigon River and nearly four times that of the Lower Chao Phraya River (Table 2) World J Microbiol Biotechnol To determine if there were seasonal differences for the sampling sites across all rivers, further statistical analysis was conducted However due to the relative low numbers at the water treatment sites compared to other land-use types which would disproportionately skew data with excessive variance, these water treatment sites were removed from the seasonal data sets prior to analysis When comparing the means for all the rivers combined based on season (with water treatment site removal), the observed difference for combined means of the land use sites was found to be statistically significant (p = 0.001) (Table 2) Additional comparisons were made for mean E coli counts based on land use classifications, to discern if river surface waters within urban areas and runoff associated with urban activity were significantly different from rivers impacted by agriculture or more-rural land use activities The overall mean cfu/100 ml values for the land use types ranged from log 1.7 (water treatment sites) to log 4.1 (urban sites), with values for agricultural/rural, mixed land use, and industrial sites being log 3.2, 3.9, and 3.8, respectively Analysis based on land use types was made comparing the agricultural/rural sample sites (41 samples) individually to the urban (77 samples), industrial (21 samples), and mixed land use sites (6 samples) based on the yearly collected data Comparisons to the water treatment sites were omitted due to the low observed counts at these sites and limited collected samples (12 samples) There were statistically significant differences observed comparing the agricultural/rural land use types to both urban sites (p = 0.001) and industrial sites (p = 0.022), while such statistical differences were not observed when comparing mean E coli counts of agricultural/rural sites to that of mixed land use locations (Table 3) Observed pathogenic E coli types Of 564 isolates processed, 22 (3.9 %) were observed to have virulence genes initially determined by the presence of PCR products and further confirmed by sequencing and Table Mean E coli counts based on land use and season (mean ± standard error) Land use type Overall Dry season Wet season Agricultural/rural (41) 3.15 ± 0.21a 3.63 ± 0.22 2.59 ± 0.34 4.1 ± 0.19a 4.77 ± 0.16 3.11 ± 0.33 3.79 ± 0.39a 4.62 ± 0.27 2.7 ± 0.7 Urban (77) Industrial (21) Mixed use (6) 3.86 ± 0.32 3.96 ± 0.5 3.76 ± 0.5 Treatment (12) 1.67 ± 0.52 2.26 ± 0.76 1.07 ± 0.68 Counts expressed as log CFU/100 ml Number in parenthesis is total number of location land types a Mean log cfu/100 ml for agricultural/rural sites significantly lower when compared to urban (p = 0.001) or industrial sites (p = 0.022) Table Observed E coli virulence genes and pathogen types based on land use Land use type Virulence genes E coli pathogen types elt eaeA ETEC stx1 EPECa STEC Agricultural/rural (11) 3 Urban (12) Combined land use types total 12 Isolates were obtained from either Vietnam (12) or Thailand (10) Number in parenthesis is total number of location land types a Isolates positive for both eaeA and stx1 were considered as EPEC BLAST analysis All isolates presented in this study which possessed similar pathogen-type profiles, were either from different locations/rivers, or collected on different sampling dates (a different sampling month or season) for the 157 water samples collected and processed For some water samples, multiple colonies from the same sample were isolated and processed (up to 10) It is possible that some isolates which had similar pathogen profiles (based on the presence of similar PCR products) could be clones While studies have demonstrated that E coli diversity in river systems can fluctuate monthly even if collected from the same location (Jang et al 2011), to reduce such potential redundancy, additional isolates from the same sampling location and collection dates were removed from the data set if they presented similar virulence gene profiles Less than seven isolates were initially removed from the data set, due to having similar virulence gene profiles and because they derived from water samples that were collected during a single sampling event The most common pathogenic E coli isolates recovered were STEC (n = 9) and the second most common pathogenic E coli isolates observed were EPEC strains (n = 7) ETEC type isolates were also observed (n = 6) It is interesting to note that three EPEC strains possessed both eaeA and stx1 As intimin is considered a key virulence factor for enteropathogenic E coli, these isolates were considered EPEC, however this gene can also be present in Shiga toxin-producing E coli (Aidar-Ugrinovich et al 2007) (Table 4) Interestingly, the predominant Shiga-toxin gene found was stx1 (12 isolates), and isolates possessed elt The intimin factor gene, eaeA, was also relatively common being found in of the 22 isolates No other isolates harbored hlyA, invA, or est genes which could be confirmed through amplification and/or sequencing of PCR products Pathogen-type E coli were observed in both agricultural/ rural surface waters (11 isolates) and also from urban land use types (12 isolates) in roughly the same proportion (Table 4) Additionally, isolates which had virulence genes 123 World J Microbiol Biotechnol were recovered from both river systems within Thailand and Vietnam in similar numbers, totaling 10 and 11 isolates, respectively Discussion For all countries, overall means for E coli counts exceeded a proposed US-EPA coastal and recreational waters standard threshold value of log 2.61 cfu/100 ml (US-EPA 2012) although Vietnam was very close to remaining within this proposed limit with an average of log 2.86 cfu/100 ml This trend for individual rivers was also seen when looking at just seasonal averages as observed cfu/100 ml counts were as high as log 5.08, however Thailand during the wet season was the only exception being under this threshold with an average mean of log 1.95 cfu/100 ml (Table 2) This trend was also observed when accounting all of the data when the rivers were combined, with the average mean values in the dry seasons exceeding this proposed threshold value, while the wet season was much closer to acceptable limits with a mean value of log 2.76 cfu/100 ml (Table 2) Closer examination based on land use types indicated that for both seasons, most urban water sources exceeded this proposed threshold value, with some seasonal means exceeding this by more than log (Table 3) A notable exception was the industrial land use types which the mean was very close to this proposed threshold value (log 2.7 cfu/ 100 ml) It is also important to note that the water treatment land use types had an overall mean of log 1.7 cfu/100 ml which was below this recommended limit demonstrating that regional water treatment efforts were sufficiently employed There was an observed seasonal difference in the overall mean values, with the dry season having approximately 1.5 log higher counts than the wet season (Table 2) While it might be expected that heavy precipitation may also increase runoff events and in turn, increase overall numbers of fecal indicator organisms, it is quite possible that the substantial rainfall due to monsoon events during the wet season in these regions achieved a dilution effect with the microbial populations in these surface waters This is supported by other studies which also observed seasonal variation of E coli numbers in Southeast Asian surface waters with reduced numbers observed during the wet season (Isobe et al 2004) Additionally, surveys of Southeast Asian agricultural surface waters have reported log cfu/100 ml values similar to what was observed with this work (Diallo et al 2008; Yajima and Kurokura 2008) It is important to note that there were significantly higher levels of E coli in urban surface waters compared to agricultural/rural waters Although microbial loads due to fecal runoff of livestock operations is a likely source of 123 pollution, it is expected that higher density urban areas may have a greater fecal contaminant load in surface waters which receive urban runoff, especially if such wastewater is minimally treated A survey of treated septage sludge in Vietnamese households reported a mean of log cfu/g of dry weight for E coli indicating that even conventional waste treatment systems may have a potential impact on surface waters if not managed properly (Yen-Phi et al 2010) and a survey of urban canals in Thailand had even higher values ranging from 5.7 to 6.8 log CFU/100 ml (Giri et al 2005) In addition, surveys of rivers associated with metropolitan areas in Indonesia also have demonstrated similar results to what has been reported here with counts ranging from 2.9 to 4.8 log cfu/100 ml (Kido et al 2009) Approximately % of the E coli isolates analyzed demonstrated the presence of pathogenic genes It is surprising that many of the isolates harbored Shiga toxinproducing genes as human sources of this pathogen type are typically associated with E coli O157:H7, however it has been demonstrated that Shiga toxin genes are present in several E coli strains isolated from animal hosts (Nataro and Kaper 1998) It is quite possible that runoff from small livestock operations within urban areas may be a potential source for these strains as studies investigating the incidence of pathogenic E coli in Vietnamese swine operations found STEC strains in irrigation water systems (Kobayashi et al 2003) EPEC types were also detected at a relatively similar proportional number with the other pathogenic E coli types This may not be uncommon as a recent survey within Taiwan of water treatment plants and surface waters of nearby rivers found that EPEC was a common diarrheagenic E coli type, with this pathogen type being detected in approximately % of the 55 samples (Huang et al 2012) ETEC was also a commonly observed pathogenic E coli type, determined by the presence of the elt virulence gene (Table 4) This pathogenic E coli type is typically associated with traveler’s diarrhea and fecal contamination of water has been known to be a major factor in its epidemiology (Nataro and Kaper 1998) Also, a survey of young children suffering from diarrhea in Jakarta, Indonesia, found that approximately 20 % of rectal swab samples were positive for ETEC strains (Richie et al 1997) supporting the notion that this E coli pathogen type may not be uncommon Southeast Asian urban populations From this work, there is an indication that a fair percentage of E coli found in urban surface waters may be pathogenic strains, as 3.9 % of the isolates sampled and tested possessed virulence genes However, only a limited number of isolates from each water sample were further processed for PCR analysis Additionally enteroaggregative E coli, considered another divergent pathogenic group expressing aggregative adherence to gut epithelia tissue, was not investigated (Nataro et al 1987) This pathogenic World J Microbiol Biotechnol phenotype strain was not included in this study primarily due to lacking access to an appropriate clinical isolate E coli strain as a comparative positive control for PCR analysis Due to these previously stated limitations, the results of this study may provide an incomplete picture to the relative risk of populations that utilize surface waters in Southeast Asia Nonetheless it is important to note that even with these limitations pathogenic strains of E coli were observed Given the mean counts in urban waters were observed in some sampling events to exceed log cfu/100 ml, it is not unreasonable to predict that pathogenic E coli could be present in these surface waters and the incidence of pathogenic stains may be rather high Although most pathogenic E coli types require larger infectious doses (Kothary and Babu 2001), the observed high numbers of E coli in this study combined with the continual exposure to these surface waters could negatively impact public health, especially if such waters are used by neighboring communities for agricultural production (Lynch et al 2009) Further, as E coli is an indicator organism for fecal contamination, it is not unreasonable to consider other pathogens transmitted by the oral-fecal route may be present and that there may potentially be higher risks to the health of populations that utilize these surface waters for drinking, recreational use, or agriculture The results of this study demonstrate that in Southeast Asia, urban surface waters and rivers associated with urban activity have substantially high levels of E coli Further, roughly % of the isolates harbored pathogenic genes with the most common pathogen types being either EPEC or STEC These study results highlight the importance for monitoring and treatment of urban waters in Southeast Asia, especially if these waters are to be used for drinking sources or for agricultural and aquaculture activity, as there may be a negative impact on public health Acknowledgments This work was supported by the UNU&GIST Joint Programme on Science and Technology for Sustainability, Gwangju Institute of Science and Technology, Korea and part of a project funded by the Asia–Pacific Network for Global Change Research (Project Reference Number: ARCP2010-01CMYSthiannopkao) References Ackers ML, Mahon BE, Leahy E, Goode B, Damrow T, Hayes PS, Bibb WF, Rice DH, Barrett TJ, Hutwagner L (1998) An outbreak of Escherichia coli O157:H7 infections associated with leaf lettuce consumption J Infect Dis 177(6):1588–1593 Aidar-Ugrinovich L, Blanco J, Blanco M, Blanco JE, Leomil L, Dahbi G, Mora A, Onuma DL, Silveira WD, Pestana de Castro AF (2007) Serotypes, virulence genes, and intimin types of Shiga toxin-producing Escherichia coli (STEC) and enteropathogenic E coli (EPEC) isolated from calves in Sao Paulo, Brazil Int J Food Microbiol 115(3):297–306 Byappanahalli M, Fujioka R (1998) Evidence that tropical soil environment can support the growth of Escherichia coli Water Sci Technol 38(12):171–174 Byappanahalli MN, Whitman RL, Shively DA, Ferguson J, Ishii S, Sadowsky MJ (2007) Population structure of Cladophora-borne Escherichia coli in nearshore water of Lake Michigan Water Res 41(16):3649–3654 CDC (2006) Ongoing multistate outbreak of Escherichia coli serotype O157:H7 infections associated with consumption of Fresh Spinach—United States, September 2006 Morb Mortal Wkly Rep 55(38):1045–1046 Diallo MBC, Anceno AJ, Tawatsupa B, Houpt ER, Wangsuphachart V, Shipin OV (2008) Infection risk assessment of diarrhearelated pathogens in a tropical canal network Sci Total Environ 407(1):223–232 Field KG, Samadpour M (2007) Fecal source tracking, the indicator paradigm, and managing water quality Water Res 41(16): 3517–3538 Giri RR, Takeuchi J, Ozaki H (2005) Influence of night soil contamination on activated sludge microbial communities in Bangkok, Thailand Ecol Eng 25(4):395–404 Ha N, Kitajima M, Hang N, Matsubara K, Takizawa S, Katayama H, Oguma K, Ohgaki S (2008) Bacterial contamination of raw vegetables, vegetable-related water and river water in Ho Chi Minh City, Vietnam Water Sci Technol 58(12):2403–2411 Haas CN, Rose JB, Gerba CP (1999) Quantitative microbial risk assessment Wiley, New York Huang S-W, Hsu B-M, Su Y-J, Ji D-D, Lin W-C, Chen J-L, Shih F-C, Kao P-M, Chiu Y-C (2012) Occurrence of diarrheagenic Escherichia coli genes in raw water of water treatment plants Environ Sci Pollut Res 19(7):2776–2783 doi:10.1007/s11356-0120777-4 Hunter PR (2003) Drinking water and diarrhoeal disease due to Escherichia coli J Water Health 1(2):65–72 Isobe KO, Tarao M, Chiem NH, Minh LY, Takada H (2004) Effect of environmental factors on the relationship between concentrations of coprostanol and fecal indicator bacteria in tropical (Mekong Delta) and temperate (Tokyo) freshwaters Appl Environ Microbiol 70(2):814–821 Jang J, Unno T, Lee SW, Cho KH, Sadowsky MJ, Ko G, Kim JH, Hur H-G (2011) Prevalence of season-specific Escherichia coli strains in the Yeongsan River Basin of South Korea Environ Microbiol 13(12):3103–3113 doi:10.1111/j.1462-2920.2011 02541.x Jerse AE, Kaper JB (1991) The eae gene of enteropathogenic Escherichia coli encodes a 94-kilodalton membrane protein, the expression of which is influenced by the EAF plasmid Infect Immun 59(12):4302–4309 Kido M, Yustiawati Y, Syawal M, Sulastri S, Hosokawa T, Tanaka S, Saito T, Iwakuma T, Kurasaki M (2009) Comparison of general water quality of rivers in Indonesia and Japan Environ Monit Assess 156(1):317–329 doi:10.1007/s10661-008-0487-z Kobayashi H, Khai LTL, Phan TT, Yamasaki S, Taniguchi T (2003) Prevalence of pathogenic Escherichia coli in a swine breeding environment in Can Tho province, Vietnam Jpn Agric Res Q 37(1):59–64 Kothary MH, Babu US (2001) Infective dose of foodborne pathogens in volunteers: a review J Food Saf 21(1):49–68 doi:10.1111/ j.1745-4565.2001.tb00307.x Lynch MF, Tauxe RV, Hedberg CW (2009) The growing burden of foodborne outbreaks due to contaminated fresh produce: risks and opportunities Epidemiol Infect 137(3):307–315 Nataro JP, Kaper JB (1998) Diarrheagenic Escherichia coli Clin Microbiol Rev 11(1):142–201 123 World J Microbiol Biotechnol Nataro JP, Kaper JB, Robins-Browne R, Prado V, Vial P, Levine MM (1987) Patterns of adherence of diarrheagenic Escherichia coli to HEp-2 cells Pediatr Infect Dis J 6(9):829–831 Ohno A, Marui A, Castro ES, Reyes AA, Elio-Calvo D, Kasitani H, Ishii Y, Yamaguchi K (1997) Enteropathogenic bacteria in the La Paz River of Bolivia Am J Trop Med Hyg 57(4):438–444 Pakalniskiene J, Falkenhorst G, Lisby M, Madsen SB, Olsen KE, Nielsen EM, Mygh A, Boel J, Molbak K (2009) A foodborne outbreak of enterotoxigenic E coli and Salmonella Anatum infection after a high-school dinner in Denmark, November 2006 Epidemiol Infect 137(3):396–401 Paton AW, Paton JC (1998) Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E coli hlyA, rfbO111, and rfbO157 J Clin Microbiol 36(2):598–602 Phan TT, Khai LTL, Loc CB, Hayashidani H, Sameshima T, Watanabe T, Taniguchi T, Kobayashi H, Ito H, Akiba M (2003) Isolation of Salmonella strains from the aquatic environment and comparison with those of animal origin in Tan Phu Thanh village, Mekong Delta, Vietnam Jpn Agric Res Q (JARQ) 37(4):237–241 Richie E, Punjabi NH, Corwin A, Lesmana M, Rogayah I, Lebron C, Echeverria P, Simanjuntak CH (1997) Enterotoxigenic Escherichia coli diarrhea among young children in Jakarta, Indonesia Am J Trop Med Hyg 57(1):85–90 Santo Domingo JW, Bambic DG, Edge TA, Wuertz S (2007) Quo vadis source tracking? Towards a strategic framework for environmental monitoring of fecal pollution Water Res 41(16): 3539–3552 Sears CL, Kaper JB (1996) Enteric bacterial toxins: mechanisms of action and linkage to intestinal secretion Microbiol Rev 60(1): 167–215 Simpson JM, Santo Domingo JW, Reasoner DJ (2002) Microbial source tracking: state of the science Environ Sci Technol 36(24): 5279–5288 Soller J, Embrey M, Tuhela L, Ichida A, Rosen J (2010) Risk-based evaluation of Escherichia coli monitoring data from undisinfected drinking water J Environ Manag 91(11):2329–2335 Solo-Gabriele HM, Wolfert MA, Desmarais TR, Palmer CJ (2000) Sources of Escherichia coli in a coastal subtropical environment Appl Environ Microbiol 66(1):230–237 123 Toma C, Lu Y, Higa N, Nakasone N, Chinen I, Baschkier A, Rivas M, Iwanaga M (2003) Multiplex PCR assay for identification of human diarrheagenic Escherichia coli J Clin Microbiol 41(6):2669–2671 Unno T, Han D, Jang J, Lee SN, Ko G, Choi HY, Kim JH, Sadowsky MJ, Hur HG (2009) Absence of Escherichia coli phylogenetic group B2 strains in humans and domesticated animals from Jeonnam Province, Republic of Korea Appl Environ Microbiol 75(17):5659–5666 US-EPA (2002) The 2000 national water quality inventory Office of Water EPA-841-R-02-001 US-EPA (2012) Recreational water quality criteria Office of Water EPA 820-F-12-058 Vollaard AM, Ali S, Smet J, Van Asten H, Widjaja S, Visser LG, Surjadi C, Van Dissel JT (2005) A survey of the supply and bacteriologic quality of drinking water and sanitation in Jakarta, Indonesia Southeast Asian J Trop Med Public Health 36(6):1552–1561 Wheeler C, Vogt TM, Armstrong GL, Vaughan G, Weltman A, Nainan OV, Dato V, Xia G, Waller K, Amon J, Lee TM, Highbaugh-Battle A, Hembree C, Evenson S, Ruta MA, Williams IT, Fiore AE, Bell BP (2005) An outbreak of hepatitis A associated with green onions N Engl J Med 353(9):890–897 Yajima A, Kurokura H (2008) Microbial risk assessment of livestockintegrated aquaculture and fish handling in Vietnam Fish Sci 74(5):1062–1068 Yan T, Hamilton MJ, Sadowsky MJ (2007) High-throughput and quantitative procedure for determining sources of Escherichia coli in waterways by using host-specific DNA marker genes Appl Environ Microbiol 73(3):890–896 Yatsuyanagi J, Saito S, Miyajima Y, Amano K, Enomoto K (2003) Characterization of atypical enteropathogenic Escherichia coli strains harboring the astA gene that were associated with a waterborne outbreak of diarrhea in Japan J Clin Microbiol 41(5):2033–2039 Yen-Phi VT, Rechenburg A, Vinneras B, Clemens J, Kistemann T (2010) Pathogens in septage in Vietnam Sci Total Environ 408(9):2050–2053 Zimmer R, Verrinder Gibbins AM (1997) Construction and characterization of a large-fragment chicken bacterial artificial chromosome library Genomics 42(2):217–226 ... the health of populations that utilize these surface waters for drinking, recreational use, or agriculture The results of this study demonstrate that in Southeast Asia, urban surface waters and... Taiwan of water treatment plants and surface waters of nearby rivers found that EPEC was a common diarrheagenic E coli type, with this pathogen type being detected in approximately % of the 55... substantial water runoff during operation, (4) mixed, being a relatively proportional combination of at least two of other land use types, and finally (5) water treatment sites, which were locations