Determination of causative bacteria agent of hemorrhagic disease in mudskipper (pseudapocryptes elongatus)

MINISTRY OF EDUCATION AND TRAINING CAN THO UNIVERSITY NGUYEN THU DUNG DETERMINATION OF CAUSATIVE BACTERIA AGENT OF HEMORRHAGIC DISEASE IN MUDSKIPPER (Pseudapocryptes elongatus) Major in Aquaculture Identification code: 62620301 SUMMARY OF DOCTORAL DISSERTATION IN AQUACULTURE 2015 This study was achieved at the College of Aquaculture and Fisheries, Can Tho University Scientific advisors: Assoc Prof Dr ĐANG THI HOANG OANH Reviewer 1:………………………………………………………… Reviewer 2:………………………………………………………… Reviewer 3:………………………………………………………… This dissertation was defended at the University Examination Committee At……………………………………………………………… At ……hour… , on date………month…… year……………… The dissertation is available at: Center for education materials of Can Tho University National library MINISTRY OF EDUCATION AND TRAINING CAN THO UNIVERSITY NGUYEN THU DUNG DETERMINATION OF CAUSATIVE BACTERIA AGENT OF HEMORRHAGIC DISEASE IN MUDSKIPPER (Pseudapocryptes elongatus) Major in Aquaculture Identification code: 62620301 SUMMARY OF DOCTORAL DISSERTATION IN AQUACULTURE Scientific advisors: Assoc Prof Dr ĐANG THI HOANG OANH 2015 Chapter OVERVIEW OF THE DISSERTATION 1.1 Introduction Mudskipper (Pseudapocryptes elongatus) is a special species of high economic value, are consumed widely in domestic and export value Mudskipper cultures in the provinces Mekong Delta region, however, in the recent times mudskipper were sick with pathological signs of hemorrhage in the body, at the fin and anal with a high mortality rate and widespread Most of determination of hemorrhagic disease are bacteria Streptococcus agalactiae is typical as the causative agent of tilapia (Oreochromis sp.) (Pham Hong Quan et al., 2013), red tilapia (Oreochromis sp.) (Dang Thi Hoang Oanh and Nguyen Thanh Phuong, 2012) S iniae on seabass (Latex calcarifer) (Tran Vi hich and Nguyen Huu Dung, 2011), Japanese flounder (Paralichthys olivaceus), red croaker (Sciaenops ocellates) (Eldar et al., 1999) In addition, fish diseases are caused by S dysgalactiae in mullet (Liza alata, Liza haemotocheila) (Qi et al., 2013), sturgeon (Acipencer schrenckii) (Yang and Li, 2009), fish brown (Mugil cephalus) and cobia (Rachycentron canadum) (Abdelsalam et al., 2009) Determination of hemorrhagic disease also is found from many different species as Aeromonas hydrophila bacteria (Loan et al., 2009), Vibrio parahaemolyticus and V alginolyticus on grouper (juvenile and grow up) (Somkiat Kanchanakhan, 1996; Nguyen Thi Thanh Thuy et al., 2009 was quoted by Vo Van Nha, 2012) Because of various agents causative diseases, so the prevention and treatment of dengue in aquatic animals are only effective when the agent and the cause is pinpointed Currently, determination of hemorrhagic disease on mudskipper isn’t researching, to provide information for disease prevention and treatment hemorrhagic on mudskipper "Determination of causative bacteria agent of hemorrhagic disease in mudskipper (Pseudapocryptes elongatus) " is researched 1.2 General objective of the study Survey and assessment of hemorrhage appear on a mudskipper farm in Bac Lieu province Identifying characteristics of Pathology in fish pathogens which proposed solutions to prevent and treat the disease effectively 1.3 Scientific significance and applicable ability of the dissertation Information from the results of an mudskipper condition and prevent disease process will contribute to limit the damage in the farming process mudskipper effective on economic productivity and income generation for farmers 1.4 New findings of the dissertation Identifying the causative agent of hemorrhagic disease in mudskipper is S dysagalactiae and the time the disease usually appear in mudskipper ponds A polymerase chain reaction (PCR) was preformed and optimized for detection of S dysgalactiae bacteria to apply early diagnosis, rapid and specific the causative agent of hemorrhagic disease in mudskipper Recommend some antibiotic treatment of hemorrhagic disease in mudskipper Chapter LITERATURE REVIEW In the literature review, the thesis described and analyzed the issues related to the situation of indentured mudskipper as well as the study of certain types of pathogenic bacteria on the fish to the main contents: - The situation of indentured mudskipper in the world and country - The situation of the disease appears on mudskipper - Overview of hemorrhagic disease in fish - Overview of the characteristics of the bacteria on the fish - Overview of the situation pathogens Streptococcus on brackish and sea fish - Determination of the virulence of some strains of the bacteria that cause hemorrhagic disease - Diagnosis of hemorrhage - Prevention and treatment of dengue in fish Chapter METHODS OF THE STUDY 3.1 3.1 Study periods and site Time to research: from September, 2011 to December, 2014 3.2 Study species: Mudskipper 3.3 Study methods 3.3.1 The interview 3.3.1.1 The secondary data Collected from the report of specialized agencies in Bac Lieu province Secondary data include aquaculture situation and the situation of mudskipper farm in Bac Lieu 3.3.1.2 The primary data Interview 90 farmers mudskipper commercial in Bac Lieu town, Hoa Binh District and Dong Hai District, Bac Lieu province Primary data include basic information, experience, culture techniques, information on fish diseases and how to treat the disease when mudskipper disease 3.3.2 Fish sampling methods - Fish sample: mudskipper live, sample of 254 fish living in 34 pounds (11 ponds normal, 23 ponds have a mudskipper hemorrhagic disease) - Conditions for sampling: fish are 2-3 months old, weight 15-25 g/fish Sampling time is 7-8 am 3.3.3 Testing Method parasites The number of test samples of parasitic is 120 samples in 12 ponds, include 04 sampling sessions, each of 03 ponds, each pond 10 fish Check the skin, gills and gut a fish The level of parasite infection: The rate of infection = (The number of infection samples/Total samples tested) x 100 The intensity of infection = (The number of parasite/Fish, organ, lame, microscope) 3.3.4 The method of sample analysis bacteria 3.3.4.1 Giemsa staining method To spread kidney samples up lame Samples were fixed in methanol for minute Giemsa staining method according Humason, 1979 cited by Rowley, 1990 Read the results by a microscope at 100X with oil drop 3.3.4.2 The method of isolation and identification of bacteria - Use a sterile scalpel incision in the kidney Through kidney by implanting, twist to take samples and cultured on agar plate Incubate plates in an incubator at a temperature of 28°C After 24-48 hours, read the results - Check the net of bacteria, oxidase, catalase, O/F, capability development of bacteria in the environment TSB (+ 6.5% NaCl), the hemolytic ability of bacteria d The method of identification of bacteria by API 20 Strep kit (Biomérieux, Pháp) Random identifier 32 strains of bacteria collected is obtained sampling 06 times by API 20 Strep kit 3.3.5 The identification of bacteria by sequencing method 3.3.5.1 The method of bacterial DNA extraction The process of DNA extraction from bacteria applied by the method of Bartie et al (2006) Bacteria proliferate raised from 16-18 hours in ml of NB (+ 1.5% NaCl) at a temperature of 28ºC, DNA extraction by 1.5 ml of bacteria to the centrifuge tube with 100 mM Tris-HCL l 10, mM EDTA, pH 8.0 (TE) The mixture was heated at 95ºC for 15 minutes, then cooled in ice and centrifuged for minutes at the speed of 14,000 circle/min to separate the DNA solution and stored at -20ºC until use 3.3.5.2 The method of sequencing 16S rRNA gene of bacteria 10 bacterial samples selected isolated from the results identified by the method of 16S rRNA gene sequencing include: B1-6T; B2-5G; B23TT; B6-9TT; A1F1; A1F2; A1F4; A1F6; A1F9; A5F4 The PCR product samples were sent to laboratory NK-Biotek and R & D units of companies Nam Khoa Sequencing products were run electrophoresis sequencing machine ABI 3130XL sequencer 16 capillar The results sequencing of 16S rRNA gene were compared using the program Blast search on the database of NCBI gene bank 3.3.6 The method histopathology The number of samples analyzed, including 127 fish Sampling gill tissue, liver, kidney of healthy fish and fish disease The samples were cut to a thickness of 5-7 mm, and then processed by automated handling machines through stages dehydrate, making the coated sample and paraffin Casting blocks and cut with a thickness of 4-6 μm, to dye the samples by Haematocyline and Eosin (H & E) Read the results by the microscope and based on the document of Ferguson (2006) (cited by Dang Thi Hoang Oanh, 2011) 3.3.7 The method hematology 3.3.7.1 The method analyze blood samples of fish The number of samples analyzed blood samples is 102 fish Blood was taken from the aorta at the tail of fish (Houston, 1990) To spread the blood sample on lame The blood sample after being fixed by soaking in methanol for 1-2 minutes (Rowley, 1990) 3.3.7.2 The quantification of erythrocyte Red blood cells (RBC) are counted by the erythrocyte count chamber at 40X of the microscope The formula for calculating the red blood cell: R = C x 10 x x 200 Notes: R: red blood cell (cells/mm3); C: total hemoglobin count on five areas; 10: spacing lamellae and counting chamber is 0.1 mm; 5: The area of each zone is 0,2 mm2; 200: red blood cell dilution 3.3.7.3 Qualitative and quantitative leukocyte Staining pattern: sample dyeing method Wright's & Giemsa (Humason, 1997 cited by Rowley, 1990) Observation under the microscope at 100X (Supranee et al., 1991) Total leukocytes (TBC) = (Leukemia in 1500 cells x the density of red blood on chamber RBC)/RBC in 1500 on a sample cell dye The density of each type (cells/mm3) = The number of each type of leukocytes x density total leukocytes / 200 3.3.8 The rapid diagnostic method hemorrhage 3.3.8.1 The method of bacterial DNA extraction: (same 3.3.5.1) 3.2.8.2 The method of the kidney tissue DNA extraction Based on the method Phenol chloroform extraction of Taggart et al (1992) (to adjust by Dang Thi Hoang Oanh Dang and Dang Thuy Mai Thy, 2009) to extract DNA fish kidney 3.3.8.3 The method of DNA amplification PCR amplified 16S rRNA gene was performed according to the process of Nunan et al (2003) The molecular weight of the DNA fragments to detect S dysgalactiae is 1500 bp The primer is used in PCR amplification 16S rRNA gene designed by Zinniel et al., (2002) Primer 1: p515FPL 5'-GTGCCAGCAGCCGCGGTAA- ', Primer 2: p13B 5'AGGCCCGGGAACGTATTCAC-3 ' 3.3.8.4 The PCR detected S dysgalactiae PCR using primers STRD-DYI/dys-16S-23S-2 according to Hassan et al (2003): STRD-DYI: "5 'TGGAACACGTTAGGGTCG 3'" 16S-23S-dys-2: "5 'CTTAACTAGAAAAACTCTTGATTATTC 3'" PCR detects S dysgalactiae bacteria based of Hassan et al (2003), the positive control used in PCR detection of bacteria is S dysgalactiae, that was identified by decoding 16S rRNA sequencing is B2-5G 3.3.8.5 The method of electrophoresis Using 10 l PCR products were run electrophoresis on 1.5% agarose gel (ABgene, UK) in the buffer x TAE (10 mM Tris, mM acetate, 0.1 mM EDTA) 3.3.8.6 The method of determining the sensitivity of PCR detected S dysgalactiae 0.5 g kidney tissue of fish mixed bacteria with density 25 ng, 50 ng, 100 ng, 200 ng, 400 ng, 800 ng, 1.600 ng and 3,200 ng used for PCR to detect S dysgalactiae 3.3.8.7 The method of determining the specificity of PCR detection S dysgalactiae Using PCR primers in detecting S dysgalactiae to detect five different types of bacteria including Vibrio parahaemolyticus, Edwardsiella ictaluri, Aeromonas hydrophilla, Streptococcus agalactiae, Flavobacterium columnare The positive control used PCR detection S dysgalactiae, it was identified by decoding 16S rRNA sequencing is B2-5G 3.3.8.8 The applicability of PCR detection process S dysgalactiae The ability to process applications in multiple strains of S dysgalactiae and kidney of fish 3.3.9 The method of antimicrobial susceptibility According to the method of Geert Huy, 2002 3.3.9.1 The method of bacterial recovery Bacteria keeps at -80oC, recovered on TSA (+1.5% NaCl) and incubated at 30°C after 48 hours 3.3.9.2 The method of antimicrobial susceptibility Using pipette 0,1 ml bacteria MHA (+1.5% NaCl) and spread, use pen takes antibiotic into a petri dish Each petri dish paste four antibiotic discs Place the plate in an incubator at 30°C Read the results after 48 hours 3.3.9.3 The methods for determination of minimum inhibitory concentration (MIC) of antibiotics The minimum inhibitory concentration (MIC) of antibiotics on bacteria is determined by the method of Geert Huys (2002) 3.3.10 The method of arrangement laboratory 3.3.10.1 The preparation of experiment Laboratory instruments such as plastic tanks 500 L, 60 L, aeration tubing, racket, pumice stone be cleaned with soap and 200 ppm chlorine, drying Then water is about 2/3 tank, aeration Water supply to 1/3 plastic bucket Water resource use is water salinity 10 ‰ 3.3.10.2 The fish for laboratory Mudskipper are the same size, strong, flexible, light-skin, weight 1520 g/fish The fish are fed in 500 L plastic tanks, aeration of about week Check the health of fish (randomly selected fish) before the experiment 3.3.10.3 The Preparation bacterial infect with fish Bacteria are stored on TSA (+1.5% NaCl) (TSA+), incubated at 28°C Overgrowth, then, bacteria were centrifuged at a speed of 5,000 cycles/min at 4°C for minutes Counting bacterial density by colorimetric spectrophotometer at 610 nm Bacterial solution is diluted 10 times (1 ml of x 109 CFU/ml + ml physiological saline) to be the density of 108, 107, 106, 105, 104, 103 CFU/ml 3.3.10.4 The method arrange susceptibility experiment The experiment infection was random with treatments of strains B1-6T, B2-3TT, B2-5G, B6-9TT injection density is 108 CFU/fish and physiological saline in the control treatment Fish were injected 0.1 ml/fish at the fin Each treatment repeated times with a density of 10 fish/tank After injection, the expression of fish is monitored continuously for days End of experiment, in each treatment shall collect tissue samples (3 fish/treatments) in the organs gills, liver and kidneys 3.3.10.5 The method laboratory determined LD50 Experimentally determined LD50 is completely random using 02 strains B1-6T and B2-5G Fish experiments were injected 0,1 ml/fish Each treatment repeated times with a density of 20 fish/tank Treatment 1, 2, 3, 4, 5, 6, 7: The fish are injected with a density of 102, 103, 104, 105, 106, 107, 108 CFU/fish Treatment 8: control treatment: The fish are injected with saline After injection, the expression of fish is monitored continuously for 14 days The concentration of bacteria lethal to 50% of fish experiment (LD50) was determined according to Reed and Muench formula (1938): LD50 = 10 a – p.d Notes: p.d = (L% - 50%) / (L% - H%) a: The powers at which the bacteria die lowest fish (over 50%) H%: Proportion of the highest mortality (below 50%); L%: Percentage of the lowest mortality (over 50%) 3.3.10.6 The method arrange the experiment treat hemorrhagic in the laboratory - The bacteria that cause infection are B1-6T, injection density is 104 CFU/fish The experimental period was 21 days - Antibiotics: DO and FFC used in experiments are antibiotics of UV company: DO and FFC in the form, materials; DO with the trade name Rydoxyne and FFC with the trade name of the UV-Flo - The drug was mixed into fish food, drug content of 20 mg/kg weight of the fish Feeding on demand The experiment includes treatments, each treatment was arranged 30 fish, repeated times - Fish in treatments 1, 2, 3, are infected the first day and the third day provides food mix with antibiotics Feeding continuously for days Treatment use DO material, treatment uses DO product; treatment use FFC material and treatment 4use FFC product - Treatment 5: Control 1: Fish are infect the first day and food not mix antibiotic - Treatment 6: Control 2: Fish are injected saline and food not mix antibiotic All (100%) mudskipper farmers interviewed not use a settling pond system, farmers not change the water, they just add water (96.7%), chemical processing and microbiology for improving environmental water in the pond e Fish health management Using antibiotics to prevent disease of fish by mixing food and antibiotic to feed during the culture period, the most of the farms use amoxicillin (81.1%), the remaining use other antibiotics (Figure 4.2) Figure 4.2 Using antibiotic in mudskipper farmer in BacLieu 4.1.1.5 The situation of the disease in mudskipper farmer Disease of fish concentrate in months old and hemorrhagic disease (78.9%), ulceration (50%), liver hemorrhage (25,6%) (Figure 4.3) Figure 4.2 Percentage of disease in the mudskipper culture The average mortality rate is 18,04±12,17 (%) (Table 4.5) Table 4.5 The mortality rate The mortality rate (%) ≤ 10 10 – 20 20 – 30 ≥30 Unknown Farmers 25 35 17 12 Rate (%) 27,78 38,89 18,89 13,33 1,11 The survey results showed that most of the fish die concentrate 10% - 20% (38.9%), but the mortality is over 30% also relatively high proportion, accounting for 13.33% Antibiotics are mixed into fish feed periodically There are 81.1% of surveyed households chose amoxicillin mixed into food (2-4 g/kg feed) When fish diseased, they increase the dose (3-5 g/kg feed) fed continuously for 3-5 days 10 4.1.2 The results parasites test on mudskipper The result parasites showed parasite species appear less, mostly parasites of ectoparasites (Table 4.6) Table 4.6 The intensity and rate of infection parasites on mudskipper Parasites Chilodonella Epistylis Trichodina Ergasilus Skin The intensity (Parasites /lame) 8 The rate (%) 27,24 33,33 20 Gill The intensity (Parasites /lame) The rate (%) 33,81 20 There are 04 species of parasites were found with morphology, structure matching the description of Ky Ha and Bui Quang Te (2007) which is Chilodonella, Epistylis, Trichodina and Ergasilus The parasite species in the fish with susceptibility intensity (2-8 parasites/lame) and very low infection rate (20% - 33.81%) With these results demonstrate the presence of parasites not affect fish health 4.1.3 The isolation of bacteria on mudskipper hemorrhagic disease 4.1.3.1 The result of isolated bacteria The results were obtained isolated is 252 colonies, the most of the colonies in the kidneys of fish with 38.1% (Table 4.7) Table 4.7 The number of bacteria Time Organs Kidney Liver Spleen Total 13 15 34 13 17 12 42 6 17 11 0 11 26 30 62 27 23 36 86 Total Quantity 96 90 66 252 Rate (%) 38,1 35,7 26,2 100 4.1.3.2 Morphology, physiology and biochemistry The bacteria are circling, white, size from 0,4 to 0,8 µm/colonies, Gram (+), spherical, diplococcus and streptococcus (Figure 4.4) Figure 4.4 Morphology of bacteria Gram (+) Streptococcus (100X) In 252 strains have 249 strains that are spherical, Gram (+), no mobile, most oxidase negative (231/249 strains) and catalase negative 11 (174/249 strains) The results showed that 15/15 strains not cause hemolysis, 15/15 strains not grow in TSB (+ 6.5% NaCl) (Figure 4.5) Figure 4.5 The results hemolytic and development in TSB (+6,5%NaCl) A: The bacteria not cause hemolysis on 5% sheep blood B: The bacteria not grow in TSB (+6,5%NaCl) 4.1.3.3 The results identified by API 20 Strep kit The results showed that the strain identification 100% positive with Alkaline phosphatase, Leucine aminopeptidase, Ribose, Trehalose, mostly positive with Amygdalin (90.6%), Arginine Dihydrolase (93.7%), βglucuronidase (93.7%) And negative with the remaining (Figure 4.6) Figure 4.6 The result test API 20Strep with B1-6T and B2-5G bacteria 4.1.4 The results bacterial identification by sequencing method Bacteria after decoding conducted comparisons with the data of the NCBI, based on the degree of sequence homology 16S rRNA gene fragment showed that all 10 strains of bacteria are coincident with bacteria strains identified as S dysgalactiae (Table 4.8) Table 4.8 The result compare the degree of sequence homology with the strains of bacteria in the data bank of the NCBI No Notation 10 B1-6T B2-5G B6-9TT B2-3TT A1F1 A1F2 A1F4 A1F6 A1F9 A5F4 The bacteria in the NCBI S dysgalactiae S dysgalactiae S dysgalactiae S dysgalactiae S dysgalactiae S dysgalactiae S dysgalactiae S dysgalactiae S dysgalactiae S dysgalactiae Code in the NCBI KM077497.1 KM077497.1 KM077497.1 KM077497.1 NR043661.1 NR043661.1 NR043661.1 HE858529.1 NR043661.1 NR043661.1 The degree of homology 99% 100% 99% 99% 99% 98% 99% 99% 99% 97% Rate nucleotide homology 1003/1004 1005/1005 996/997 971/972 618/624 537/546 608/612 597/602 573/575 336/345 (http://blast.ncbi.nlm.nih.gov/Blast.cgi) 4.2 Determination of causative agent of hemorrhagic disease in mudskipper 4.2.1 Pathological hemorrhage on mudskipper 12 4.2.1.1 Pathological Muskipper was hemorrhagic disease, they have signs of abnormality as lethargic swimming, pouring edge, not eating, not react or react very slowly Pathological of hemorrhage fish as pale color, bleeding in the body, in fine, tumors in the body, opaque and bulging eyes (Figure 4.7) Figure 4.7 Pathological on the body of mudskipper hemorrhagic disease (A) Mudskipper swim lethargically; (B) & (C): Mudskipper hemorrhagic on the fins and body Viscera of fish wounded, hemorrhage or pale liver, spleen swelled or shrunk and bled, kidney hemorrhage and mushy (Figure 4.8) Figure 4.8 Pathological viscera of mudskipper hemorrhagic disease (A) Fish health (B) Spleen swelling and hemorrhage (C) Liver swelling and hemorrhage (D) Liver hemorrhage, spleen swelling, kidney mushy 4.2.1.2 The results of fresh sample template kidney It was observed that the bacteria attack broke the erythrocyte membrane, concentrated around the wall of red blood cells (Figure 4.9) Figure 4.9 The sample template fresh kidney (Wright & Giemsa, 100X) (A): Kidney of fish health (B): bacteria clustered; (C): Macrophage (D): bacteria attack broke the erythrocyte membrane On the fish health have few or no bacteria when observes sample kidney on a microscope 4.2.2 Histopathological hemorrhage on mudskipper 4.2.2.1 Gill The results showed that 127/127 gill samples of the fish hemorrhagic disease have swelled and adhered fiber fill Gill bled, the fibers adhered and lost the structure of gill, fiber shorten or degenerated, arterial bleed and infected bacteria (Figure 4.10) 13 Figure 4.10 Histopathological gills of mudskipper (H&E, 40X) (A) Gill of fish health: Fiber gills (), lamella gills (); (B) The swell of lamella gills (), the artery infected bacteria (); (C) the fibers adhered and lost the structure of the gill (), the cell increase size () (D) Gills lost the structure 4.2.2.2 Kidney It was observed that mainly hemorrhage, congestive at capillaries and veins, tubular intraluminal fibrosis and dilated, glomerular enlarged, structural changes, and necrosis The phenomenon of congestion in kidney of fish was recorded in most of the samples, phenomena hemorrhage and necrosis or liquefaction necrosis are also found in samples of the kidney fish disease (Figure 4.11) Hình 4.11 Histopathological kidneys of mudskipper (H&E, 40X) (A): the kidney of fish health, tubule (); (B) congested (), macrophage (); (C): Necrosis (); (D): infected bacteria (); (E): glomerular enlarged and structural changes () (100X); (F): congested (), glomerular enlarged and structural changes () 4.2.2.3 Liver The results showed that liver infected bacteria (Figure 4.12E), hepatic, venous congestion (Figure 4.12C), lipid vacuoles enlarged, liver change structure (Figure 4.12E & F) Necrosis liver nearly liquefied, congested areas change into inflamed (Figure 4.12B & D) 14 Hình 4.11 Histopathological livers of mudskipper (H&E, 40X) (A): the liver of fish health, hepatic veins (), lipid vacuoles lipid (); (B) inflammation fluid (); (C): venous liver congestion (); (D) liver cells congested (); (E): liver infected bacteria (), lipid vacuoles enlarged (),change structure (); (F): Liver cells change structure () 4.2.3 Hematological hemorrhage on mudskipper 4.2.3.1 Morphological cell Red blood cells (RBC) of mudskipper are oval or elliptical and the nucleus in the middle Four types of leukemia have been found including lymphocytes, monocytes, neutrocytes and platelets (Figure 4.13) Figure 4.13 The shape blood cells of mudskipper (100X) (A): RBC (); (B): platelet (); (C): monocyte (), platelet (), neutrocyte (), lymphocyte (); (D): monocyte () The sample of blood, fish appears clusters of bacteria and change shape (Figure 4.14) Figure 4.14 The blood of mudskipper disease (100X) (A): Bacteria attact RBC (), (B): Bacteria attact membrane cells ()create space in the cytoplasm () 15 The bacteria attack red blood cells are broken, the cytoplasmic appear more vacuoles or no cytoplasm Besides, all kinds of leukocytes change shape and find four types of leukocytes 4.2.3.2 Red blood cell The number of red blood cells are from 6.8 x 106 CFU/ml to 28.6 x 10 CFU/ml, there is a difference between healthy and hemorrhage fish, erythrocyte of fish disease decreased than fish health, difference statistically significant (P [...]... treatment mudskipper in the pond 23 PUBLISHED PAPERS OF THE AUTHOR 1 Nguyen Thu Dung và Đang Thi Hoang Oanh, 2013 The situation of disease management in midskipper (Pseudapocryptes lanceolatus) in Bac Lieu province Journal of Science, Can Tho University, No 27: 169-177 (in Vietnamese) 2 Nguyen Thu Dung và Đang Thi Hoang Oanh, 2015 Determination of the causative agent of hemorrhagic disease in mudskipper (Pseudapocryptes. .. processing and microbiology for improving environmental water in the pond e Fish health management Using antibiotics to prevent disease of fish by mixing food and antibiotic to feed during the culture period, the most of the farms use amoxicillin (81.1%), the remaining use other antibiotics (Figure 4.2) Figure 4.2 Using antibiotic in mudskipper farmer in BacLieu 4.1.1.5 The situation of the disease in mudskipper. .. as lethargic swimming, pouring edge, not eating, not react or react very slowly Pathological of hemorrhage fish as pale color, bleeding in the body, in fine, tumors in the body, opaque and bulging eyes (Figure 4.7) Figure 4.7 Pathological on the body of mudskipper hemorrhagic disease (A) Mudskipper swim lethargically; (B) & (C): Mudskipper hemorrhagic on the fins and body Viscera of fish wounded, hemorrhage... months of age Some disease in mudskipper is hemorrhage (78.89%), ulcer (50%), abdominal distension (50%), liver disease (25.56%) Amoxicillin was the most popular used antibiotic for disease prevention and treatment - Streptococcus dysgalactiae is agent that cause hemorrhagic disease in mudskipper Characteristic pathological is bleeding fish on the body fin; liver, kidneys and spleen swelling and bleeding... There are 56.7% of surveyed households feeding 2 times/day in the morning and afternoon The weight of food to feed depends on the needs of fish, households should have a continuous feeding of the day (each separated by 2 or 3 hours) (8.89%) (Figure 4.1) Figure 4.1 Frequency of feeding d Management of water quality in the pond 9 All (100%) mudskipper farmers interviewed do not use a settling pond system,... survival rate of fish in fish treatments did not use antibiotics difference statistical significance (P