Hydrogen production by enrichment granules in an acidogenic fermentation process

HYDROGEN PRODUCTION BY ENRICHMENT GRANULES IN AN ACIDOGENIC FERMENTATION PROCESS SHIVA SADAT SHAYEGAN SALEK NATIONAL UNIVERSITY OF SINGAPORE 2007 HYDROGEN PRODUCTION BY ENRICHMENT GRANULES IN AN ACIDOGENIC FERMENTATION PROCESS SHIVA SADAT SHAYEGAN SALEK (B.Sc, Tehran University) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DIVISION OF ENVIRONMENTAL SCIENCE AND ENGINEERING NATIONAL UNIVERSITY OF SINGAPORE 2007 ACKNOWLEDGEMENTS Sincerest appreciation is extended to Prof. NG Wun Jern, my professor, for his patience, encouragement and support during all phases of the project resulting in the completion of this thesis. I would also like to express my gratefulness to my current supervisor Dr HE Jianzhong for her guidance, support and kindness during last year of this project. My special thanks to my senior MUN Cheok Hong for patiently training me laboratory skills, and most importantly to think critically and scientifically. CHENG Dan, TO Priscilla, and FAN Caian have also helped me in many ways. Their friendship and help will always be remembered. Finally, I express my genuine and deepest gratitude to my parents and brothers for their boundless love, encouragement and moral support. I TABLE OF CONTENTS ACKNOWLEDGEMENTS ..................................................................................................................... I SUMMARY ............................................................................................................................................ IV LIST OF TABLES ................................................................................................................................. VI CHAPTER 1: INTRODUCTION .......................................................................................................... 1 1.1 INTRODUCTION ............................................................................................................................. 1 1.1.1 RESEARCH OBJECTIVES ................................................................................................................ 5 1.1.2 HYPOTHESES................................................................................................................................. 6 1.1.3 CHAPTERS IN BRIEF ...................................................................................................................... 7 CHAPTER 2: LITERATURE REVIEW ............................................................................................ 10 2.1 ENERGY SUPPLY AND ENVIRONMENTAL PROTECTION ............................................... 10 2.2 THE TRANSITION TO THE RENEWABLE ENERGY ECONOMY ..................................... 11 2.2.1 HYDROGEN PRODUCTION FROM RENEWABLE ENERGY .............................................................. 11 2.2.2 RENEWABLE ENERGY THROUGH ANAEROBIC TREATMENT TECHNOLOGY.................................. 12 2.2.3 HYDROGEN PRODUCTION FEASIBILITY ....................................................................................... 12 2.3 ANAEROBIC WASTEWATER TREATMENT .......................................................................... 13 2.3.1 IMPORTANT PARAMETERS IN ANAEROBIC TREATMENT .............................................................. 15 2.3.2 TWO-STAGE ANAEROBIC WASTEWATER TREATMENT................................................................ 15 2.3.3 FUNDAMENTALS OF ANAEROBIC TREATMENT ............................................................................ 16 2.4 FUNDAMENTALS OF THE FERMENTATIVE PRODUCTION OF HYDROGEN ............. 21 2.4.1 INSTABILITY OF HYDROGEN PRODUCTION AND COMPOSITIONS OF BACTERIAL COMMUNITIES WITHIN A DARK FERMENTATION ......................................................................................................... 24 2.4.2 PRETREATMENT CONDITIONS TO SCREEN HYDROGEN PRODUCING BACTERIA FROM THE MIX CULTURE ............................................................................................................................................. 28 2.4.2.1 Heat-treatment ................................................................................................................... 29 2.4.2.2 Acid/Base Treatment .......................................................................................................... 30 2.4.2.3 Lack of Carbon Source....................................................................................................... 31 2.4.2.4 Methanogen Inhibitors ....................................................................................................... 31 2.5 FERMENTATION PROCESS THROUGH GRANULATION .................................................. 31 2.6 GRANULE MICROSTRUCTURE................................................................................................ 32 2.6.1 FORMATION OF LAYERED MICROSTRUCTURE ............................................................................. 32 2.6.1.1 Biogranules with Layered Microstructure ......................................................................... 36 2.6.2 FORMATION OF UNIFORM MICROSTRUCTURE ............................................................................. 36 2.6.2.1 Biogranules with uniform microstructure .......................................................................... 37 2.6.3 HYDROGEN PRODUCTIVE GRANULES ......................................................................................... 37 2.6.3.1 Microstructure of Hydrogen-Producing Granule .............................................................. 38 CHAPTER 3: MATERIAL AND METHODS.................................................................................... 39 3.1 REACTOR CONFIGURATION.................................................................................................... 39 3.2 GAS COLLECTION SYSTEM...................................................................................................... 41 3.3 SUBSTRATE PREPARATION ..................................................................................................... 41 3.4 START-UP AND MONITORING BIOREACTOR OPERATION ............................................ 44 3.4.1 SEED SLUDGE ............................................................................................................................. 44 3.4.2 MONITORING BIOREACTORS PERFORMANCE .............................................................................. 44 3.4.2.1 pH ....................................................................................................................................... 44 3.4.2.2 Solids .................................................................................................................................. 45 3.4.2.3 Gas Composition ................................................................................................................ 46 II 3.4.2.4 Volatile Acids ..................................................................................................................... 46 3.4.2.5 Total Organic Carbon ........................................................................................................ 47 3.4.3 MICROBIAL ANALYSIS ................................................................................................................ 47 3.4.3.1 Scanning Electron Microscopy (SEM) ............................................................................... 47 3.4.4 MOLECULAR MICROBIAL DIVERSITY ANALYSIS ........................................................................ 48 3.4.4.1 DNA Extraction .................................................................................................................. 48 3.4.4.2 Polymerase Chain Reaction. .............................................................................................. 48 3.4.4.3 Terminal-Restriction Fragment Polymorphism analysis. .................................................. 49 CHAPTER FOUR: RESULTS AND DISCUSSION .......................................................................... 50 4. SAMPLING AND RESULTS ........................................................................................................... 50 4.1 OPTIMIZE THE ANAEROBIC H2 PRODUCTION ................................................................... 50 4.2 CULTURE ENRICHMENT (PRE-TREATMENTS AND START UP) .................................... 50 4.2.1 INITIAL HEAT TREATMENT .......................................................................................................... 51 4.2.2 ACID TREATMENT....................................................................................................................... 51 4.2.2.1 Enhancement pH ................................................................................................................ 51 4.2.2.2 Cultivation pH .................................................................................................................... 51 4.3 BIOLOGICAL HYDROGEN PRODUCTION MEASURED IN BATCH ANAEROBIC RESPIROMETERS AFTER HEAT TREATMENT ......................................................................... 53 4.3.1 BIOLOGICAL HYDROGEN PRODUCTION MEASURED IN ASBR AFTER HEAT TREATMENT ........... 60 4.4 BIOLOGICAL HYDROGEN PRODUCTION MEASURED IN ASBR AFTER LACK OF CARBON SOURCE TREATMENT.................................................................................................... 61 4.5 MICROBIAL SHIFT ...................................................................................................................... 65 4.6 DYNAMIC CHANGES DURING ONE CYCLE OF ASBR ....................................................... 68 4.7 CHARACTERISTIC OF ENRICHED ACIDOGENIC GRANULES ....................................... 70 4.7.1 SIZE (AVERAGE GRANULE DIAMETER) DISTRIBUTION AND SETTLING VELOCITY ...................... 70 4.7.2 MORPHOLOGY AND MICROSTRUCTURE OF GRANULES ................................................................ 71 4.8 BIOLOGICAL HYDROGEN PRODUCTION MEASURED IN UASB WITH ENRICHED GRANULE ............................................................................................................................................. 76 CHAPTER FIVE: CONCLUSIONS AND RECOMMENDATIONS .............................................. 78 5.1 APPLICATION AND CONTRIBUTION OF THIS RESEARCH ............................................. 78 5.2 CONCLUSIONS .............................................................................................................................. 78 5.3 RECOMMENDATIONS FOR FURTHER RESEARCH............................................................ 79 BIBLOGRAPHY ................................................................................................................................... 81 III SUMMARY Energy supply and environmental protection are two crucial issues for sustainable development of today's world. Among renewable energies, hydrogen produced by biomass is a completely carbon-free fuel with a high energy yield (122 kJ/g), and considered a feasible alternative to fossil fuels. Harvesting hydrogen by fermentation process has attracted many researchers in recent years. This study demonstrated acidogenic sludge (pH 5.5) could produce hydrogen and also granulate in an anaerobic sequencing batch reactor (ASBR) fed with synthetic wastewater containing glucose with 6.7h hydraulic retention time (HRT) at ambient temperatures. Optimization, enrichment, and stability of the acidogenic granular sludge have been investigated at a constant loading rate of 25 g-glucose/ (L.d). Results showed that hydrogen in the biogas increased from 15% to 48% by subjecting the biomass to a combination of heat-treatment, acidic pH, and carbon source limitation. The maximum hydrogen, yield, and production rate was 73%, 2.5 molH2/mol glucose, and 0.34 molH2/d, respectively. Microbial analysis indicated that enrichment by granulation was successful and microbial diversity changed significantly after treatments. The ASBR was operated for 445 days. The hydrogen producing granules were characterized. A typical matured granule was 1.7mm in diameter with an average of 43 m/h settling velocity. Moreover, as morphological analysis demonstrated, the inner and outer surface of the granules was comprised the same types of bacteria and hence had non-layered structure. A hydrogen producing granule had multiple cracks on the surface. The acidified effluent comprised volatile fatty acids (VFA) and alcohols. The VFA comprised acetate (73%), butyrate (23%), propionate (1.5%), caproate (0.69%), valerate (0.58%). Key words: acidogenic, hydrogen, granule, glucose, synthetic wastewater IV LIST OF FIGURES FIGURE 1.1............................................................................................................................................... 4 FIGURE 1.2............................................................................................................................................... 5 FIGURE 1.3............................................................................................................................................... 9 FIGURE 2.1......................................................................................................................................... 2020 FIGURE 2.2........................................................................................................................................... 333 FIGURE 2.3........................................................................................................................................... 355 FIGURE 3.1......................................................................................................................................... 4040 FIGURE 4.1........................................................................................................................................... 522 FIGURE 4.2........................................................................................................................................... 533 FIGURE 4.3........................................................................................................................................... 555 FIGURE 4.4. .......................................................................................................................................... 577 FIGURE 4.5........................................................................................................................................... 599 FIGURE 4.6......................................................................................................................................... 6161 FIGURE 4.7......................................................................................................................................... 6262 FIGURE 4.8......................................................................................................................................... 6364 FIGURE 4.9......................................................................................................................................... 6768 FIGURE 4.10....................................................................................................................................... 6970 FIGURE 4.11....................................................................................................................................... 7071 FIGURE 4.12....................................................................................................................................... 7172 FIGURE 4.13......................................................................................................................................... 734 FIGURE 4.14......................................................................................................................................... 744 FIGURE 4.15......................................................................................................................................... 745 FIGURE 4.16. ........................................................................................................................................ 755 FIGURE 4.17......................................................................................................................................... 766 FIGURE 4.18......................................................................................................................................... 777 V LIST OF TABLES TABLE 2.1. ............................................................................................................................................. 14 TABLE 2.3 .......................................................................................................................................... 2727 TABLE 2.4 .......................................................................................................................................... 3434 TABLE 3.1 .......................................................................................................................................... 4242 TABLE 3.2 .......................................................................................................................................... 4343 VI Chapter One Introduction Chapter 1: Introduction 1.1 Introduction Decreasing fossil fuel reserves, global warming, and the need for energy efficiency has attracted many researchers to work on hydrogen production. There has been some 200 publications related to fermentation hydrogen production from wastewater and solid wastes by mixed cultures over the past three decades [1]. The reason for this attraction is because wastewater treatment is one of the vital areas in our well being. In addition, the production of hydrogen gas from wastewater makes wastewater treatment more economical. Hydrogen gas shows promise as a non-polluting fuel since it produces water instead of green house gases when combusted [2]. Furthermore, hydrogen has a high-energy yield (122 kJ/g) that is about 2.75 times that of hydrocarbon fuel [3]. Despite the "green" nature of hydrogen as a fuel, it is still primarily used from non-renewable sources such as fossil fuels via steam reforming [4], which indicates that bio-hydrogen production from photosynthetic or fermentative routes using renewable substrate has not become economically and technically feasible yet. Fermentative hydrogen is usually produced from the break-down of sugars during anaerobic glycolytic. Pyruvate driven from various substrate catabolismes, such as glycolysis could be the source of the majority of microbial hydrogen production. This compound can be broken-down and catalyzed by "pyruvate formate lyase" (first reaction) and "Pyruvate ferredoxin oxidoreductase" (second reaction) enzymes [5]. 1 − ( PFL) Pyruvate + CoA → acetyl − CoA + formate − − CH 3COCOO + CoA → CH 3CO + CoA + HCOO (1.1) − 2 − Pyruvate + CoA + 2 Fd (or ) → acetyl − CoA + CO2 + 2 Fd (red ) (1.2) 1 Chapter One Introduction As shown in equitation 1.1.1, Acetyl-CoA from pyruvate break-down can be the source for Adenosine 5'-triphosphate ATP and either formate or reduced ferredoxine (Fd (red)), can be the source for hydrogen [6]. Generally, from the pyruvate metabolism one or two hydrogen molecules can be produced which constitutes a relatively low yield. According to Hallenbeck (2005), there may be several reasons for this low productivity. The produced formate from pyruvate (equation 1.1) is further broken down to H2 and CO2 by hydrogen lyase complex under acidic conditions only when the formate concentration is high. Therefore, under most conditions which the formate concentration is not enough high in the environment, the degradation of formate is incomplete which leads to less than stoichiometric hydrogen production. In addition, fermentation has been optimized by evolution to produce cell biomass, methane and carbon dioxide. Thus, hydrogen is only a by-product of the anaerobic fermentation. Besides, in many organisms the actual yields of hydrogen production decrease by hydrogen recycling due to the presence of uptake hydrogenases1, which consume a portion of the hydrogen produced. An additional factor that may reduce hydrogen productivity is the fact that in mixed acid fermentation, the mixed cultures present in the environment may lead to other fermentation end products. A typical fermentation might yield lactate [7], ethanol [8], acetate, formate, H2, CO2, succinate and butanediol. Some of these reactions lead to a decrease in the reducing power of pyruvate for hydrogen production and some others are hydrogen consuming reactions. As a result, even though the maximum possible yield of hydrogen from the enteric-type fermentation of glucose is two mol of H2 per mole of glucose, actually only about one-half of this amount is observed. 1 Hydrogenase is an complex enzyme carries out chemical reversible reaction of : 2 H + + 2e − ↔ H 2 2 Chapter One Introduction Other than enteric-type fermentation, a different pathway of fermentation is typified by those carried out by clostridia. These species can break down the pyruvate by pyruvate:ferredoxin oxidoreductase (PFOR), generating reduced ferredoxin and acetylCoA (figure 1.1). Through this reaction several solvents such as acetone, butanol, butyrate and ethanol could be produced. Little or no hydrogen is produced during production of these solvents. The maximum theoretical yield for these fermentative processes is calculated at 4 mol of H2 per mole glucose [9]. The origin of this higher amount is by the action of NADH:ferredoxin oxidoreductase which recycles the NAD and produces Fd (red) which can in turn to drive hydrogen evaluation [10]. However, the reduction of hydrogenase enzyme by NADH is an energetically unfavorable reaction and it can only be completed at very low partial pressure of hydrogen. In natural environments the very low partial pressure can be obtained from very active hydrogen consumption provided by methanogenesis. Nevertheless, in laboratory experiments researchers have tried to decrease the hydrogen partial pressure by sparging of gases such as nitrogen. From the facts presented, the main natural limitations of hydrogen production process can be highlighted as: Overall yield for hydrogen productions is one or two molecules of hydrogen per molecule of pyruvate which is considered low production. The reduction of hydrogenase by NADH is an energetically unfavorable reaction and it only proceeds at very low partial pressure of hydrogen, below 10-3 atm, when the free energy change is negative. Typical fermentation process might yield lactate, ethanol, acetate, formate, butanediol, succinate and other solvents to receiver NADH. Production of these solvents decreases the hydrogen production yield. 3 Chapter One Introduction 2 Ferredoxin (oxd) Glucose 2 NAD 2ADP 2 NADH 2 Ferredoxin (red) 2 ATP 2 Pyruvate 2 Fd (oxd) H2 ase 2 Fd (red) 2 Acetyl-CoA 2 CO2 2ADP 2 ATP 4 H2 2 Acetate Figure 1.1 Hydrogen production by clostridia carrying out acetate fermentation [6] The presence of methanogenesis in mixed anaerobic cultures which consume the hydrogen. According to these natural limitations, it is impossible or difficult to go against the natural approach to obtain higher yield of hydrogen production. In order to overcome these limitations, many researchers have applied controlling methods such as: • Repeated heat treatments were used to screen hydrogen productive species with the ability of sporulation during unfavorable conditions and to sustain high hydrogen production in long-term experiments [11 and12]. • Vacuum, vigorous stirring, immobilizing cells and nitrogen gas sparging was utilized to decrease the hydrogen partial pressure inside the reactor [13 and14]. 4 Chapter One • Introduction Operating under thermophilic condition to increase the entropy term and as a result promote the reduction of hydrogenase enzyme by NADH which is energetically an unfavorable reaction [6]. • Aeration, addition of toxic chemical, operation at a short HRT to wash out them, and operation at low pH to inhibit the activity of hydrogen-consuming methanogenesis [15]. These controlling methods, as shown in figure (1.2), can be both energetically and economically intensive. Figure 1.2 Natural limitations of hydrogen production and its control parameters 1.1.1 Research Objectives The intention of this study was to optimize hydrogen production as well as avoiding the controlling methods by enriching the biomass by subjecting it to a combination of acid treatment, heat treatment and lack of carbon source treatment. These biomass treatments make use of special property of hydrogen productive species, which is sporulation during unfavorable conditions, to screen them from other species. The enriched cultures resulted from these treatments were examined in a batch and continuous approach by an anaerobic sequencing batch reactor (ASBR) and up-flow anaerobic sludge blanket (UASB) to study the stability of hydrogen production. 5 Chapter One Introduction The procedures discussed as controlling methods, to overcome the natural limitation of hydrogen production are both energy consuming and costly. Therefore, the aim of this study was to avoid these controlling methods and as result obtain sustainable and economical hydrogen production. The proposed idea in this research was supported by four theoretical facts as follows: 1. Sludge can be treated to form hydrogen-productive granules [16]. 2. Granules can be retained because of superior settling characteristics [17 and18] and since, low HRT favors hydrogen productivity; therefore this characteristic of granules can be beneficial for hydrogen production. 3. Hydrogen producing Clostridium and bacillus are able to produce endospores in harsh conditions such as heat, chemical toxicity, lack of carbon source, ultraviolet, ionizing radiation, Acid/base conditions, and Desiccation [19]. 4. Granules treating carbohydrates have layered structure [20]. The overall objective of this study is to optimize and stabilize the hydrogen production by granule enrichment. The following specific studies were conducted to achieve the overall objective: 1. Optimize and stabilize the anaerobic H2 production through enrichment of granular culture by acid treatment, heat-treatment, and lack of carbon source. 2. Characterize the SBR hydrogen producing granules. 3. Comparison of the hydrogen production stability of the enriched granule between the batch and continuous approach. 1.1.2 Hypotheses 1. Make use of special property of Clostridium and Bacillus species inside the granules (sporulation in harsh conditions), to screen them from other species inside 6 Chapter One Introduction the mixed culture through acid treatment, heat treatment and lack of carbon source treatment . 2. Afterwards, retain only the granules inside the sequencing batch reactor by special properties of granules which possess higher settling velocity. 1.1.3 Chapters in Brief The following flowchart (Figure 1.3) summarized the complete research plan. As shown in the flow chart, first of all, the sludge collected from a local anaerobic digestion was subjected to heat and acidic treatment to enrich the culture towards hydrogen production and to induce sludge granulation. The enriched culture obtained from the treatments was activated in an ASBR using synthetic wastewater. After the lag time, the 10 liter reactor was operated at pH 5.5, and HRT of 6.66 hours. The reactor performance was monitored through several parameters such as suspended solid, gas production, gas composition and volatile fatty acids concentrations. These parameters were analyzed by equipments such as GC-FID, GC-TCD and spectrophotometer. Microbial analyses such as T-RFLP and SEM were conducted after the ASBR reached the steady state. After reaching the steady state, data was analyzed to determine hydrogen production yield and rate. In order to optimize the hydrogen productivity of granules, heat and lack of carbon source treatment is applied to the culture after reaching the steady state. After each treatment, the performance of the reactor is determined and the data collected from the reactor running, is analyzed for hydrogen productivity. Finally, the hydrogen production stability of the enriched culture is compared in a continuous approach by UASB and a batch approach by an ASBR for stable hydrogen production. . 7 Chapter One Introduction Hydrogen Production by Enrichment Granules in an Acidogenic Fermentation Process Seed from anaerobic digestion treatment Heat treatment Acidic treatment Enriched culture Synthetic wastewater Lag period and start up Constants: pH: 5.5 Ambient temperature V: 10L HRT: 6.7 h Operating the reactor Equipments: • GC-FID • GC-TCD • pH controller • Water displacement method • Phenol-sulfuric acid method with UV • Programmable Logic Controller (PLC) Monitoring the performance of anaerobic sequencing batch reactor (ASBR) based on: • H2 , CO2, CH4 and N2 composition • Effluent analysis, VFA • Mass balance • Suspended Solids • Gas production rate • Glucose concentration Continued in next page 8 Chapter One Introduction Reach the quasi steady-state Equipments: SEM Light microscope Microbial community studies: Morphological analysis T-RFLP Data analysis Determine: H2 production yields H2 production rate Apply enrichment treatments 2- Lack of carbon source treatment 1- Heat Treatment Data Analysis Determine: H2 production yields H2 production rate Determine the stability of the resulted culture in continues and batch reactors SBR UASB Monitoring the performance Study the stability Figure 1.3 Experimental Protocol 9 Chapter Two Literature Review Chapter 2: Literature Review 2.1 Energy Supply and Environmental Protection Energy supply and environmental protection are two crucial issues for the sustainable development of today's world. At present, fossil fuels provide over 80% of the energy consumption of the world [21]. There are different predictions regarding fossil fuel depletion. Nevertheless, it is definite that fossil fuels will eventually become depleted in the near future. Furthermore, burning these fuels contributes to climate change and environmental pollution [22]. Hence, many studies have been conducted on alternative energy sources. Having taken into account the ever-growing demand for energy, it seems inevitable to seek a sustainable energy source. Contrary to fossil fuels, renewable energy is energy derived from resources that are regenerative and cannot be depleted [23]. Therefore, renewable energy sources are fundamentally different from fossil fuels, and do not produce as many greenhouses gases and other pollutant as does fossil fuel combustion. Various kind of renewable energies such as wind, water, and solar energy had used traditionally. However, because of the threats of climate change due to pollution and the exhaustion of fossil fuels there are many other suggestions as renewable energies. These include biofuel (liquid biofuel, biodiesel [24], ethanol, solid biomass [25] and biogas), geothermal energy [26], geo-energy, nuclear energy, and hydrogen fuel are some examples from on-going natural processes. Energy sources that could maintain our standard living without causing adverse affects to the environment includes wind, solar, and biomass, among others, these three will arguably be the best sources in the future [27]. 10 Chapter Two Literature Review 2.2 The Transition to the Renewable Energy Economy From the facts presented previously, it is easy to see that there is enough renewable energy in the world to satisfy our needs. Many technologies are available and some of these technologies cost more than others. It seems the only question that remains is when we will make the transition to a new renewable energy economy. The current political powers in most countries seem to prefer to continue with the fossil fuel energy infrastructure. This results in high demand for oil and gas and violent circumstances in Middle East where most oil is. The concern is how much time must pass before we arrive with our new renewable energy infrastructure? Do we have to wait until all the fossil fuel resources depleted and then face the problem? How many more years of increasing greenhouse gas emissions and rising energy prices can the world sustain? 2.2.1 Hydrogen Production from Renewable Energy Amongst renewable energies presented in section 2.1, hydrogen obtain from biomass is a completely carbon-free fuel with a high combustion enthalpy (185 kJ L-1) and is considerable a feasible alternative to fossil fuels. With technology for hydrogen as fuel for transportation already well established [14], a solution for energy supply and mitigating global warming could be achievement of a hydrogen economy where the hydrogen gas is produced by renewable energy. For more than three decades, researchers have been trying to produce hydrogen from various sources. Throughout these studies, different amounts of hydrogen have been obtained. However, there has not been an efficient, simple, robust and most importantly affordable method found, both from an investment capacity and operating costs of point of view. 11 Chapter Two Literature Review Hydrogen has a great potential for use as primary or secondary energy source for chemical synthesis or for electrical storage and generation with fuel cells [28]. 2.2.2 Renewable Energy through Anaerobic Treatment Technology Wastewater treatment can be a possible source of energy, since; anaerobic treatment of wastewater can produce methane as well as hydrogen. These gases can generate energy by combustion or via fuel cells. Biogas is considered a traditional energy. Unreliable evidence indicates that biogas was used for heating bath water in Assyria during the 10th century BC and in Persia during the 16th century AD. However, methane was first known as having useful and profitable value in England, where a particularly designed septic was used to generate gas for the purpose of lighting in the 1890s [29]. There are also reports of successful methane production units around the world, and many farmers wonder if small scale methane production units can be set up at their farms to convert manure and waste into energy [30]. Recent interest in the use of anaerobic treatment at sewage treatment facilities is increasing, as anaerobic treatment reduces the ultimate volume of bio-solids needing disposal by 50-80 percent. In addition, during anaerobic treatment, methane or hydrogen is produced which has energy value, and the residual bio-solids can be safely used as a humus-rich compost if it is low in heavy metal content. 2.2.3 Hydrogen Production Feasibility Biomass obtained from different sources can have various hydrogen productions depending on the kind and concentration of carbohydrates present in the biomass. Generally, the most common products in the fermentation of carbohydrates are acetate and butyrate. This acidification process may be expressed by following reactions: 12 Chapter Two Literature Review C 6 H 12 O6 + 2 H 2 O → CH 3COOH + 2CO2 + 4 H 2 (2.1) C 6 H 12 O6 → CH 3 CH 2 CH 2 COOH + 2CO2 + 2 H 2 (2.2) As shown in the equations, the stoichiometric yields are 4 moles of hydrogen per mole of glucose in the production of acetic acid (maximum theoretical hydrogen), and 2 mole of hydrogen in the production of butyric acid. However, several volatile fatty acids and alcohols such as propionate, hexanoate, ethanol, and butanol can be as fermentation products during hydrogen production process. H2 can readily be produced from a range of biomass materials. However, without substantial improvement, most yields are probably too low to be practically useful. As an example, Antonopouluo et al. (2007) had produced 10.4l hydrogen per kg of sorghum biomass [31] The demand of hydrogen as a new clean energy source is rapidly increasing. Therefore, low-cost technology for bio-production of hydrogen is being developed in many countries. Improving bio-hydrogen-producing capacity and reducing cost is the key to achieve industrialization. The microbiological conversion of organics into hydrogen is comparatively inefficient (15-30% efficiency). However, hydrogen gas has an advantage of high conversion rate (90%) of gas to electricity. Therefore, hydrogen production from wastewater is a relatively feasible option since the market value of hydrogen gas is nearly 20 times higher than methane gas. In all cases, the overall efficiency from waste to electricity via hydrogen gas remains relatively low (is 1 kW-h every kilogram of biodegradable waste) mainly due to the low efficiency in the fermentation step [32]. Table (2.1) has shown hydrogen production cost and amount of energy used from various kinds of biomass sources. 13 Chapter Two Hydrogen from Biomass Dairy Manure Ag Residues Wood Waste Energy Crops MSW Landfill Gas Literature Review H2 Number of H2 H2 Production Potential FCVs Cost (Q-Btu) Supported ($/lb) Technology Anaerobic Digestion 0.0068 278,208 1.04 Gasification 0.0007 28,639 1.20 Gasification 0.0164 670,971 1.20 Gasification 0.0040 163,651 1.23 SMR 0.0100 409,129 1.10 SMR 0.0071 290,481 1.17 H2 Cost wo/Taxes ($/gal gas equivalent) H2 Cost w/Taxes ($/gal gas equivalent) 1.06 1.22 1.22 1.26 1.12 1.20 1.56 1.72 1.72 1.76 1.62 1.70 Table 2.1 Cost of the Hydrogen Technology from various Biomass Sources. Notes: * Biomass data from Directed Technologies, 2003, DOE Grant No. DE-FG0199EE35099. * Fuel Cell Vehicle (FCV) * SMR = Steam Reformation; Ag = Agriculture; MSW = Municipal Solid Wastes. * The average fuel economy of FCVs is assumed to be 25 mi/lb H2. * A pound of H2 = 51,500 Btu; a gallon of gasoline = 115,500 Btu; (both at net heating value). 2.3 Anaerobic Wastewater Treatment Louis Pasteur was the first scientist to discover anaerobic organisms during his research on fermentation microorganisms in 1861 [33]. In 1881, Mouras' Automatic Scavenger used anaerobic microorganisms to treat waste for the first time [34 and35]. Currently, anaerobic digestion is an established technology for the treatment of wastes and wastewater. Anaerobic treatment is applicable for a wide range of users, from industry to farming, waste-treating companies, water boards and individual farms or households. The technology is widely applied in industry, especially in the food and beverage and pulp and paper industry, particularly for wastewater treatment. Throughout time, studies and experiments has shown various advantages and disadvantages of anaerobic treatment. The rationale and interest in the use of an anaerobic treatment process can be explained by considering the advantages and disadvantages of this system [36]. One of the important advantages of anaerobic process is that, this process can be net energy producer instead of energy user. In addition, some of the advantages of these systems are as follows; they have lower 14 Chapter Two Literature Review biomass production, fewer nutrients requirement, rapid response to substrate addition after long period without feeding and finally they can use high volumetric loading rate and therefore, smaller reactor volume and less space is required for treatment [37]. Potential disadvantages also exist for anaerobic process such as longer start-up time to develop necessary biomass inventory, may require alkalinity addition to adjust the pH, biological nitrogen and phosphate removal is not effective, the process is sensitive to the adverse effect of lower temperatures on reaction rates, potential for production of odors and corrosive gases and may require treatment with an aerobic treatment process to meet discharge requirements. According to these advantages and disadvantages, this process is beneficial for treatments of specific wastewaters. 2.3.1 Important Parameters in Anaerobic Treatment The complexity of anaerobic wastewater treatment, relative to the microbial consortia and reactions involved, specify that certain parameters have particular significance for process control and system stability. These parameters include the reactor environment and operational parameters. The environmental parameters include: temperature, pH, alkalinity, volatile acids, ammonia, sulfate, toxic metals, salts and inhibitory intermediate products [38]. The operational parameters included solids concentration (MLSS), solids retention time (SRT), food to microorganisms ratio; (F/M) ratio, organic concentration and loading rate, and hydraulic retention time (HRT) [39]. The current study has attempted to pay attention to environmental and operational parameters for the particular anaerobic reactors used. 2.3.2 Two-Stage Anaerobic Wastewater Treatment Hydrogen and methane production can be easily linked, using a two-stage process. The first stage is designed for the initial fermentative/acidogenic degradation. During these 15 Chapter Two Literature Review processes hydrogen could be recovered. The second stage is for the subsequent acetogenic/methanogenic degradation of the intermediate fatty acids. This process would require longer hydraulic detention times and would produce methane gas [40]. The two processes could theoretically be separated by controlling pH and hydraulic detention times [41]. Although two-stage anaerobic treatment systems have been used, none have yet been designed or operated at full scale for hydrogen production and recovery [42]. The present study has focused on the acidogenic process which is the initial stage of the complete process of fermentation. The degradation process is not accomplished by only acidogenic process; therefore, chemical oxygen demand (COD) removal is not completed by acidogenic process. The process should be continued by acetogenic/methanogenic degradation in a separate reactor to achieve high COD removal. 2.3.3 Fundamentals of Anaerobic Treatment Organic molecules can be degraded by aerobic or anaerobic reaction. In aerobic degradation free molecular oxygen is used while, in anaerobic degradation there is no free molecular oxygen involved. If the degradation of glucose (C6H12O6) occurs with free molecular oxygen, the degradation is referred to as aerobic respiration. Aerobic respiration occurs in the aerobic tank of an activated sludge process and it results in the production of bacterial cells (sludge), carbon dioxide, and water. C 6 H 12 O6 + 6O2 → 6CO2 + 6 H 2 O (2.3) There are four important forms of anaerobic degradation of organic molecules that occur at wastewater treatment plants. These four are nitrate reduction (denitrification), sulfate reduction, methanogenesis (methane production), and fermentation [43]. 16 Chapter Two Literature Review Nitrate reduction commonly take places in an anoxic selector, denitrification tank, and a secondary clarifier and it can be completed by facultative anaerobic bacteria. Nitrate reduction results in the production of bacterial cells (sludge), carbon dioxide, water and molecular nitrogen. − C 6 H 12 0 6 + 4 NO3 → 6CO2 + 6 H 2 O + 2 N 2 (2.4) Sulfate reduction results from obligatory bacteria. Sulfate reduction typically occurs in an anaerobic digester. However, this reaction also occurs in sewer systems, secondary clarifier and a thickener if the settled solids remain too long in theses treatment units without the presence of oxygen and nitrate. Bacterial cells, carbon dioxide, water, sulfide, and different kind of organic compound, mostly acids and alcohols can be produced by sulfate reduction. 2CH 3 CHOHCOOH + SO4 2− + H + → 2CH 3COO − + 2CO2 + 2 H 2 O + HS − (2.5) Methanogenic bacteria can produce methane through two pathways. The major route is from acetate by aceticlastic, methane-forming bacteria. Another way of methane production is the reduction of carbon dioxide by hydrogen-oxidizing, methane forming bacteria. This route results in the production of bacterial cells, methane, and water. CH 3COO − + H 2 → CH 4 + H 2 O + OH − (2.6) 4 H 2 + CO2 → CH 4 + 2 H 2 O ( 2. 7 ) The fermentation reaction differs according to the sugar being used and the product produced. If the sugar is glucose (C6H12O6), the simplest sugar, the product can be 17 Chapter Two Literature Review ethanol (C2H5OH). This is one of the fermentation reactions carried out by yeast, and it can be applied in food production. C6H12O6 → 2C2H5OH + 2CO2 + 2 ATP (Energy Released:118 kJ/mol) (2.8) Glucose undergoes glycolysis as it is degraded. At the end of gylcolysis two molecules of pyruvate (CH2COCOOH) are produced. One pathway to degrade pyruvate is through fermentation to volatile fatty acids such as acetate, alcohols such as ethanol and gases such as hydrogen and carbon dioxide [44]. One more pathway is through methanogenesis. Fermentation is a process of energy production in a cell compounds with no free molecular oxygen, carbon dioxide or sulfate. Typical examples of fermentation products are ethanol, lactic acid, and hydrogen. However, more compounds can be produced by fermentation, such as butyric acid and acetone. The ratio of these VFA changes with different feedstock, although typically acetate is the major product [45]. Fermentation requires the use of an organic molecule to remove the electrons from the degrading compound; furthermore fermentation is an inefficient process, and it releases little energy to the bacteria [46]. The reason is most of the energy released by the degraded compound remains in the fermented products. This process normally occurs in an anaerobic digester, but it may also take place in sewer systems, a secondary clarifier, or a thickener. Fermentation can be completed by both facultative anaerobic bacteria and strict anaerobic bacteria and can occur by many different pathways with many different products. The types of organic compounds produced during this process are dependent on the type of bacteria and the existing operational conditions. 18 Chapter Two Literature Review In many of the fermentative pathways, hydrogen is produced. The production of hydrogen gas is important in anaerobic digesters because, hydrogen is one the main substrates for the production of methane and also hydrogen pressure may inhibit the acetogenic bacteria. Strict anaerobic bacteria are more important than facultative bacteria in fermentation process. Bacteroides, Bifidobacteria, and Clostridium are some examples of these strict anaerobic bacteria. There are two important groups (which are the concern of this study) of fermentative bacteria: the acidogenic bacteria and the acetogenic bacteria. The acidogenic bacteria or acid-formers such as Clostridium convert simple sugars, amino acids, and fatty acids to organic acids, alcohols, acetone, carbon dioxide, hydrogen, and water. Several of these compounds are volatile and malodorous [47]. In addition, some of these compounds can be used directly by methane-forming bacteria, while other compounds can be converted to compounds that can be used by methane-forming bacteria. Acetogenic bacteria produce acetate and hydrogen that can be used straightforwardly by methanogenesis bacteria. Acetogenic bacteria convert several of the fatty acids that are produced by acidogenic bacteria to acetate, hydrogen and carbon dioxide. 19 Chapter Two Literature Review Insoluble, complex organic substrates HYDROLYSIS PHASE 1 Soluble, simple organic substrates ACID AND ALCOHOL PRODUCTION Organic acids and alcohols PHASE 2 ACETOGENESIS Acetate, carbon dioxide, hydrogen METHANOGENESIS PHASE 3 Methane Figure 2.1 Biological phases of anaerobic degredation As shown in figure (2.1) there are three basic biological phases that occur in municipal anaerobic digesters with respect to methane production. According to Thiele (1991), [48], and Henze (1983), [49] three major biological reaction steps are involved in anaerobic treatment. These are hydrolysis, fermentation/acetate production, and methanogenesis. During hydrolysis fermentative organisms break down more complicated and large organics to simpler compounds. Afterward, during fermentation products of hydrolysis are converted to organic acids, alcohols, carbon dioxide, and 20 Chapter Two Literature Review hydrogen by syntrophic acetogenic bacteria. During the next stage of fermentation, most of the acids and alcohols are converted to acetate. Finally, during methanogenesis, methane-forming bacteria covert carbon dioxide, hydrogen, acetate and several others limited substrate to methane gas. The anaerobic treatment process is therefore a complex reaction and a given anaerobic reactor requires the presence of the right microbial consortium which must live in a dynamic state for a successful system operation. It is obvious that species diversity is a source of difficulty on process control and failure of anaerobic reactors. These problems are only overcome if there is a balance in the species population [50]. 2.4 Fundamentals of the Fermentative Production of Hydrogen From the facts presented in previous section, hydrogen can be produced during acidogenic and acetogenic phases of the process of anaerobic treatment. Therefore, the possible reactions, which are supposed to occur in hydrogen productive reactors are hydrolysis, acidogenesis and acetogenesis. Hydrolytic bacteria and fermentation: According to Novaes (1986), [51], most organic wastes contain carbohydrates, lipids and protein. The function of the hydrolytic bacteria is to reduce the high molecular weight organics to low molecular weight substances. Specifically, they produce enzymes which hydrolyze organic compounds such as cellulose, hemicellulose, pectin, starch (polysaccharides) and others into smaller molecular weight materials such as monosaccharide. As Daniels (1984), [52] stated the hydrolytic bacteria include obligate anaerobes like clostridium, bacteroides, ruminococcus, and butyrivibrio species and facultative anaerobes such as escheichia coli and bacillus species. Acidogenic/Acetogenic (syntrophic) bacteria: Several studies have reported on the acid forming phase of anaerobic treatment. This attraction is because of the importance 21 Chapter Two Literature Review of the acid forming phase is important in overall anaerobic treatment as well as its role in the formation of granules. Subsequently, the degradation of organic acids is performed by the acetogenic bacteria. That is, the acetogenic bacteria oxidized hydrolytic fermentation products to acetate and other fatty acids. This group of bacteria, which have also been studied by Bryant (1979), [4], includes both facultative and obligate microbes that can ferment organic molecules larger than acetic, such as butyrate and propionate, in addition to compounds larger than methanol to hydrogen and acetate. The acetogenic bacteria can be grouped into two categories depending on whether H2 is produced (H2-producing acetogens) or hydrogen is consumed (homoacetogens). The H2-producing acetogens exist in a syntrophic association with H2-utilizing bacteria. H2-producing can grow only in an environment with extremely low partial pressure of hydrogen in the reactor (as explained in chapter one). This low partial pressure can be naturally provided by methanogenesis. One explanation for the dependency of the H2-producing bacteria on the methanogens has been presented by Bryant (1979), [4] which is summarized in Table (2.2). 22 Chapter Two Literature Review A. Propionate-catabolilzing acetogenic bacterium − CH 3 CH 2 COO − + 3H 2 O → CH 3 COO − + HCO3 + H + + 3H 2 = +18.2 Kcal/reaction B. Butyrate-catabolizing acetogenic bacterium CH 3 CH 2 CH 2 COO − + 2 H 2 O → 2CH 3 COO − + H + + 2 H 2 = +11.5 Kcal/reaction C.H2-utiliziing methanogenic bacterium − HCO3 + 4 H 2 + H + → CH 4 + 3H 2 O = - 32.4 Kcal/reaction D. SUM A+C Syntrophic association − 4CH 3CH 2COO − + 3H 2O → 4CH 3COO − + HCO3 + H + + 3CH 4 = - 24.4 Kcal/reaction E.SUM B+C syntrophic association − 2CH 3CH 2CH 2COO − + HCO3 + H 2O → 4CH 3COO − + CH 4 + H + = - 9.4Kcal/reaction Table 2.2 Stoichiometry and the change of free-energy for catabolism of propionate and butyrate by H2-producing acetogens and H2-utilizing methanogens [4]. Table (2.2), has showed that the catabolism of propionate to acetate, CO2 and H2 (reaction A) and the catabolism of butyrate to acetate and H2 (reaction B) would not 23 Chapter Two Literature Review proceed alone because of the highly positive free-energy for both reactions (4). However, the H2-prutilization reaction by methanogens (reaction C), would proceed because of its highly negative free-energy. Therefore, when the H2-producing acetogenic bacteria are placed in syntrophic association with the H2-utilizing bacteria (sum of A+C, and sum of B+C), then the combined reactions (reactions D and E) become energetically favorable [4]. According to Daniels (1984), for the reactions to favor H2- producing bacteria, which is with a negative free energy, the H2 partial pressure must be less than 10-3 atm for the use of butyrate and 10-4 atm for the use of propionate. That is, propionate acetogenesis is more sensitive to H2 partial pressure than butyrate acetogenesis. 2.4.1 Instability of Hydrogen Production and Compositions of Bacterial Communities within a Dark Fermentation One of the key problems researchers have faced on the subject of hydrogen production is to have stable hydrogen production over a long term period. The average biogasproduction rate, hydrogen percentage, bacterial density, volatile fatty acids and alcohols productions are registered as steady-state values. Normally when the variation is less than 10% it is considered to be steady-state [51]. As studies have shown, under non-sterile conditions, the culture will shift from "H2 producing bacteria" to "hydrogen consuming bacteria" such as methanogenesis or "hydrogen producer's competitors" such as acetogens, propionate, and lactate producers. However, by using controlling methods to inhibit hydrogen consuming bacteria and hydrogen producer's competitors such as heat treatment and acid/base treatment it is possible to achieve stable hydrogen production. However, there has not yet been a promising solution to maintain this stable state, for long term. As an example, the heat-shocking process produced a stable inoculum for biogas production. 24 Chapter Two Literature Review Van Ginkel (2005) used the same heat shocked repeated five times over a 30-days period produced an average of 262 ± 24 mL of biogas with no apparent trend in gas production [53]. There has been a range of periods reported before reaching the steady-state operation. As Liu and Fang (2002) have stated, pseudo-steady state operation has been reached in 14-21 days in various HRT (between 4.6 to 28.8 days) [54]. Moreover, according to Lin and Chaia-hong (2003), it took 44days for the reactor to reach stable performance with HRT of 12h, and the stable reactor performance lasted for 13 days [55]. The reason for this short period of steady-state is that there are several reactions take place inside the mix culture. A number of these reactions lead to hydrogen production and others may result in hydrogen consumption. Optimum H2 yield should be achieved with acetate as the fermentation end product. However, in practice, high H2 yields are usually related with butyrate production, and low yields with the production of propionate, and reduced end products such as alcohols and lactic acid. Some Clostridia species such as C. butyricum produce predominantly butyrate. On the other hand, C. propionicum types produce mainly propionate. Vavilin et al. (1995) [56] gave the overall equation for the production of propionate from hexose, showing that the reaction involves the consumption of H2: C 6 H 12 O6 + 2 H 2 → 2CH 3CH 2 COOH + 2 H 2 O (2.8) To obtain higher amount of hydrogen production, propionate production should be avoided. According to Vavilin et al. (1995) the limiting substrate for butyrate production is glucose, while the limiting substrate for propionate production is hydrogen, and the two groups of microorganisms producing these end products are in balance in the microbial consortium. Since, C. propionicum is a non-spore former 25 Chapter Two Literature Review bacteria; therefore, it can be inhibited by heat treatment of the inoculum and as a result may assist in biasing the community towards hydrogen production. In addition, Cohen et al. (1985), [57] demonstrated that irregular feeding rate (a 2 h daily interruption of supply) to a reactor inoculated with un-pasteurized activated sludge strongly selected for non-spore forming propionate-formers. The culture which had previously produced butyrate and H2 after a one-off cessation of the feed supply for 6h, or regular feed interruption for 1h per day gave similar shifts in product formation, thought to be related to a population shift away from butyrate/H2 producing spore formers and towards propionate producing non-spore formers. The semi-continuous feeding mode used in some studies at laboratory scale, thus gave poor performance comparing to feeding in continues mode. Also, under continuous operation, it is possible that a short process disturbance commit the spore-formers irretrievably to sporulation, and the spore-forming population may be then depleted by wash-out if the HRT is short, even though normal feeding is quickly resumed [58]. All these factors affected hydrogen production stability by a mix culture. Chang (2004) has reported that the steady-state operation can be maintained for 20 days at the HRT of 0.5h with the average hydrogen production rate and yield boosted to 9.72 L/h/L, 3.89 mol-H2/mol-sucrose, respectively [59]. Another study by Nanqi Ren et al. (2003) has revealed that after 33 days stable conditions could be obtained. Gas production rate was 24.96 L/d during stable condition. However, after day 21, gas production rate and fermentation products decreased and there were significant changes in the composition of the products. The ratio of butyric acid within total products drastically decreased from 974.5 mg/L to about 500 mg/L, whereas the ratio of propionic acid gradually increased from 179.6 mg/L to 547.1 mg/L. Such changes suggested the conversion of the metabolic pathway of the microbes within the reactor. 26 Chapter Two Literature Review When the system stabilized again after day 33, the average concentration of ethanol, acetic acid, propionic acid, butyric acid and valertic acid were 847.5 mg/L, 868.3 mg/L, 553.7 mg/L, 402.6 mg/L and 214.2 mg/L respectively, which presented a mixed acid fermentation [60]. Table (2.3) has summarized results regarding the steady-state conditions. Time taken to reach Duration that Author Year the steady state (d) steady state lasted HRT Jiunn-Jyi Lay, [61] 2000 60 - - Herbert H.P. Fang et al. 2001 60 - 6h H. Liu and Herbert Fang 2002 14-21 - 4.6-28.8 days 44 13 days 12h Chiu-Yue Lin and 2003 Chaia-hong Jo Ea-San Chang 2004 33 - - Nanqi Ren 2003 33 - - Table 2.3 Different studies' comparison on steady state condition for hydrogen production The complex nature of consortia in H2 producing microf1ora and the existence of shifts in population are now being demonstrated using genetic techniques. Pertu E. P. Koshkinen et al. (2006), [62] has studied microbial community composition dynamics during glucose fermentation in a fluidized bioreactor (FBR). According to his work the prompt onset of H2 production was due to the rapid growth of Clostridium butyricum (99-100%) affiliated strains after starting continuous feed. The proportion trend of C. butyricum in FBR attached and suspended-growth phase communities coincided with H2 and butyrate production. To summarize, after screening the H2 productive bacteria by using their special property of sporulation during harsh conditions the hydrogen productivity increased. 27 Chapter Two Literature Review However, after this stage the new bacterial community will be activated and bacterial community diversity increased and as a result the composition of the microbial pathways will also change to different VFA and alcohols. Consequently, hydrogen productivity decreased inside the reactor and cause instability. Several solutions have been suggested to disclose this undesired phenomenon as mentioned. 2.4.2 Pretreatment Conditions to Screen Hydrogen Producing Bacteria from the Mix Culture There is a need to use mixed cultures that are present within the natural environment in order to have more practical wastewater treatment. Additionally, processes using mixed cultures are easier to operate and also they are able to have a wider choice of feedstock [63]. However, these mixed cultures can be used as long as hydrogen consumption by methanogens and other bacteria are inhibited through seed sludge pretreatment such as heat-treatment, acid/base inhibitors, and lack of carbon source treatment [64]. These pretreatments could be applied before start-up of the reactor operation while there are other inhibitors such as, hydraulic retention time (HRT), temperature and pH which are applied during reactor's operation [65 and 66]. Seed sludge pretreatments are achieved by relying on the spore-forming characteristics of the hydrogen-producing Clostridium [19]. These kinds of bacteria have an ability to produce spores in harsh environments such as high temperature, desiccation, lack of nitrogen and carbon source, chemical toxicity, acidic or basic conditions, aeration, ultraviolet and ionizing radiation. When favorable conditions return, the spores become vegetative cells [67 and 68]. The purposes of all these pretreatments are to suppress as much hydrogen-consuming bacterial activity as possible while still preserving the activity of the hydrogen-producing bacteria [19]. Each of these inhibiters has their own advantages and disadvantages. Present study has 28 Chapter Two Literature Review tried to apply the most economical and common pretreatments on the sludge which are heat-treatment, acid treatment and lack of carbon source treatment. 2.4.2.1 Heat-treatment In 1977, Alexander has used the characteristic of Clostridium species, which is sporulation in harsh conditions such to screen them from non-spore forming species [69]. Heat treatment has been the most common treatment to screen of hydrogen producing bacteria [1]; the reason could be because of, the quick and inexpensive practice. However, heat treatment practice has a number of disadvantages, the process requires energy for heating and because of anaerobic condition it is difficult and energy consuming to heat the anaerobic biomass inside the reactor. In addition, Oh, et al. (2003), has reported that heat treatment could not inhibit the activity of all hydrogenconsuming bacteria such as homoacetogenic bacteria [62]. This kind of bacteria may survive the heat treatment, and consume hydrogen for the production of acetate, and therefore, the overall hydrogen production decreases. Lastly, repeated heat treatment is required to sustain hydrogen production over long term experiments. To be more precise, germination of a spore involves three steps: activation, germination and outgrowth. Heat treatment is one way to start spore germination. Germination of spores is considered a rapid process, which generally takes 60 to 90 minutes [70]. A number of parameters affect spore germination such as incubation, pH, prior heat treatment, and reducing conditions [66]. Moreover, sporulation takes 6 to 8 hours in most spore-forming species [70]. Naturally the duration depends on environmental conditions and the kind of spore-forming bacteria. 29 Chapter Two Literature Review In this study, heat treatment of the inculumn was employed as one of the methods to increase hydrogen production by inactivation of non-spore forming hydrogen consuming microorganisms. 2.4.2.2 Acid/Base Treatment There are two kinds of selection by pH, enhancement pH and cultivation pH. The first one is applied for short term period and it selects the species which can survive after such high or low pH. Second enrichment however, is a long term practice which chooses the kind of bacteria with the ability to tolerate this pH during reactor operation [71]. The current study has applied both enrichment techniques. Chang et al. (2002), [72] have reported a great increase in hydrogen yield after treating the sludge with acid and base treatment for about 24h. This increase of hydrogen is because; the hydrogen utilizing methanogenesis were killed or inhibited during the enrichment. However, clostridia remain in the culture by producing spores during the enrichment [73]. Endospores are very resistance to acid and base because of their complex, multilayered structure which is structurally different from vegetative cells [19]. According to Zhen-Peng Zhang et al. (2006), [74] there is a rapid formation of granules in an anaerobic reactor by acid incubation for 24h by shifting the culture pH from 5.5 to 2.0. The same concept has been used for this study to form granules inside the ASBR. Based on numerous experiment results, the optimum cultivation pH value for acidogenic hydrogen production is around 5.5 [12 and 75]. Both enhancement pH and cultivation pH could be very effective in increasing hydrogen production. 30 Chapter Two Literature Review 2.4.2.3 Lack of Carbon Source As mentioned in section (2.4.2) lack of nitrogen and carbon source is considered as unfavorable conditions which activate spore germination [65 and 66]. However, sporeforming bacteria enrichment is not commonly achieved through lack of carbon source. However, one of the advantages of this practice is that it is economically favorable since no energy input is required [54]. 2.4.2.4 Methanogen Inhibitors Since, methanogens are very sensitive to sudden pH variations, chemical toxicity, oxygen and heat, therefore, inhibition of these species is achievable. Forced aeration has been used by Ueno et al, (1995) and results showed that 330-340 ml H2/g hexose could be produced without production of methane gas [76]. Moreover, 2-Bromoethanesulfonate (BES) is considered as a methanogen inhibiter. Use of BES at concentrations up to 25 mM reported to be effective to inhibit the methanogenesis and thus increasing hydrogen production [77]. Although, BES is an analog of the coenzyme in methanogen and thus is very specific against methanogens [78], however, Koskinen et al. (2006), [60] has reported BES in batch-culturing resulted in low diversity of Clostridia and did not eliminate all H2 consumers. 2.5 Fermentation Process through Granulation The advantages of granulation process through reactor are biomass enhancement, increase of reactor efficiency in organic removal, and increase of methane production has discovered by numerous studies. However, studies on the application of granular sludge processes for anaerobic hydrogen production only began in recent years. These studies have shown a superior potential of hydrogen productivity by granules as compared to suspended sludge system [79]. Understanding the mechanisms of 31 Chapter Two Literature Review granulation process is necessary to for improve reactor design and performance [80 and 81]. Due to the absence of initial cores for cell attachment, microbial granulation is preceded with a selfadhesion or aggregation of microbial cells [82]. This process thus can be defined in terms of energy involved in the interaction of cell to cell and is governed by the surface physicochemical characteristics of microbial cells. In a thermodynamic sense, microbial sludge stability is governed by a charge balance among several repulsive forces which include electrostatic, salvation (hydration) and steric forces, and attractive forces including van der Walls, short range hydrogen bonds, and electrostatic forces [83]. Some physicochemical models therefore, have been proposed, as an example, secondary minimum adhesion model [84], extracellular polymers (ECPs) bonding model [85], and inert nuclei model [18]. The granulation of microbial cells is a complicated process, in which biological, microbiological and hydrodynamic factors are also involved other than physicochemical forces. For example, different models and hypotheses based on aforementioned factors have been proposed for anaerobic granulation, including structural models, proton translocationdehydration theory, cellular automaton model and cell-to-cell communication model The formation and mechanisms of conventional granulation of anaerobic sludge in UASB reactor have been well documented [86]. 2.6 Granule Microstructure 2.6.1 Formation of Layered Microstructure During anaerobic degradation, complex substrates are converted by fermentative/acidogenic bacteria into volatile fatty acids (VFA), which are further converted by acetogens forming bacteria to acetate, prior to formation of methane by methanogens. The rate of each step depends on the concentration of the reactants, bacterial species, and a number of environmental parameters, such as pH and 32 Chapter Two Literature Review temperature. In the cases where the initial step of the substrate degradation is significantly faster than the subsequent degradation of the intermediates, most of the substrates are consumed by bacteria near the bio-granule surface. The concentration of intermediates would build up, causing them to diffuse toward bio-granule interior, due to concentration gradients, leading to further degradation. As a consequence, the biogranule develops a layered structure, where the outer layer is mainly responsible for the rapid initial step of substrate degradation and the inner layer(s) for the subsequent degradation of the intermediate (figure 2.2). Figure 2.2 Effect of degredation kenetics on biogranule microstructure [85] Table (2.4) summarizes the maximum specific substrate rate of enrichment culture at 35 °C for a number of substrates. Propionate was converted to acetate at the rate similar to the subsequent conversion of acetate to methane. Acetogenesis of butyrate was however twice as fast. On the other hand, carbohydrates, including glucose, sucrose and starch, were converted to VFA at rates about 5-10 times faster than acetotrophic methanogenesis. 33 Chapter Two Reaction Literature Review substrate Max Reference SSUR Acetotrophic methanogenesis Acetate 4.8 Zenhder, et al (1980) Acetotrophic methanogenesis Acetate 6.8-13.1 Lawrence and McCarty (1969) Acetotrophic methanogenesis Acetate 4.4-11.6 Noike, et al (1985) Acetogenesis Propionate 6.2 Gujer and Zehner (1983) Acetogenesis Propionate 8.2-12.2 Lawrence and MaCarty(1969) Acetogenesis Butyrate 16.6 Lawrence and MaCarty(1969) Fermentation of carbohydrate Glucose 72 Zeotemeyer, et al. (1982) Fermentation of carbohydrate Sucrose 71 Noike, et al (1985) Fermentation of carbohydrate starch 40 Noike, et al (1985) Table 2.4 Maximum substrate utilization rate at 35°C (g-COD/g.VSS.d), [87] Fang et al (1995) studied the degradation of butyrate in a UASB reactor and confirmed that acetotrophic methanogenesis was the rate-limiting step [88]. This was also reflected on the two-layered microstructure of butyrate-degrading biogranules. Most of the butyrate was readily converted to acetate in the outer layer, while the acetate produced was allowed to diffuse to the interior before methanogenesis could take place. Li et al. (1995), based on some interesting observations, suggested that benzoate degradation is a two-step process [89]. Bacteria such as Syntrophus buswelli, rapidly converted benzoate inside their cells directly into acetate, which is subsequently converted to methane by methanogens at a slower rate. Like those degrading butyrate, benzoate-degrading granules also exhibited a two-layered microstructure. 34 Chapter Two Literature Review Figure 2.3 Structure of carbohydrate treating granules [85] In the degradation of carbohydrates, the rate-limiting step is the acetotrophic methanogenesis [46], as shown in Table (2.4) the initial acidogenesis of carbohydrate took place rapidly at the outer layer; the intermediate VFA, including butyrate and propionate, degraded at lower rate, and diffused to the interior of the biogranule. These intermediates are then degraded by acetogens in the middle layer forming acetate. Since the methanogenesis step is rate-limiting, the acetate diffused toward the biogranule centre where methanogenesis took place. As a result, carbohydratedegrading biogranules develop a three-layered microstructure. 35 Chapter Two Literature Review The thickness of the outer layer, where fermentation and acidogenesis took place, is dependent on the complexity of the carbohydrate. The trend seems to be the more complex the substrate, the thicker the outer layer. 2.6.1.1 Biogranules with Layered Microstructure Biogranules having layered microstructure included utilizing butyrate, sucrose, starch and carbohydrates in brewery wastewater as organic substrates. Among them, butyrate and benzoate degrading biogranules exhibited a two-layered microstructure, while the three carbohydrate degrading ones exhibited a three layered microstructure. As Mu et al. (2006), the outer layer of the butyrate degrading biogranules [79] have a thickness of 20-40 µm . Under epi-flurescence at 350nm and 420nm [90], this layer emitted intense fluorescence due to the presence of hydrogenotrophic methanogens. SEM micrographs showed that this layer packed with micro-colonies composed of two species of bacteria which appeared to be juxtaposed for syntrophic association. The interior composed of uniformly distributes Methanothrix-like bacteria, which emitted much dimmer flurescence [91]. Similar to these degraded butyrate, benzoate-degrading biogranules also exihibited a two-layered microstructure, in which the outer layer was composed of an abundance of Syntrophus buswellii-like [92], which converted benzoate into acetate, whilst the interior was mainly composed of Methanithrix-like filaments. 2.6.2 Formation of Uniform Microstructure Within the process of decomposition of organic compounds the, granules degrading simple substrates or the final stage of the process have simpler structure. As an example, in the degradation of formate and acetate, the substrate was converted into methane in a one-step process, each by a predominant species of methanogen, the bio- 36 Chapter Two Literature Review granules resulting in a simple, uniform microstructure. In addition, these two biogranules were smaller in size comparing to other kind of biogranules. For biogranules degrading substrates of which the initial degradation was slow relative to the subsequent degradation of intermediates, a considerable fraction of substrate would diffuse toward the interior before being degraded. Substrate concentration becomes quite uniform over the biogranule cross-section; as a result biogranules developed a uniform microstructure with even distribution of all sorts of bacteria involved at various stages of degradation. This was the case for the propionate- and peptone- biogranules. For these substrates, the initial steps of degradation, including acetogenesis of propionate [93], hydrolysis of protein [94] and acidogenesis of glutamate, are rate limiting. 2.6.2.1 Biogranules with uniform microstructure Biogranules degrading formate, acetate, propionate and peptone wastewater had a uniform microstructure. Conversions of formate and acetate into methane are one-step process. Biogranules degrading formate and acetate were small, and each had a simple uniform microstructure composing of a predominant species of methanogen. Formatedegrading biogranules were of irregular shape with sizes less than 0.5 mm, were mainly composed of rod-shaped filamentous Methanobacterium formicicum-like bacteria [95]. Acetate-degrading biogranules were also small (less than 1 mm in size): they were predominantly composed of Methanothrix-like filaments and scattered clusters of Methanosarcina-like cysts [91]. 2.6.3 Hydrogen Productive Granules It was found in recent studies that the hydrogen-producing sludge could form granules with high bioactivity [16]. 37 Chapter Two Literature Review The physical characteristic of these kinds of granules has been investigated by measuring the average diameter of the granules and settling velocity. The microstructural characteristics have been analyzed by scanning electron microscopic (SEM), Transmission Electron Microscopy (TEM), and extraction of extracellular polymeric substances. EPS are products of bacteria that accumulate on the bacterial cell surface [96]. They form protective layer for the cells against the harsh external environment, and also provide carbon and energy during starvation. EPS were found to be essential to the flocculation of activated sludge [97 and 98] and to the microstructure of methanogenic granular sludge [99]. EPS are composed of variety of substances, including carbohydrate, protein, humic substances, uronic acid, and DNA. Based on Fang et al. (2002) results, the characteristic of a hydrogen producing granul (HPG) was 1.6+0.2 mm in size, 1.038 g/ml in density, >50 m/h in settling velocity, and 11+1% in ash content. These characters are comparable to methanogenic granular sludge except that the ash content which is lower for HPG [17]. 2.6.3.1 Microstructure of Hydrogen-Producing Granule The structural surface of the HPG as determined by SEM photos is porous with multiple cracks. This kind of structure is likely to facilitate the passage of nutrients and substrate as well as the release of hydrogen, which has a very limited solubility of 1.58 mg/L in water. In addition, as shown in several studies, HPG granule, unlike those of methanogenic UASB granules did not exhibit a layered structure because of the simplicity of the acidogenic process. The microbial species responsible for the formation of hydrogen producing granules is still unclear. 38 Chapter Three Material and Methods Chapter 3: Material and Methods 3.1 Reactor Configuration ASBR and UASB reactors were used for conducting the research. The reactors were identical in all aspects. Photographs of the reactors are shown in plates (3.1.1a) and (3.1.1b). The total reactor volume was 14 L of which 10 L were used as the working (fluid) volume while the remaining 4 liters was head-space. Six ports were installed in the ASBR, and five ports in the UASB for sampling, injecting NaOH, feeding, de-sludge, and decanting. The ports were 9cm long and 0.8cm inside diameter and were made of stainless steel tubes. The top of the reactor was fitted with a plate having the same outside diameter (19.5cm) as the flange of the reactor. The plate and flange were 1cm thick. The plate and flange had eight holes in which threaded rods were used to fasten them. The top plate of each reactor had two more holes. One of the holes was used for biogas removal. The second hole was fitted with 2.5cm inside diameter stainless steel tubing and 37cm long, to secure the pH controller probe. The reactor volumes were calibrated using measured amounts of tap water. Peristaltic pumps were used for the feeding the substrate concentrate, dilution water, and for effluent withdrawal. Three pumps were used for the ASBR and three for the UASB. Dilution water and decant pumps were fitted with size 15 pump heads, while the feeding pumps were fitted with size 13 pump heads. A programmable logic controller (PLC) was used for the ASBR. The substrate concentrate was kept at 4°C before dilution with tap water. Plate (3.1.1c) shows the experimental set-up of the ASBR and UASB system. Mixing was done with USP5402E impellers operated at 100rpm. 39 Chapter Three Material and Methods a UASB pH Controler Decant pump Feed pump b PLC Impeller motor ASBR Feed pump Figure 3.1 a) Up flow Anaerobic Sludge Blanket, b) Anaerobic Sequencing Batch Reactor 40 Chapter Three Material and Methods 3.2 Gas Collection System The gas exits the reactor through one of the holes on the top plate and was conveyed to the gas collector by way of tygon tubing. The top of the water-displacement gas collector had two holes one for connecting to the reactor and the other for venting the gas. A sampling part fitted with a septum allowed for sampling with a syringe. A ruler was attached to outer surface of the gas collector to measure the amount of gas production. The water's pH inside the water reservoir was kept at less than 3 with HCl to reduce carbon dioxide dissolution. 3.3 Substrate Preparation The synthetic feed used for fermentation contained 6.94g glucose/L as the sole carbon source as well as a sufficient amount of inorganic supplements. Properties of the substrate are shown in Table (3.1). Since glucose in the synthetic substrate can be easily degraded; therefore, the substrate concentrate was refrigerated at 4°C. In addition, to obtain a well dissolved and homogenous substrate without any degradation during feeding, the concentrated substrate was autoclaved at 120°C for 20 minutes before refrigeration. As mentioned before (3.1) prior to feeding this concentrated substrate to the reactor it was diluted 74 times with water. Since spore germination, and the granulation process require specific nutrients [100] substrate properties should be selected with care. Magnesium chloride (MgCl2) and calcium chloride are two inorganic supplements required in the process of granulation [77]. Moreover, the hydrogenase enzyme contains a unique, complex nickel-iron center (Ni-Fe); therefore, ferrous chloride (FeCl2) and nickel sulfide (NiSO4) are also 41 Chapter Three Material and Methods considered key trace minerals during hydrogen production [6]. The other minerals are necessary for typical bacteria activities (Table 3.1). Parameter Value (mg/L) Carbon Source Diluted Glucose Concentration 6944 NH4Cl 200 CaCl2.2H2O 50 Trace Minerals KH2PO4 30.47 MgCl2.6H2O 100 MnCl2.2H2O 12.5 Na2MoO4.2H2O 10 FeCl2.4H2O 30 NiSO4 32 Table 3.1 Substrate composition The synthetic substrate concentrate was made up every five days for both the ASBR and UASB reactors. A substrate volume of 5 L was prepared for each reactor and after autoclaving was kept refrigerated over five days. Before reactor feeding the substrate was diluted for SBR and UASB with 74 and 12.48 times with water respectively. Since the organic loading rate (OLR) was high (25g/L.d) for both ASBR and UASB, also the reaction occurring was an acidic reaction, pH can drop. Therefore, sodium hydroxide (NaOH) 1 N was used to adjust the pH. 42 Chapter Three Material and Methods The organic loading based, on the substrate strength and reactors HRT was kept constant at 25 g/d.L for both the ASBR and UASB (Table 3.2). Operational parameters Reactors ASBR UASB HRT (h) 6.7 48 Concentration (g/L) 6.94 12.5 25 25 Organic Loading Rate (g/L.d) Table 3.2 ASBR and UASB operational parameters The volume of substrate fed and decant during 4 hour cycle operation, along with other operational variables are shown in Table (3.3). Operational variables ASBR Number of cycle per day 6 Length of cycle, hours 4 Volume of feed per sequence, liters 6 Volume of feed per day, liters 36 Volume of decanted per sequence, liters 6 Volume of decanted per day, liters 36 Length of feeding time, min 10 Length of react time , min 190 Length of settling time, min 30 Length of decanting time, min 10 Reaction/settling ratio 6.3 Table 3.3 ASBR operational variables 43 Chapter Three Material and Methods 6.7h HRT and 48h HRT were used for the ASBR and UASB operation. The sequencing batch reactor was operated for 519 days, from 13th March 2005 to 15th July 2007, and the UASB from 10th of May 2007, to 10th of July 2007 for 66 days. 3.4 Start-up and Monitoring Bioreactor Operation 3.4.1 Seed Sludge The seed sludge was obtained from a local wastewater treatment plant. The H2producing ability of the sludge was improved via heat treatment of the seed sludge at 80˚C, followed by acid pretreatment, in which the pH of the sludge was adjusted to 3.0 with 0.1 N HCl and was restored to 5 with NaOH afterwards. 3.4.2 Monitoring Bioreactors Performance To determine reactors performance, several parameters were regularly analyzed such as total organic carbon (TOC), gas composition, VFA composition, VFA concentration, and gas production rate. Other analytical parameters were determined less frequently such as morphological analysis of the granules, chemical oxygen demand (COD), alkalinity, and glucose concentration. Granules were morphologically analyzed at the end of the study to determine the hydrogen producing granule characteristics. Optimum temperature for mesophilic hydrogen production was found to be 30°C [101]. The temperature of Singapore, where the experiment was conducted, varied from 24°C to 32°C [109]. In addition, according to Chiu-Yue Lin, anaerobic sewage sludge could be acclimated to produce hydrogen at ambient temperature [102]. Considering the reactor volume of 10 L, low HRT of 6.66 and the reactor configuration, a significant amount of energy is required to bring the reactor 44 Chapter Three Material and Methods temperature up to the optimal mesophilic temperature. Therefore, along with objectives of this study which is to reduce controlling method to increase hydrogen production feasibility, AnSBR was operated at ambient temperature. 3.4.2.1 pH Throughout operation pH was controlled with pH controllers dosing NaOH for both the SBR and UASB. pH measurements were also performed on grab samples using an Alex pH meter. The pH meter was calibrated each time it was used according to standard procedures with pH 4.00, 7.00 and 9.00 buffer solutions. The pH measurements were made immediately after taking the samples from the reactor to minimize the loss of dissolved carbon dioxide. Measurements were made by inserting the pH probe into the sample after rinsing with distilled water and samples. The pH probe was a standard glass membrane-type probe, which was gel-encased. Frequent pH measurements were made to monitor the reactor system, because changes in the pH value, especially towards acidic conditions, indicate a potential imbalance in the reactors. A drop in pH would indicate an accumulation of volatile fatty acids. A drop to pH 3 could inhibit bacterial activities 3.4.2.2 Solids On accordance with Standard Methods [112] the samples were filtered through 9 cm GF/C filter paper. The filter paper was pre-dried and weighed. Pre-drying the filter paper involved ignition at 550˚C for 20 minutes and cooling in a desiccator. The initial weight of the filter paper was recorded after ignition by weighing with a laboratory balance. The samples were then filtered through the filter paper using vacuum filtration. The filter paper with the captured solids was then placed in the oven at 103°C for one hour to dry to constant weight and then cooled in a desiccator to be 45 Chapter Three Material and Methods weighted for the second time. The total suspended solids and volatile suspended solids were calculated using the formula: Total suspended solis, mg / L = B− A Volume of samples, ml Volatile suspended solids, mg / L = B−C Volume of sample, ml (3.4.2.2.1) (3.4.2.2.2) Where: A= Initial weight of filter, mg B= weight of filter after drying in a 103°C oven C= weight of filter after ignition in a 550°C oven 3.4.2.3 Gas Composition The biogas composition was determined by gas chromatography (Shimadzu GC-17A equipped with Thermal Conductivity Detector) on a Porapak N 80/100 mesh column. The column temperature was maintained at 60oC. The temperature for the detector and injection port was maintained at 120oC. Argon was used as the carrier gas. A standard gas having 25% hydrogen, 25% nitrogen, 40% methane and 10% carbon dioxide was used to calibrate the GC for biogas composition. 3.4.2.4 Volatile Acids Analysis of VFA was made by gas chromatography (Shimadzu GC-14B equipped with Flame Ionization Detector) on a 25m x 0.32 mm HP-FFAP fused silica capillary column in accordance with the method described by Yu and Fang (2003). Prior to analysis the samples were acidified to a pH < 2 with methanoic acid [103]. 46 Chapter Three Material and Methods 3.4.2.5 Total Organic Carbon Analysis of total organic carbon was made by Shimadzu TOC-Vcsh, Japan. Hightemperature combustion method was used to measure the total organic carbon (TOC). 3.4.3 Microbial Analysis 3.4.3.1 Scanning Electron Microscopy (SEM) Fang and Chui's (1993) protocol was used for granule sectioning and sample preparation prior to SEM observation [104]. SEM sample preparation protocol: 1. Granules were fixed by soaking in a 0.1 M phosphate buffer solution (pH 7.2) with 4% glutaraldehyde for 2 hours 2. Sliced in half after being frozen with liquid nitrogen 3. Dehydrated with a series of water/ethanol solutions followed by another series of ethanol/carbon dioxide solutions: 30% alcohol-10-15min 50% alcohol-10-15min 70% alcohol-10-15min 80% alcohol-10-15min 90% alcohol-10-15min 95% (2 changes)-10-15min 100% (2 changes)-10-15min 4. Critical point dried with carbon dioxide using a Blazers CPD 030 Critical Point Dryer 5. Mounted on stubs with silver paint 6. Coated with gold-palladium 47 Chapter Three Material and Methods After coat with gold-palladium the sectioned granules were viewed and photographed under SEM. Different magnifications of 50, 75, 100, 350, 1000, 2000, 3500, 5000, and 10000 were used for morphological analysis. This rang of magnification from 50 to 10000 were used because granule's structure, granule's size, bacteria's distribution, and bacteria's morphology were analyzed under SEM. 3.4.4 Molecular Microbial Diversity Analysis The bacterial community of the ASBR and UASB was analyzed by T-RFLP. DNA extraction and PCR are processes prior to T-RFLP as sample preparation. 3.4.4.1 DNA Extraction Cells (1 ml) used for DNA extraction were withdrawn after vigorous shaking from the reactors by 1-ml disposable syringe and needles following the protocol [105] and centrifuged immediately at 10,000 for 10 minutes at 4°C. The cell pellets were stored at -20oC until processing. Genomic DNA was extracted from frozen cell pellets using the DNeasy Tissue Kit (QIAGEN GmbH, Germany) according to the manufacturer’s instructions. Molecular techniques such as polymerase chain reaction (PCR), terminalrestriction fragment length polymorphism (T-RFLP) were used to characterize and identify the genera of current active culture subsequently [106]. 3.4.4.2 Polymerase Chain Reaction. PCR was performed in a total volume of 20 µl by Bio-Rad thermal cycler (Bio-Rad Laboratories, Inc., California) and the products were analyzed on an Agilent Bioanalyzer using DNA7500 Labchip Kit. The initial amplification was performed with a pair of universal Eubacterial primers 8F [5’AGAGTTTGATCCTGGCTCAG3’] and 1541R [5’AAGGAGGTGATCCAGCCGCA3’]) [107]. The following PCR 48 Chapter Three Material and Methods parameters were used for the amplification: 130s at 94º; 30 cycles of 30s at 94º, 45 s at 55º, and 130s at 72º; and a final extension of 6 min at 72º. 3.4.4.3 Terminal-Restriction Fragment Polymorphism analysis. T-RFLP with the restriction enzyme provides an overview of the microbial community composition over time during the enrichment process to estimate the microbial diversity. By using the protocol [108] the amplified fragments by universal primer (8F and 1541R, 8F labeled with Cy5) were digested with the restriction endonucleases Hha I (NEB, USA). The enzyme was deactivated by heating at 65 ºC for 10 min. 49 Chapter Four Results and Discussion Chapter Four: Results and Discussion 4. Sampling and Results The steady state performance of the ASBR could be regarded to quasi steady state. Because the ASBR process is operated in cyclic mode, its steady state condition is quasi. The quasi steady-state are considered to be established when gas quality and total organic carbon concentration of the effluent are stable (less than 10% variation), [55] during 20 days of ASBR operation. The results for the ASBR parameters monitored were obtained under quasi steady state conditions during each operational treatment. However, for UASB reactor steady state conditions were obtained as indicated by constant hydrogen production [53]. 4.1 Optimize the anaerobic H2 production In the beginning of the experiments the performance of the ASBR was optimized by selecting the optimum parameters from other studies on hydrogen production such as pH 5.5, HRT 6.7h, and reaction/settling ratio 6.33 [12, 16, 49, 57 and 74]. The initial biomass concentration was set at 8.8 g/L which increased afterwards because of the granulation. Organic loading rate was selected according to glucose concentrations typically found in the sugary factory processing industry. Since, the reactor is operated in Singapore; therefore, the ambient temperature varies from 22 to 34 °C [109]. 4.2 Culture Enrichment (Pre-treatments and Start up) Prior to reactor start up, two kinds of treatments (heat and acid treatments) were applied to the seed from the anaerobic digestion of a local wastewater treatment plant. 50 Chapter Four Results and Discussion 4.2.1 Initial Heat treatment The wet sludge was heat treated for 20 minutes at 80°C before start up. The reasons for this treatment was to select Clostridium spore-formers from natural environment and pasteurized the activated sludge [58 and110]. 4.2.2 Acid Treatment There are potentially two kinds of pH enrichments, enhancement pH and cultivation pH. 4.2.2.1 Enhancement pH According to Zhang 2006, to induce microbial granulation, the acclimated culture could be subjected to an acid incubation [74]. Microbial aggregation could take place immediately with initiation of acid incubation and granule can be developed rapidly. The same concept had used in this study for granulation. Therefore, the culture after heat treatment was subject to an acid incubation for 24 h shifting the culture pH to 3.0 by HCl. The culture was resumed to pH 5.5 after the incubation and the reactor start operation at hydraulic retention time (HRT) of 6.7 h. Enhancement pH was applied only for short period and it selects the species which can survive in such low pH. 4.2.2.2 Cultivation pH Second enrichment, is a long-term practice which selects the species with the ability to tolerate the specific pH during reactor operation. In the present study, a constant pH of 5.3 was selected to screen acidogenesis culture and suppresses the methanogenesis activity. After 14 days of ASBR operation with stirring rate of 100rpm, granules appeared as shown in figure (4.1). 51 Chapter Four a c Results and Discussion 600µm 300µm b 300µm d 300µm Figure 4.1) Microscopic images of granules after 14 days of ASBR operation. As can be seen in figure (4.1) the granules have a hirsute and squashy structure. The average size of these immature granules was 1.5mm. Before the heat treatment practice the reactor was held at quasi steady state for 42 days. During this period biogas composition was mostly carbon dioxide (83%), with the remaining comprising methane (15%) and a small amount of hydrogen (1.92%). According to Fang 1995, a sludge bed of bio-granules may contain 50 g/L of suspended solids (SS), considerably higher than a suspended sludge [94]. In this study, prior to heat treatment the average suspended solids (SS) concentration was 29 g/L and the maximum concentration was 56 g/L. 52 Gas percentage (%) Chapter Four Results and Discussion 100 90 80 70 60 50 40 30 20 10 0 0 10 20 30 40 50 Time (d) Hydrogen Methane Carbon Dioxide Figure 4.2 Gas composition before heat treatment 4.3 Biological Hydrogen Production Measured in Batch Anaerobic Respirometers after Heat Treatment As mentioned in section 2.4.2, heat treatment could be conducted for granule enrichment. However, resistance of cultures varies due to, the kind of species, and different conditions of age or growth of the culture. Therefore, to find out the optimum temperature and duration of heat treatment for specific culture used in this study, series of serum bottle experiments were conducted. The parameters of these serum bottles such as loading rate, temperature, pH were the same as the reactor which indicated 25g/L.d, ambient temperature and 5.3 respectively. All batch experiments were carried out in duplicates and the experiment was done twice. According to Wesley et al. (1997), it is through the inactivation of one or more essential proteins, such as enzymes, that heat treatment kills a specific microorganism [111]. The amount of heat required to kill varies from one organism to another, in fact for any organism both the amount of heat (i.e., the temperature) to be used and the length of time the material to be sterilized is maintained at a given temperature must be considered. The bacterial 53 Chapter Four Results and Discussion endospores are probably the most resistant form of life known; some will survive 100°C for several hours. There is no standard pattern of heat resistance for endospores, because their resistance varies not only from species to species but under different conditions of age or growth. A number of factors have been regarded as contributing to the heat resistance of spores. Their low water content and thick spore coat are probably the most important factors. Another important factor to be considered with heat sterilization is the environmental of the microorganisms being destroyed. Environment is important for two reasons: (1) in order to kill, the heat must reach the organism, and (2) more heat than normal is required to kill organisms embedded in protein material. Vegetative forms of pathogenic organisms are readily destroyed at the temperature of boiling water. Actually, they are usually killed within a few minutes at 80°C. However; some bacterial endospores show unusual heat resistance and may survive boiling temperature for up to 20h. The killing effect of boiling water is greatly increased by the addition of 2 percent sodium carbonate or detergents. In most cases, heat activation at 75 to 80°C for 15-20 min is used to inactivate vegetative cells and activate germination of spores. These factors were considered to choose various temperatures for serum battle experiment. Five sets of serum bottles with temperatures of 80°C, 100°C, 120°C, 140°C, and control were examined. Serum bottle experimental parameters: • Volume 150 ml • SS the same as the reactor (15g/L) • Loading Rate 25 g/L.d glucose • Experiment duration: 200 h 54 Chapter Four Results and Discussion 120 120 100 G a s p e r c e n t a g e (% ) G a s p erc e n ta g e (% ) 100 80 60 40 20 80 60 40 20 0 0 0 50 100 150 200 -20 250 0 50 100 -20 Hydrogen Methane b Carbon Dioxide 250 Hydrogen Methane Carbon Dioxide 120 120 G a s p e r c e n ta g e (% ) 200 Time (h) Time (h) a 150 100 G a s pe r c e nta ge (% ) 100 80 60 40 20 80 60 40 20 0 0 50 100 150 200 0 250 0 Time (h) c Hydrogen 50 100 150 200 250 Time (h) Methane d Carbon Dioxide Methane Carbon Dioxide G a s C o m p o s it io n ( % ) 100 90 80 70 60 50 40 30 20 10 0 -10 0 Hydrogen 50 100 150 200 250 Time (h) e Hydrogen Methane Carbon Dioxide Figure 4.3 Gas concentration (%) in the vessels head space after heat treatment over time, at a) 80°C, b) 100°C, c) 120°C, and d) 140°C for 25 minutes, e) Control batch experiment without heat treatment As shown in figure (4.3) following by a lag phase of 20.3h for 80°C, 23 h for 100°C, and 25h for 120°C there was gas production for 200h. However, after 200h of 55 Chapter Four Results and Discussion experiment there was no activity in terms of gas production for 140°C. Based on these results, we concluded that biogas production experiments conducted at different temperatures followed the same trend of gas production quality. After the lag time, there was an increase in hydrogen production for a period of 99.7h for 80°C, 49h for 100°C and 47h for 120°C; and afterwards the hydrogen was consumed in 27h, 48h and 75h, respectively (figure 4.3a, figure 4.3b and figure 4.3c). To compare the three batches of 80°C, 100°C, and 120°C, increase of hydrogen per hour were 0.44%, 0.76%, and 0.79% and decrease of hydrogen per hour were also 1.62%, 0.77%, and 0.49% respectively. The same pattern of H2 production followed by hydrogen consumption was reported by other researchers [59]. Beeftinkt and van den Heuvel (1987), [112] reported a similar shift from hydrogen producing process of acetate-butyrate to hydrogen consuming of without performing any community analysis the metabolic shift was suggested to have resulted from changes in the microbial community structure rather than metabolic adaptation. They also showed that differences in bacterial community structures during acetate–butyrate and acetate–propionate dominated metabolisms. These results demonstrate that the instability of H2 production in these batch tests might be due to changes in microbial populations. Oh et al. (2003) found high hydrogen gas concentrations (57-72%) were produced in all batch tests that encountered heat treatment at pH (6.2 or 7.5). However, hydrogen gas phase concentrations in all batch cultures reached a maximum of 57-72% after 30h but thereafter rapidly declined to non-detectable levels within 80h [62]. As can be understood from these results 80°C showed the shortest lag time, which is expected because of the lower temperature applied to the culture; and as a result, more species of bacteria can tolerate 80°C than higher temperatures. In addition, according 56 Chapter Four Results and Discussion to Doyle 2002, in most cases, heat activation at 75 to 80°C for 15-20 min is used to inactivate vegetative cells and activate germination of spores. It means that the diversity of microbial culture remain in the 80°C batch, after heat treatment, was more than other serum bottles encountered to higher temperatures, and thus more species of bacteria are able to consume the hydrogen or produce carbon dioxide. This can be the reason for rapid decrease of hydrogen at 80°C. There was no biogas production recorded for 140°C after 200h. As a result, the experiment was continued for the second batch. The results showed that even though the lag time is long, however, hydrogen productivity could be maintained for a longer duration comparing to previous heat treatments (figure 4.4). Nevertheless, because of long lag time having heat treatment for 140°C does not appear to be a practical option. Methanogenesis was completely inhibited as shown in Figures (4.3a to 4.3d). Gas Composition (%) 100 80 60 40 20 0 0 20 40 60 80 100 120 140 -20 Time (h) Hydrogen Methane Carbpn Dioxide Figure 4.4 Gas concentration (%) after heat treatment over time at 140C for 25 minutes (second batch of feeding). Facts presented can conclude that, although heat treatment affects hydrogen production; however it cannot be the ultimate solution. Although researchers have applied heat treatment to have stable inoculum for biogas in terms of hydrogen production, that is only because they have applied it continuously [51]. 57 Chapter Four Results and Discussion Considering parameters of shorter lag time, longer duration of hydrogen productivity and maximum hydrogen percentage, 80°C had shown optimum results. Consequently, this temperature had also been chosen for one more experimental batch test. These sets of batch tests were conducted to identify the microbial culture responsible for hydrogen production. The batch set included of four duplicate bottles contained biomass of the ASBR. The reason for this experiment was to identify the responsible culture producing hydrogen inside the reactor before further operation of the reactor. Therefore, these four batch tests with same conditions explained before (4.3) were selected, first with separated granules; second with only suspended biomass, third with both granules and separated suspended biomass, and forth with granules and suspended biomass as control test. Afterwards, heat treatment at 80°C for 25 min was applied to all batch tests except the control test, and gas concentration (%) was measured for the duration of 190h. All batch tests were conducted in duplicates. The results of these batch experiments are shown in figure (4.5). 58 Chapter Four Results and Discussion 1.2 a 1 gaspercentage 0.8 0.6 0.4 0.2 0 -0.2 0 50 100 150 200 time (hr) H2 CH4 CO2 1 b gaspercentage 0.8 0.6 0.4 0.2 0 0 50 100 150 200 150 200 -0.2 time (hr) c 1.2 gaspercentage H2 0.8 CH4 CO2 1 0.6 0.4 0.2 0 -0.2 0 50 100 time (hr) H2 CH4 CO2 d 100 80 60 40 20 0 0 50 100 150 200 -20 Hydrogen Methane Carbon Dioxide Figure 4.5 a) Separated granules, b) Separated suspended biomass, c) Granules with suspended biomass after heat treatment at 80°C for 25 min, d) Control batch experiment without heat treatment 59 Chapter Four Results and Discussion As can be seen in figure (4.5), separated granules had shown shorter lag time (42.5h) comparing to suspended biomass (112.5h). However, the lag time for the batch test containing both suspended biomass and granules was the same as separated granules (42.5h). Maximum hydrogen proportion was almost the same among three batch tests which was 45%, and similar to previous batch experiments there was no methane production. Results of these batch tests concluded that both granules and suspended biomass are responsible for hydrogen production. This might indicate that the same species are present in both media. 4.3.1 Biological Hydrogen Production Measured in ASBR after Heat Treatment Subsequent to selecting the optimum heat treatment temperature (80°C for 25 min), the same temperature was applied to ASBR after reaching the quasi steady state. As shown in figure (4.5a), a similar pattern of hydrogen production was also observed in ASBR. Although there was an increase from 2% to 16% in average hydrogen production after heat treatment; however, results confirmed that heat treatment alone, is not the ideal solution to reach the stable hydrogen production. Figure (4.6 b) shows 30 days of quasi steady state by the enriched culture after heat treatment. After applying the heat treatment to ASBR it was followed by a lag time of 3 days the hydrogen proportion in the biogas increased continuously for 13 days, and afterwards during 17 days all hydrogen was consumed. A maximum of 37% hydrogen could be reached after heat treatment. 60 Chapter Four Results and Discussion a 100 Gas percentage (%) 90 80 70 60 50 40 30 20 10 0 0 5 10 15 20 25 30 35 Time (d) Hydrogen Gas Composition (%) b Methane Carbon Dioxide 100 90 80 70 60 50 40 30 20 10 0 0 5 10 15 20 25 30 35 Time (d) Hydrogen Methane Carbon Dioxide Figure 4.6 a) ASBR gas concentration (%) after heat treatment over time, b) ASBR quasi steady state conditions reached after heat treatment 4.4 Biological Hydrogen Production Measured in ASBR after Lack of Carbon Source Treatment Enrichment of the culture was continued towards hydrogen production after reaching the quasi steady state; the culture had encountered lack of carbon source for 20 days. During these 20 days the sludge was starved and then gas samples were taken. Since starvation is economical (no additional energy is required), it was chosen as a novel enrichment method. In addition, after previous treatments the culture had become more enriched, sudden shock may destroy the species which were beneficial for hydrogen production. The lack of carbon source is a smooth and long practice 61 Chapter Four Results and Discussion which gradually maintains the kinds of bacteria with the ability of sporulation during of lack carbon and nutrients. Gas Composition (%) 80 70 60 50 40 30 20 10 0 0 5 10 15 20 25 Time (d) Hydrogen Methane Carbon Dioxide Figure 4.7 Gas concentration (%) after lack of carbon source treatment during start up The hydrogen proportion had significantly changed after the treatment. The average hydrogen concentration (%) increased from an average of 16% to an average of 48% during quasi steady state and the maximum hydrogen concentration (%) was 73%. In addition, high hydrogen productivity could be maintained and methanogenesis was completely inhibited. Comparable hydrogen concentration (%) has reported in other studies. Liu and Fang (2002) reported that, hydrogen accounted for 57% to 68% of biogas at HRT ranging 4.6-28.6h and sucrose concentration ranging 4.8-29.8 g/L during hydrogen production from wastewater by acidogenic granular sludge [52]. Fang et al. (2002) also reported that methane-free biogas comprised 63% hydrogen, 35% carbon dioxide, and 2% nitrogen by acidogenic granular sludge degrading sucrose with HRT of 6h and pH 5.5 [16]. The dominant metabolic products of volatile fatty acids, gas composition, and biomass production were examined during the first 18 days of start up after encountering to lack of carbon source for 20 days. 62 a 30 Suspended solid (g/L) Chapter Four 25 Results and Discussion 20 15 10 5 0 0 5 10 15 20 25 30 35 40 Time (d) b 1.8 Suspended solid (g/L) 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0 0 5 10 15 20 25 30 20 25 30 Time (d) Concentration (mM) c 16 14 12 10 8 6 4 2 0 0 5 10 15 Time (d) Acetate Butyrate Propionate Figure 4.8 a) Suspended solids concentrations in the ASBR, b) Suspended solid concentrations in the effluent, c) Dominant volatile fatty acids concentration in the effluent during star up under the lack of carbon source treatment 63 Chapter Four Results and Discussion According to Nandi and Sengupta 1998, the most common products in the fermentation of carbohydrates are acetate and butyrate. This acidification process may be expressed by following reactions [113]: C 6 H 12 O6 + 2 H 2 O → CH 3COOH + 2CO2 + 4 H 2 (4.1) C 6 H 12 O6 → CH 3 CH 2 CH 2 COOH + 2CO2 + 2 H 2 (4.1) As shown in the equations 4.1 and 4.1, the stoichiometric yields are 4 moles of hydrogen per mole of glucose in the production of acetic acid, and 2 mole of hydrogen in the production of butyric acid. The maximum yield of 2.49 (mol H2/mol glucose) found during start up of this study was resulted both from acetate and butyrate process. During this period VFA content was mostly acetate (54%), butyrate (23%), propionate (20%) and small amount of other VFA's includes 3% (i-butyrate, valerate, caproate, icaproate, i-valerate and heptanoate) in the effluent. In addition, the main alcohol composition was ethanol. On the subject of the suspended solid concentration of the effluent, as shown in figure (4.8 b), during first five days of the start up the concentration was high (~1.6 g/L). The reason was the wash out of the dead microorganisms which could not tolerate the lack of carbon source treatment. However, after 12 days the concentration of biomass in effluent decreased to 0.435 g/L and become more stable. Since, synthetic wastewater was used as feed; therefore, the difference between suspended solid (SS) and volatile suspended solids (VSS) is small and that’s the reason in the graphs VSS has not been shown. At this stage, the Sludge Retention Time (SRT) was calculated as: 64 Chapter Four Results and Discussion Average SRT during startup = MLSS (mg / L) × V ( L) 13450(mg .L) × 10 L = = 8.58d MLSS withdraw rate(mg / L.d ) 36( L / d ) × 435(mg / L) (4.3) Average SRT during the quasi steady state = MLSS (mg / L) × V ( L) 2659(mg.L) × 10 L = = 28.41 d MLSS withdraw rate(mg / L.d ) 36( L / d ) × 260(mg / L) (4.4) The average MLSS of ~27 g/L of the reactor was due to the presence of biogranules inside the reactor. In fact, this factor is a promising feature of the ASBR process that granular biomass can be achieved, and in this way higher biomass can be maintained in the reactor with efficient biomass setting time and a long solids retention time (SRT) [114]. All the MLSS samples were taken during complete mixing of the reactor and prior to effluent withdrawn. 4.5 Microbial Shift As presented in section (4.3) and (4.4) hydrogen productivity increased in terms of gas quality, after conducting each treatment. The possible reasons for a higher hydrogen production after heat and lack of carbon source treatments could be because of population shift or metabolic shift take place in the reactor [56]. A number of experiments can be conducted to confirm the reason. The complex nature of consortia in H2 producing microflora and the existence of population shift can be demonstrated using genetics techniques. Regarding the metabolic shift, fermentation end products vary within the same bacterium dependent on environmental conditions, and by detecting VFA effluent concentrations, the metabolism pathways could be determined. Therefore, to identify the reason of higher hydrogen productivity, genetic techniques and microbial products (VFA and alcohols) could be detected by various methods. 65 Chapter Four Results and Discussion T-RFLP is one of the genetics techniques which had been conducted after heat treatment and also after lack of carbon source treatment. The amplified fragments by universal primer were digested with the restriction endonucleases Hha I (NEB, USA). These results have demonstrated that the microbial population has shifted almost completely after first treatment. However, similar species were observed before and after lack of carbon source treatment and the population has changed. 66 Chapter Four Results and Discussion 25000 a 20000 D y e S ig n a l 370.37 15000 72.39 10000 5000 266.76 369.47 71.38 600.69 581.74 471.24 0 0 50 100 150 200 250 300 350 Size (nt) 400 450 500 550 600 650 700 b 50000 45000 218.03 D y e S ig n a l 40000 35000 30000 25000 72.62 20000 15000 10000 62.99 225.54 566.75 5000 0 0 100 150 200 250 300 350 Size (nt) 400 450 500 550 600 650 c 30000 25000 D y e S ig n a l 50 63.03 20000 15000 10000 266.56 5000 72.69 573.09 550.45 581.79 218.18 0 0 50 100 150 200 250 300 350 Size (nt) 400 450 500 550 600 650 Figure 4.9 T-RFLP results, a) Before heat treatment, b) After heat treatment, c) After lack of carbon source treatment 67 Chapter Four Results and Discussion 4.6 Dynamic changes during one cycle of ASBR The elucidation of the dynamic changes during one cycle is helpful in understanding how the biological process occurs inside sequencing batch bioreactor. Figure (4.10) shows the dynamic changes in organic matter (TOC), biomass (SS), VFA, gas quality and gas production during one cycle in the system at HRT of 6.7 h with R/S ratio of 6.33. The monitoring of the variation in substrate concentration showed that glucose was completely degraded within first 15 min of operation. As the reaction phase started, the total carbon and total organic carbon decreased and the total VFA concentration increased as shown on figure (4.10). 68 Chapter Four a Results and Discussion Concentration (mM) 80 70 60 50 40 30 20 10 0 0 20 40 60 80 100 120 140 160 140 160 Time (min) Acetate Gascoposition (%) b Butyrate Ethanol 60 50 40 30 20 10 0 0 20 40 60 80 100 120 Time (min) Hydrogen Carbonconcentration(mg/L) c Methane Carbon Dioxide 2500 2000 1500 TOC TC 1000 500 0 0 20 40 60 80 Time (min) GasProductionVolume(ml/min) d 60 50 40 30 20 10 0 0 5 15 25 60 120 150 180 Time (min) Figure 4.10 Evolution of (a) VFA concentrations, (b) Gas concentrations (%), (c) Carbon Concentrations, (d) Gas production rates at each cycle operation 69 Chapter Four Results and Discussion During one cycle VFA includes of acetate (73%), Butyrate (23.6%), propionate (1.5%), caproate (0.69%), valerate (0.58%), and very small amounts of i-caproate, ivalerate heptanoate, and i-butyrate. The concentration increased in the first 60minutes. In addition, during one cycle the gas production concentrations (%) remain constant. However the amount of hydrogen production rate varies during the cycle and the maximum hydrogen production rate were during first 20minutes (53ml/min). 4.7 Characteristic of Enriched Acidogenic Granules Throughout the enrichment process, physical, morphological and biological characteristics of the acidogenic granules were modified. However, in this chapter the main focus is on the characteristic of the enriched granule after both heat and lack of carbon source treatment. 4.7.1 Size (Average granule Diameter) Distribution and Settling Velocity The Hydrogen Producing Granule (HPG) had an average diameter of 1.7 ± 0.2mm. the maximum granule diameter inside the reactor was 3.5mm. It exhibited an average settling velocity of 43m/h, which was comparable to reported velocities for the methanogenic granules. For each size three samples were examined and the average size was taken. R2 = 0.9422 100 Settling Velocity (m/h) 90 80 70 60 50 40 30 20 10 0 0 0.5 1 1.5 2 2.5 3 3.5 Diameter of the Granules (mm) Figure 4.11 Granules settling velocity 70 Chapter Four Results and Discussion According to figure (4.11), there is a correlation between the diameter of the granule and settling velocity rate. As shown in the figure 4.11 larger granules settle faster than the smaller ones. Therefore, larger granules lead to shorter settling time and as a result can improve the reactor performance. 4.7.2 Morphology and Microstructure of granules Analysis of light microscopic shown that prior to treatments, granules were brown in color; however, after enrichment the HPG became creamy white in color. The reason of this change in color is due to suppression of sulfate reducing activity at pH 5.5. Figure 4.12 Photos of Granules by light microscopic Figure (4.13, 4.14, and 4.15), illustrates the SEM images of the hydrogen producing acidogenic granules sampled after treatments. Different magnifications of 1000, 2000, 3500 and 5000 were used for morphological analysis. 71 Chapter Four Results and Discussion Figure (4.13) illustrates that the acidogenic granules had porous and multiple cracks on the surface, which is different from that of the methanogenic granules. These pores were likely to facilitate the passage of nutrients and substrate as well as the release of hydrogen, which has a very low solubility 1.58 mg/L in water. As shown in figure (4.14), the granules were sliced before observing under the SEM. In addition, for each sliced granule 7 places (center and sides) were observed under the SEM to examine the layered structure of the granule. Figure (4.16 and 4.17) illustrate that the hydrogen producing bacteria were almost completely composed of the spore-forming, rod shaped bacteria. Therefore, the dominant species might be clostridium. Comparing to the studies [19 and 115] in which diverse morphology at the surface and inner layers of the granule were observed, what was found in this study was different. In this study the same morphological bacteria can be seen in both outer and inner structure of the granule. 72 Chapter Four Results and Discussion a b c d e f Figure 4.13, Granule surface, a) sliced granule, magnification 75, b) magnification 5K, c) magnification 1K, d) porous and multiple cracks on the surface, magnification 350, e) magnification 5K, f) magnification 5K 73 Chapter Four Results and Discussion Figure 4.14 Sliced granules Figure 4.15 Parts of sliced granule observed under SEM 74 Chapter Four Results and Discussion a b c d Figure 4.16 a) part 1, magnification 3.5K, b) part 3, magnification 3.5, c) part 3, magnification 2K, d) part 7, magnification 3.5. 75 Chapter Four Results and Discussion a b c d Figure 4.17 a) part 4, magnification 10K, b) part 2, magnification 5K, c) part 5, magnification 5K, d) part 6, magnification 5K 4.8 Biological Hydrogen Production Measured in UASB with Enriched Granule The enriched granule applied in an UASB reactor to evaluate the stability in a continuous approach. As shown in figure (4.18) gas concentration (%) was stable during 66 days of operation of UASB reactor and the average hydrogen was 61%. 76 Chapter Four Results and Discussion 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 0 10 20 Hydrogen 30 40 Methane 50 60 70 Carbon dioxide Figure 4.18 UASB gas concentration (%) during 66 days of operation Since, the SRT is 29 days these data can be representative, however, further research need to be done to confirm that the long-term stability can be maintained. 77 Chapter Five Conclusions and Recommendations Chapter Five: Conclusions and Recommendations 5.1 Application and Contribution of this Research The results of this research show, for the first time, that the ASBR process can form hydrogen producing granules. Hydrogen and methane production can easily be linked using a two-stage process. That is, the ASBR process can be utilized for treatment of high strength wastewater with short hydraulic detention times during first stage of a two stage treatment. During the second stage of anaerobic treatment, methane can be recovered from intermediate fatty acids and alcohols present in the effluent of the first stage. This process would require longer hydraulic detention times and would produce methane gas. Although, two-stage anaerobic treatment systems have been used, none have yet been designed or operated at full-scale for hydrogen production and recovery [116]. The present study has shown that acidogenic process which is the initial stage of the complete process of anaerobic treatment can be stabilized in terms of hydrogen concentration without additional costs for controlling methods such as "repeated" heat treatment, sparging nitrogen gas and other kinds of treatments. On the other hand, the results of this study have demonstrated that, completely mixed cultures in wastewater treatment practice can be further enriched by several treatments which lead to higher efficiency and stability. 5.2 Conclusions Based on the experiments conducted here, the following conclusions can be drawn. 1. Granules were formed in an anaerobic sequencing batch reactor at acidic pH. 2. An increase in hydrogen productivity was observed after heat treatment and lack of carbon source treatment. 78 Chapter Five Conclusions and Recommendations 3. The ASBR process demonstrated to be efficient in terms of hydrogen productivity and stability after treatments. 4. Sulfate reducing bacteria and methanogenic bacteria were completely inhibited after treatments. 5. Based on microbial analysis, the enrichment of granules was successful and accordingly the diversity of organisms changed significantly after performing these treatments. 6. Granules morphological analysis showed multiple cracks on the surface of the granule and the of interaction pathways inside the granule's structure. Furthermore, these analyses verified the non-layered structure of acidogenic granules. 7. Anaerobic degradation comprises a sequential process of hydrolysis, acidogenesis, acetogenesis and methanogenesis. This study had showed that an intermediate process like acidogenic/acetogenic can have stable hydrogen production in terms of hydrogen concentration by selection of preferable bacteria under typical operational conditions. 5.3 Recommendations for Further Research 1. Studies should be conducted to investigate same concept used in this research in a two-stage wastewater treatment to understand the economical and technical feasibility of this study. The first stage is designed for the initial fermentative/acidogenic degradation by enriched biomass obtained in current study. During these processes hydrogen could be recovered. The second stage is for the subsequent acetogenic/methanogenic degradation of the intermediate fatty acids to recover methane. This process would require longer hydraulic 79 Chapter Five Conclusions and Recommendations detention times and would produce methane gas. These two processes can be separated by controlling pH and hydraulic detention times. 2. Studies should be conducted to identify microbial species in the enriched granules. 3. Results from this study have shown that glucose was completely degraded within first 15 min of operation. In addition, laboratory-scale works on simple substrates have used HRTs as low as 4h with high hydrogen production [53 and 117]. In current study because of presence of granules lower HRTs can be studied without washout. 4. Previous studies on granule structure indicated that outer layer of the granule is mainly responsible for the acidogenic degradation lead to hydrogen production. Therefore, granule structure can play an important rule on hydrogen production. Shear forces (e.g. resulted from stirring) affect granule size and structure. Studied can be conducted to investigate effects of shear forces on granule performance in terms of hydrogen production. 5. A one-off cessation of feed supply for few hours or regular feed interruption gave shifts in product formation, thought to be related to a population shift away from butyrate/H2 producing spore formers and towards propionate producing non-spore formers. The semi-continuous feeding mode such as ASBR used by some workers at laboratory scale could thus give poor performance [56]. Therefore, the continuous approach by UASB can be further studied by enriched granules to confirm the stable hydrogen production. 80 BIBLOGRAPHY 1 Chenlin Li and Herbert H. P. Fermentative Hydrogen Production from Wastewater and Solid by Mixed Cultures, Critical in Environmental Science and Technology, 37 (1), pp. 1-39. 2007. 2 Sang-Hyoun Kim, Sun-Kee Han, Hang-Sik Shin. Effect of Substrate Concentration on Hydrogen Production and 16S rDNA-based Analysis of the Microbial Community in a Continuous Fermenter. Int. J. Process Biochemistry, 41, pp.199-207. 2006. 3 Scott DS. Hydrogen-the Case for Inevitability, Int. J. Hydrogen Energy, 29, pp. 225– 7. 2004. 4 Bryant, M. P. Microbial Methane Production – Theoretical Aspects. J. of Animal Science, 48(1), pp. 193-201. 1979. 5 Wolfgang Rodel, Wulf Plaga, Rainer Frank and Joachim Knappe. Primary Structures of Escherichia coli Pyruvate Formate-lyase and Pyruvate-formate-lyase-activating Enzyme Deduced from the DNA Nucleotide Sequences, European Journal of Biochemistry, 177 (1), pp.153–158. 1988. 6 P.C. Hallenbeck. Fundamentals of the Fermentative Production of Hydrogen, Int. J. of Water Science and Technology, 52(1), pp. 21-29. 2005. 7 Tortura GJ, Funk BR, Case CL. Microbiolog, New York, USA: Benjamin/Cummings Press. 1998. 8 Levin DB, Pitt L, Love M. Bio-hydrogen Production: Prospects and Limitations to Practical Application. Int. J. Hydrogen Energy, 29, pp.173-85. 2004. 9 Marcella Camilli and M. Pedroni. Comparison of the Performance of Three Different Reactors for Biohydrogen Production via Dark Anaerobic Fermentation. 81 Proceeding International Hydrogen Energy Congress and Exhibition IHEC, 2005, Turkey. 10 Thauer, R., Jungerman, K. and Decler, K. Hydrogen Conservation in Chemotropic Anaerobic Bacteria. Bacteriol. 41, pp.100-180. 1977. 11 S. Sung, L. Raskin, T. Duangmanee, and S. Padmasiri, Simmons. Hydrogen Production by Anaerobic Microbial Communities Exposed to Repeated Heat Treatments, DOE Hydrogen Program Review NREL-610-32405. 2002. 12 Shihwu Sung, Dennis A. Bazylinski, and Lutgarde Raskin. Biohydrogen Production from Renewable Organic Wastes. Final Year Progress Report of Hydrogen, Fuel Cells, and Infrastructure Technologies. Iowa State University. 2003. 13 Osamu Mizuno, Richard Dinsdale, Freda R. Hawkes, Dennis L. Hawkes and Tatsuya Noike. Enhancement of Hydrogen Production from Glucose by Nitrogen Gas Sparging, Bioresource Technology, 73, pp.59–65. 2000. 14 I. Hussy, F.R. , R. Dinsdale, and D.L. Hawkes. Continuous Fermentative Hydrogen Production from a Wheat Starch Co-product by Mixed Microflora, Biotechnology and Bioengineering, 84(6), pp.619-626. 2003. 15 Chen C-G, Lin C-Y, Chang J-S. Kinetics of Hydrogen Production with Continuous Anaerobic Cultures Utilizing Sucrose as the Limiting Substrate, Applied Microbiol Biotechnology, 57, pp.56–64. 2001. 16 Herbert H. P. Fang, Hong Liu, Tong Zhang. Characterization of a Hydrogen- producing Granular Sludge, Biotechnology and Bioengineering. 78(1), pp. 44-52. 2002. 17 Hulshoff pol LW. The Phenomenon of Granulation of Anaerobic Sludge. Ph.D Thesis, Wageningen Agricultural University. 1989. 82 18 Lettinga G, van Velsen AFM, Hobma SW, de Zeeuw W, Klapwijk A. Use of the Up-flow Sludge Blanket (USB) Reactor Concept for Biological Wastewater Treatment, Especially for Anaerobic Treatment, Biotechnology and Bioengineering 22(4), pp.699–734. 1980. 19 Brock, T.D., Madigan. M. T., Martinko, J.M., and Parker. Biology of Microorganisms. New York: Prentice Hall Press. 1994. 20 McLeod FA, Guiot SR, Costerton JW, Layered. Structure of Bacterial Aggregates Produced in an Up-flow Anaerobic Sludge Bed and Filter Reactor, Applied Environmental Microbiology, 56(6), pp. 1598–607. 1990. 21 Das, D. and Veviroglu, T.N. Hydrogen Production by Biological Production Processes: A survey of Literature, Int. J. Hydrogen Energy 26(1), pp.13-28. 2001. 22 23 Daniel D. Chairas. Environmental Studies. pp. 40, Jones and Bartlett Press. 2006. United States Department of Energy Glossary of Energy-related Terms, URL December 21, 2006. 24 B. Kavalon and S. D. Peteves. Status and Perspective of Biomass to Liquid Fuels in the European Union . Report No. EUR 21745 EN, European Commission, Joint Research Center. Institute for Energy Petten, The Netherlands. 2005. 25 McLaughlin SB, Walsh ME. Evaluating Environmental Consequences of Producing Herbaceous Crops for Bio-energy. Biomass and Bioenergy, 14, pp. 317-324. 1998. 26 Allan Clotworthy. Response of Wairakei Geothermal Reservoir to 40 Years of Production. Proceedings World Geothermal Congress, March 2000.Larderello, Italy. 27 Rifkin, J. The Hydrogen Economy, Tarcher/Putnam: New York, 2002. 28 Jiunn-Jyi Lay, Toung-jonn Lee and Tatsuya Noike. Feasibility of Biological Hydrogen Production from Organic Fraction of Municipal Solid Waste, Water Research, 33(11), pp.2579-2586. 1999. 83 29 Cheremisinoff, N.P.; Cheremisinoff, P.N.; Ellerbusch, F. Biomass: Applications, Technology, and Production. New York: Dekker Press. 1980. 30 31 Lewis, C. Biological Fuels. London : Arnold Press. 1983. Antonopoulou G, Ntaikou I, Gavala HN, Skiadas IV, Angelopoulos K, Lyberatos G. Biohydrogen production from sweet sorghum biomass using mixed acidogenic cultures and pure cultures of Ruminococcus albus. Global NEST Journal, 9 (2), pp 144-151, 2007. 32 Piet Lens, P Westermann, Biofuels for Fuel Cells: Renewable Energy from Biomass Fermentation, Published London IWA Published. Pp 381. 2005. 33 Dague, R. R. State of the Art in Anaerobic Waste Treatment. 19th Water Resources Design Conference. Ames, Iowa, USA. pp.4-5. 1981. 34 Jewell. Anaerobic Sewage Treatment, Environmental Science and Technology. 21(1), pp.14-20. 1987. 35 Mcarty, P.L. One Hundred Years of Anaerobic Treatment. The Second International Conference on Anaerobic Digestion. Travemunde, Germany. 1981. 36 George Tchobanoglous, Franklin L. Buron, and H. David Stensel. Wastewater Engineering Treatment and Reuse, International Edition: Mcgrow-Hill Press. 2003. 37 Speece, R. E. Anaerobic Biotechnology for Industrial Wastewaters, Nashville: Archae Press. 1996. 38 Shizas I, Bagley DM. Improving Anaerobic Sequencing Batch Reactor Performance by Modifying Operational Parameters, Water Resource, 36(1), pp. 363-367. 2002. 39 Georgia Dinopoulou, Thomasine Rudd, John N. Lester. Anaerobic Acidogenesis of a Complex Wastewater: the Influence of Operational Parameters on Reactor Performance, Biotechnology and Bioengineering, Wiley InterScience, 31(9), pp.958968. 2004. 84 40 Shuizhou Ke, and Zhou Shi, Herbert H.P. Fang. Applications of Two-phase Anaerobic Degradation in Industrial Wastewater Treatment, Int. J. Environment and Pollution, 23(1), pp. 65-79. 2005. 41 M. Ros, G.D. Zupancic. Two-Stage Thermophilic Anaerobic-Aerobic Digestion of Waste-Activated Sludge, Environmental Engineering and Science, 21(5), pp.617-626. 2004. 42 Brucee.Logan. Extracting Hydrogen and Electricity from Renewable Resources, Environmental Science and Technology, 1, 38(9), pp. 161-167. 2004. 43 Michael H. Gerardi. Wastewater Bacteria, WiLey-Intersscience, A John Wiley & Sons, INC. Publication. 2006. 44 Karlheinz Kreuzberg. Pyruvate Degradation via Pyruvate Formate-lyase (EC 2.3.1.54) and the Enzymes of Formate Fermentation in the Green Alga Chlorogonium Elongatum, Int. J. of Planta, 163(1) pp. 60-67. 1985. 45 Austgen, Laura – Bowen, R. A. Pathophysiology of the Digestive System, Colorado State University, June 1998. Last updated on January 15, 2005 http://arbl.cvmbs.colostate.edu/hbooks/pathphys/digestion/index.html 46 47 S.Sundara Rajan. Introductory Modern Botany, Anmol Publications PVT. 2002. A. M. Reis , P. C. Lemos, M. J. Martins, P. C. CostaL. M. D. Gonçalves, and M. J. T. Carrondo. Influence of Sulfates and Operational Parameters on Volatile Fatty Acids Concentration Profile in Acidogenic Phase, Int. J. Bioprocess and Biosystems Engineering, 6(4), pp.145-151. 2004. 48 Thiele, J. H. Mixed-culture Interactions in Methanogenesis in Mixed Cultures in Biotechnology. New York: McGraw-Hill Press, pp. 261-292. 1991. 85 49 Henze, M.; Harremoe, P. Anaerobic Treatment of wastewater in Fixed Film Reactors-A Literature Review. Water Science and Technology, 15, pp. 1-101. 1983. 50 Grotenhuis, J.T.C.; Houwen, F. P. Plugge, C. M. ZEhnder, A. J. B. Anaerobic Interactions and Systems: Microbial Interactions in Granular Sludge. Proc. IV, ISME, pp. 163-168. 1996. 51 Novaes, R. F. V. Microbiology of Anaerobic Digestion. Water Science and Technology, 28(12), pp. 1-14. 1986. 52 Daniels, L. Biological Methanogenesis: Physiological and Practical Aspects. Trends in Biotechnology, 2(4), pp. 91-98. 1984. 53 Steven W. Van Ginkel. Optimization of Bio-hydrogen Production from Food Processing of Wastewater, Ph.D Thesis. The Pennsylvania State University. Department of Civil and Environmental Engineering. 2005. 54 H. Liu and H.P.P. Fang. Hydrogen Production from Wastewater by Acidogenic Granular Sludge, Water Science and Technology, 47 (1). pp 153-158. 2002. 55 Chiu-Yue Lin and Chaia-hong Jo. Hydrogen Production from Sucrose Using an Anaerobic Sequencing Batch Reactor Process, J. of Chemical Technology and Biotechnology, 78, pp. 678-684. 2003. 56 Vavilin VA, Rytow SV, and Lokshina LY. Modelling Hydrogen Partial Pressure Change as a Result of Competition between the Butyric and Propionic Groups of Acidogenic Bacteria, Bioresource Technology, 54, pp. 171–7.1995. 57 Cohen A, Distel B, van Deursen A, van Andel JG. Role of Anaerobic Spore-forming Bacteria in the Acidogenesis of Glucose Changes Induced by Discontinuous or Low Rate Feed Supply. J. Autonie Van Leeuwenhoek, 51(2), pp.179–192.1985. 86 58 F.R. Hawkesa; , R. Dinsdalea, D.L. Hawkesb, I. Hussyb, Sustainable Fermentative Hydrogen Production: Challenges for Process Optimization, Int. J. of Hydrogen Energy, 27, pp.1339 – 1347. 2002. 59 Ea-San Chang. Effect of Substrate Concentration and Trace Element Composition on Fermentative Hydrogen Production Using an Anaerobic Granular Sludge Process, Master of Engineering Thesis, Graduate Institute of Chemical Engineering, Feng Chia University . 2005. 60 Nanqi Ren, Zhi Qin, Jianzheng LI. Optimal Fermentation Type for Bio-Hydrogen Production by Fermentation. 1st European Hydrogen Energy Conf., Grenoble, France. kopie: September, 2003. 61 Jiunn-Jyi Lay. Modeling and Optimization of Anaerobic Digested Sludge Converting Starch to Hydrogen, New York: John Wiley & Sons Press, Inc. 2000. 62 E. P. Koskinen, Anna H. Kaksonen and Jaakko A. Puhakka. The Relationship between Instability and Compositions of Bacterial Communities within a Dark Fermentation Fluidized-bed Bioreactor, Biotechnology and Bioengineering. 97 (4), pp. 742-758. 2006. 63 Valdez-Vazquez, I., Rios-Leal, E., Esparza-Garzia, F., Zezzhi, F. and Poggi- Varaldo, H. M. Semi-Continuous Solid Substrate Anaerobic Reactors for H2 Production from Organic Waste: Mesophilic versus Thermophilic regime, Int. J. Hydrogen Energy, 30 (13/14), pp. 1383-1391. 2005. 64 Oh, S.E., Van Ginkel, S. W, and Logan, B.E. The Relative Effectiveness of pH Control and Heat Treatment for Enhancing Biohydrogen Gas Production, Environmental Science and Technology, 37 (22), pp. 5186-5190. 2003. 87 65 Dabrok B, Bahl H, Gottschalk G. Parameters Affecting Solvent Production by Clostridium pasteurianum. Applied Environmental Microbiology, 58, pp. 1233-1239. 1992. 66 Tanisho S, Kamiya N, Wakao N. Hydrogen Evolution of Enterobacter aerogenes Depending on Culture pH: Mechanism of Hydrogen Evolution from NADH by means of Membrane-Bound Hydrogenase. Biochim Biophys Acta, 973, pp. 1-6. 1989. 67 Sylvia, D. M., Fuhrmann, J.J., Hartel, P. G., and Zuberer, D. A. Principle and Applications of Soil Microbiology, New Jersy: Prentice Hall, Inc., pp.55.1999. 68 Doyle, M. P. Foodborne Bacterial Pathogens, New York: Marcel Dekker, Inc., 10th edition, 1989. 69 Alexander, M. Soil Microbiology. New York: John Wiley & Sons. Press, 2nd ed., pp. 28.1977. 70 Talaro, K. and Talaro, Foundations in Microbiology, Dubuque, Iowa: A Times Mirror Company, 10th ed, pp. 104. 1996. 71 Xiao Benyi and Liu Junxin. pH Dependency of Hydrogen Fermentation from Alkali-Pretreated Sludge, Chinese Science Bulletin, 51 (4), pp. 399-404. 2005. 72 Chang, J. S, Lee, K.S., and Lin, P.J. Biohydrogen Production with Fixed-Bed Bioreactors, Int. J. Hydrogen Energy, 27 (11/12), pp. 1167-1174, 2002. 73 Chen Chin-Chao; Lin Chiu-Yue; Lin Min-Cheng. Acid-base Enrichment Enhances Anaerobic Hydrogen Production Process, J. of Applied Microbiology and Biotechnology. 58(2), pp. 224-228. 2002. 74 Zhen-Peng Zhang, Kuan-Yeow Show,1y Joo-Hwa Tay, David Tee Liang, Duu-Jong Lee, Wen-Ju Jiang, Rapid Formation of Hydrogen-Producing Granules in an Anaerobic Continuous Stirred Tank Reactor Induced by Acid Incubation, J. of Biotechnology and Bioengineering, 96 (6), pp. 1040-1050. 2006. 88 75 Herbert H.P. Fang, Hong Liu. Effect of pH on Hydrogen Production from Glucose by a Mixed Culture, Biosource Technology, 82, pp. 87-93. 2002. 76 Ueno, Y., Kawai, T., Sato, S., Otsuka, S., and Morimoto, M. Biological Production of Hydrogen from Cellulose by Mixed Anaerobic Microflora, J. of Fermentation and Bioengineering. 79 (4), pp. 395-397. 1995. 77 Sparling, R., and Daniels,L. The Specificity of Growth Inhibition of Methanogenic Bacteria by Bromoethanesulonate, Canadian J. of Microbiology, 33 (12), pp.11321136. 1987. 78 DiMarco, A.A., Bobik, T. and Wolfe, R.. Unusual Coenzymes of Methanogenesis, Annual Review of Biochemistry, 59, pp. 355-394. 1994. 79 Kotsopoulos A, Zeng J, Angelidaki I. Biohydrogen Production in Granular Up-flow Anaerobic Sludge Blanket (UASB) Reactors with Mixed Cultures under Hyperthermophilic Temperature (708C). Biotechnology and Bioengineering, 94(2), pp. 296– 302. 2006 80 Mu Y, Yu HQ. Biological Hydrogen Production in a UASB Reactor with Granules. I: Physicochemical characteristics of hydrogen-producing granules. Biotechnology and Bioengineering, 94(5), pp. 980–987. 2006. 81 Mu Y, Yu HQ, Wang Y. The Role of pH in the Fermentative H2 Production from an Acidogenic Granule-based Reactor. Chemosphere, 64(3), pp. 350–358. 2006. 82 Tay JH, Tay STL, Liu Y, Show KY, Ivanov V. Biogranulation Technologies for Wastewater Treatment. Oxford: Elsivier Science. 2006. 83 Erdincler A, Koseogly S, Onay T. The Role of Blending in Polymer Conditioning of Waste Activated Sludge. Water Science Technology, 44(6), pp. 63–66. 2001. 84 Liu H, Fang HHP. Extraction of Extracellular Polymeric Substances (EPS) of Sludge. J. Biotechnology, 95(3), pp.249–256. 2002. 89 85 Schmidt JE, Ahring BK. Extracellular Polymers in Granular Sludge from Different Up-flow Anaerobic Sludge Blanket (UASB) Reactors. Applied Microbiology and Biotechnology, 42(2–3), pp.457–462. 1994. 86 Schmidt JE, Ahring BK. Granular Sludge Formation in Up-flow Anaerobic Sludge Blanket (UASB) Reactors. Biotechnology and Bioengineering, 49(3), pp. 229–246. 1996. 87 Herbert H. P. Fang, Ho-Kwong Chui and Yu-You Li. Effect of Degradation Kinetics on the Microstructure of Anaerobic Biogranule, Water Science Technology, 32 (8), pp. 165-172. 1995. 88 Fang, H.H.P., Chui, H.K. and Li, Y.Y. Anaerobic Degradation of Butyrate in a UASB Reactor, J. Bioresource Technology., 51, pp. 75–81. 1995. 89 Li, Y. Y., Fang, H.H.P., Chen, T. and Chui, H. K. UASB Treatment of Wastewater Containing Concentrated Benzoate. J. Environmental Engineering, 121 (10), pp. 748751. 1995. 90 Dodddema, H. J. and Vogels, G.D. Improved Identification of Methanogenic Bacteria by Fluorescence Microscopy. Applied Environmental Microbiology, 36(5), pp. 752-754. 1987. 91 Zehender, A.J.B., Huser, B.A., Brock, T.D. and Wuhrmann, K. Characteristization of an Acetate-decarboxylating, Non-hydrogen-oxidizing Methane Bacterium. Archives in Microbiology, 124, pp. 1-11. 1980. 92 Tarvin, D and Buswell, A. M. The Methane Fermentation of Organic Acids and Carbohydrates. J. of American Chemistry Society, 56, pp. 1751-1755. 1934. 93 Fang, H.H.P., Li, Y.Y. and Chui, H.K. Performance and Sludge Characteristics of UASB Process Treating Propionate-rich Wastewater. Water Research, 29(3), pp. 895– 898.1995. 90 94 Gujer, W. and Zehnder, A.J.B. Conversion Processes in Anaerobic Digestion. Water Science and Technology, 15(8/9), pp. 127–167.1983. 95 Michael R. Smith and Robert A. Mah. Growth and Methanogenesis by Methanosarcina Strain 227 on Acetate and Methanol, Applied Environmental Microbiology, 36(6), pp. 870–879, 1978. 96 Morgan JW, Forster CF, Evison LM. A Comparative Study of the Nature of Biopolymers Extracted from Anaerobic and Activated Sludge. Water Research, 24, pp. 743-750. 1990. 97 Frolund B, Griebe T, Nielen PH. Enzymatic Activity in the Activated-sludge Floc Matrix. Applied microbial biotechnology, 3, pp. 755-761. 1995. 98 Frolund B, palmgren R, keiding K, Nielsen PH. Extraction of Extracellular Polymers from Activated Sludge Using a Cation Exchange Resin. Water Research, 30, pp.17491758. 1996. 99 Kosaric N, Blaszezyk R. Microbial Aggregates in Anaerobic Wastewater Treatment, Advances in Biochemical Engineering Biotechnology. 42, pp. 27-62. 1990. 100 Labbe RG, Remi Shih N-J. Physiology of Sporulation in clostridia, In: Rood JI, editor. The Clostridia: Molecular Biology and Pathogenesis. pp. 21–32, New York: Academic Press. 1997. 101 F.R. Hawkesa; , R. Dinsdalea, D.L. Hawkesb, I. Hussyb, Sustainable Fermentative Hydrogen Production: Challenges for Process Optimization, Int. J. of Hydrogen Energy, 27, pp.1339 – 1347. 2002. 102 Chiu-Yue Lin, Rong-Chong Chang. Fermentative hydrogen production at ambient temperature. International Journal of Hydrogen Energy 29, pp. 715 – 720. 2004. 91 103 Yu, H. Q., and Fang, H. H. P. Acidogenesis of Gelatin-rich Wastewater in an Up- flow Anaerobic Reactor: Influence of pH and Temperature. Water Research, 37(1), pp.55-66. 2003. 104 Herbert. H. P. Fang and H. K. Chui. Microstructural Analysis of Anaerobic Granules, Biotechnology Techniques, 7 (7), pp.407-410. 1993. 105 He, J., K. M. Ritalahti, M. R. Aiello and F. E. Löffler. Complete Detoxification of Vinyl Chloride by an Anaerobic Enrichment Culture and Identification of the Reductively Dechlorinating Population as a Dehalococcoides Apecies. Applied Environmental Microbiology, 69, pp. 996-1003. 2003. 106 Sung, Y., K. M. Ritalahti, R. P. Apkarian, and F. E. Löffler. Quantitative PCR Confirms Purity of Strain GT, a Novel Trichloroethene-to-ethene Respiring Dehalococcoides Isolate. Applied Environmental Microbiology. 72, pp. 1980– 1987.2006. 107 Löffler, F. E. Q. Sun, J. Li and J. M. Tiedje. 16S rRNA Gene-based Detection of Tetrachloroethene-dechlorinating Desulfuromonas and Dehalococcoides Species. Applied Environmental Microbiology, 66, pp. 1369-1374. 2000. 108 Liu, W., T. L. Marsh, H. Cheng and L. J.Forney.. Characterization of Microbial Diversity by Determining Terminal Restriction Fragment Length Polymorphisms of Genes encoding 16S rRNA, Applied Environmental Microbiology, 63, pp. 4516-4522. 1997. 109 110 Clean Water. Ministry of the Environment and Water Resources, Singapore. 2006. Lay J-J. Modeling and Optimization of Anaerobic Digested Sludge Converting Starch to Hydrogen. Biotechnology and Bioengineering, 68(3), pp. 269–78. 2000. 111 Wesley A. Volk, Joy C. Brown, Basic Microbiology. pp. 212-214, Addison Wesley Publishing Company. 1997. 92 112 Beeftinkt HH, van den Heuvel JC. Novel Anaerobic Gas Lift Reactor (AGLR) with Retention of Biomass: Start-up Routine and Establishment of Hold-up. Biotechnology and Bioengineering, 30, pp.233-238. 1987. 113 Nandi, R., and Sengupta, S. Microbial Production of Hydrogen –An Overview, Critical Reviews in Microbiology, 24 (1), pp. 61-84. 1998. 114 Dague, R.R., McKinney, R.E., Pfeffer, J.T. Solids Retention in Anaerobic Waste Treatment Systems. J. of the Water Pollution Control Federation, 42(2), pp. 29-46. 1970. 115 Vanderhaegen B, Ysebaert K, Favere K, van Wambeke M, Peeters T, Panic V, Vandenlangenbergh V, Verstraete W. Acidogenesis in Relation to In-reactor Granule Yield. Water Science and Technology, 25(7), pp. 21–30. 1992. 116 Brucee Logan. Extracting Hydrogen and Electricity from Renewable Resources, Environmental Science and Technology, pp. 161-167. 2004. 117 Zoetemeyer RJ, Vandenheuvel JC, Cohen A. pH Influence on Acidogenic Dissimilation of Glucose in an Anaerobic Digester. Water Research, 16(3), pp.303– 311. 1982. 93 [...]... technology is widely applied in industry, especially in the food and beverage and pulp and paper industry, particularly for wastewater treatment Throughout time, studies and experiments has shown various advantages and disadvantages of anaerobic treatment The rationale and interest in the use of an anaerobic treatment process can be explained by considering the advantages and disadvantages of this system... reaching the steady state After each treatment, the performance of the reactor is determined and the data collected from the reactor running, is analyzed for hydrogen productivity Finally, the hydrogen production stability of the enriched culture is compared in a continuous approach by UASB and a batch approach by an ASBR for stable hydrogen production 7 Chapter One Introduction Hydrogen Production by. .. mole of glucose in the production of acetic acid (maximum theoretical hydrogen) , and 2 mole of hydrogen in the production of butyric acid However, several volatile fatty acids and alcohols such as propionate, hexanoate, ethanol, and butanol can be as fermentation products during hydrogen production process H2 can readily be produced from a range of biomass materials However, without substantial improvement,... limitation of hydrogen production are both energy consuming and costly Therefore, the aim of this study was to avoid these controlling methods and as result obtain sustainable and economical hydrogen production The proposed idea in this research was supported by four theoretical facts as follows: 1 Sludge can be treated to form hydrogen- productive granules [16] 2 Granules can be retained because of... released by the degraded compound remains in the fermented products This process normally occurs in an anaerobic digester, but it may also take place in sewer systems, a secondary clarifier, or a thickener Fermentation can be completed by both facultative anaerobic bacteria and strict anaerobic bacteria and can occur by many different pathways with many different products The types of organic compounds... during this process are dependent on the type of bacteria and the existing operational conditions 18 Chapter Two Literature Review In many of the fermentative pathways, hydrogen is produced The production of hydrogen gas is important in anaerobic digesters because, hydrogen is one the main substrates for the production of methane and also hydrogen pressure may inhibit the acetogenic bacteria Strict anaerobic... be practically useful As an example, Antonopouluo et al (2007) had produced 10.4l hydrogen per kg of sorghum biomass [31] The demand of hydrogen as a new clean energy source is rapidly increasing Therefore, low-cost technology for bio -production of hydrogen is being developed in many countries Improving bio -hydrogen- producing capacity and reducing cost is the key to achieve industrialization The microbiological... bio-solids needing disposal by 50-80 percent In addition, during anaerobic treatment, methane or hydrogen is produced which has energy value, and the residual bio-solids can be safely used as a humus-rich compost if it is low in heavy metal content 2.2.3 Hydrogen Production Feasibility Biomass obtained from different sources can have various hydrogen productions depending on the kind and concentration... research on fermentation microorganisms in 1861 [33] In 1881, Mouras' Automatic Scavenger used anaerobic microorganisms to treat waste for the first time [34 and35] Currently, anaerobic digestion is an established technology for the treatment of wastes and wastewater Anaerobic treatment is applicable for a wide range of users, from industry to farming, waste-treating companies, water boards and individual... settling characteristics [17 and18] and since, low HRT favors hydrogen productivity; therefore this characteristic of granules can be beneficial for hydrogen production 3 Hydrogen producing Clostridium and bacillus are able to produce endospores in harsh conditions such as heat, chemical toxicity, lack of carbon source, ultraviolet, ionizing radiation, Acid/base conditions, and Desiccation [19] 4 Granules .. .HYDROGEN PRODUCTION BY ENRICHMENT GRANULES IN AN ACIDOGENIC FERMENTATION PROCESS SHIVA SADAT SHAYEGAN SALEK (B.Sc, Tehran University) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING... approach by an ASBR for stable hydrogen production Chapter One Introduction Hydrogen Production by Enrichment Granules in an Acidogenic Fermentation Process Seed from anaerobic digestion treatment... advantages and disadvantages of anaerobic treatment The rationale and interest in the use of an anaerobic treatment process can be explained by considering the advantages and disadvantages of this