A population based study 1

GENETIC AND EPIGENETIC ALTERATIONS IN THE BRCA1 GENE IN SINGAPORE BREAST AND/OR OVARIAN CANCER: A POPULATION-BASED STUDY AZHAR BIN ALI (B.Sc., Queensland University of Technology) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF SURGERY YONG LOO LIN SCHOOL OF MEDICINE NATIONAL UNIVERSITY OF SINGAPORE 2009 ACKNOWLEDGEMENTS This thesis will not have been possible without the support and guidance from many people. It is a pleasure to have this opportunity to express my deepest gratitude to all of them. First, I would like to thank my PhD supervisor, Dr. Sng Jen-Hwei. I started working for Dr Sng in 2000 as a research assistant and in 2002; I started my MSc followed by the PhD program. During these years, her mentorship and guidance in providing sound advice, ideas and the endless open discussions had been invaluable. She kept an eye on the progress of my work and was always available when I needed help. Her strict and extensive comments had a great impact on the final form of this thesis. No words can describe my deepest gratitude for what she has done. I would also like to thank my co-supervisor, Dr. Philip Iau Tsau Choong, for his constructive comments and ideas. Despite his hectic schedule, the support given by him throughout this work and providing valuable comments on the earlier versions of this thesis is deeply appreciated. I would also like to thank the members of my PhD committee who gave valuable comments during my PhD qualifying examination: A/P Ren EE Chee, A/P Marie Veronique Clement and Dr Ratha Mahendran. I would like to mention my colleagues, in the Department of Surgery, who shared the joys and challenges of work and made laboratory life enjoyable. Eugene Lim, Juwita, Rachel Tham and Shih Wee among others, thank you for not only being good colleagues i but you are great friends as well. And not forgetting the administrative staff in the Department of Surgery for providing the vital administrative support. This research work has been supported and funded by National Medical Research Council. I am grateful to the Singapore Millennium Foundation Limited for providing the financial support and the good faith shown in me. It would have been impossible for me to pursue the PhD program without their support. Pursuing a PhD is a challenge and it is one of the best decisions I have made in my life. I would also like to thank my family, especially and friends for their support, love and care. Special thanks to Chan Tuck Wai for his encouragement and the words of wisdom given to me when I needed them. I would like to end this acknowledgement with G.K. Charleston’s words; nothing is taken for granted, everything received with grace, and everything passed on with gratitude. Thank you all for believing in me. Azhar Bin Ali 30 October 2007 Singapore ii Contents_______________________________________________________ Page Acknowledgements Table of contents i iii List of figures x List of tables xiii List of publications/conferences/awards xvi Abbreviations used in text Summary xviii xxi Chapter 1: Introduction 1.1. Genetics and epigenetics of cancer 1.1.1. Genetics of cancer 1.1.1.1. Proto-oncogenes 1.1.1.2. Tumour suppressor genes 1.1.1.3. Loss of heterozygosity (LOH) 1.1.1.4. Haploinsufficiency 1.1.2. Epigenetics of cancer 1.1.2.1. Epigenetic silencing via methylation in cancer 8 1.1.2.2. Epigenetic silencing via methylation in tumour suppressor genes 1.2. General features of breast, ovarian and fallopian tube carcinomas 10 14 1.2.1. Breast carcinoma 14 1.2.2. Ovarian carcinoma 20 iii 1.2.3. Fallopian tube carcinoma 1.3. The Breast Cancer-Susceptibility Gene, BRCA1 23 26 1.3.1. BRCA1 Structure 26 1.3.2. Functions of BRCA1 27 1.3.2.1. BRCA1 and regulation of cell proliferation 28 1.3.2.2. BRCA1 and DNA damage repair 29 1.3.2.3. Other functions of BRCA1 32 1.4. BRCA1 and hereditary breast and ovarian cancer 33 1.5. BRCA1 and sporadic breast cancer 35 1.6. Sequence alterations in BRCA1 37 1.6.1. Mutation spectrum 37 1.6.2. Founder mutations 40 1.6.3. Genomic rearrangements 42 1.6.4. Somatic deletions at the BRCA1 locus 44 1.7. Breast and ovarian cancer in Singapore Malay women 44 1.8. Aims of study 46 Chapter 2: Materials and Methods 47 2.1. Materials (Chemicals, reagents and kits) 48 2.2. Study samples 50 2.2.1. BRCA1 mutational analysis (including detection of the recurrent mutation, c.2845insA) 50 2.2.1.1. Blood specimens 50 2.2.1.2. Paraffin-embedded specimens 53 iv 2.2.2. Tissue specimens (BRCA1 promoter hypermethylation study) 55 2.2.3. Cell line 55 2.3. Methods 56 2.3.1. BRCA1 mutational analysis 56 2.3.1.1. Isolation of lymphocytes from blood 56 2.3.1.2. Isolation of genomic DNA 57 2.3.1.2.1. Genomic DNA extraction from lymphocytes 57 2.3.1.2.2. Preparation of genomic DNA from FTA cards 57 2.3.1.2.3. Preparation of genomic DNA from paraffin-embedded specimens 58 2.3.1.3. Single Strand Conformation Polymorphism (SSCP) analysis 58 2.3.1.3.1. PCR for SSCP 58 2.3.1.3.2. Agarose gel electrophoresis (DNA) 60 2.3.1.3.3. SSCP gel electrophoresis 61 2.3.1.3.4. Silver staining 64 2.3.1.3.5. Purification of PCR products for sequencing (using the Wizard® PCR Preps DNA Purification System) 65 2.3.1.4. Haplotype analysis 65 2.3.1.5. Protein Truncation Test (PTT) analysis 66 2.3.1.5.1. PCR for PTT 66 2.3.1.5.2. In vitro transcription/translation of purified v PCR product (using the TnT® Quick Coupled Transcription/Translation System) 69 2.3.1.5.3. PTT gel electrophoresis (using SDS-PAGE) 70 2.3.1.6. Genomic rearrangement analysis (using the MLPA P002 and P087 kits) 2.3.2. Methylation analysis of the BRCA1 promoter 2.3.2.1. Genomic DNA extraction from tissues 71 73 73 2.3.2.2. Total RNA extraction from tissue (using the RNAgents® Total RNA Isolation System) 74 2.3.2.3. Native agarose gel electrophoresis (RNA) 75 2.3.2.4. Reverse-transcription and PCR (Semi-quantitative) 75 2.3.2.5. Sodium Bisulfite conversion (using the CpGenome™ DNA Modification Kit) 2.3.2.6. Methylation-specific PCR (MSP) 77 79 2.3.2.7. Cloning of the MSP products and transformation (using the TOPO-TA Cloning System) 80 2.3.2.8. Sequencing (using the BigDye Terminator v3.1 Sequencing Kit) 81 2.3.3. The generation of the BRCA1 c.2845insA construct and protein expression studies 82 2.3.3.1. Site-directed mutagenesis (using the GeneTailor™ Site-Directed Mutagenesis System) 2.3.3.2. Transformation 82 84 vi 2.3.3.3. Plasmid extraction (using the Wizard® Plus SV Minipreps DNA Purification System) 2.3.3.4. Cell culture 85 86 2.3.3.4.1. Growth and maintenance 86 2.3.3.4.2. Cell stocks and growth 86 2.3.3.5. Transient transfection (using the lipofectamine and lipofectamine plus) 2.3.3.6. Protein extraction and quantification 87 88 2.3.3.7. Western blot analysis of BRCA1 c.2845insA mutant protein 2.3.4. Statistical analysis Chapter 3: Results 89 90 91 3.1. Genetic alterations of the BRCA1 gene in Singapore Malay women with breast/ovarian cancer 92 3.1.1. BRCA1 mutations 92 3.1.2. BRCA1 c.284insA mutation, age of onset of cancer and family history of cancer 95 3.1.3. The recurrent BRCA1 c.2845insA mutation detected in Malay fallopian tube cancer patient 102 3.1.4. Absence of BRCA1 genomic rearrangement in Malay breast/ovarian cancer patients 3.2. BRCA1 haplotype analysis 103 105 3.2.1. Haplotyping of Malay breast/ovarian cancer patients and vii the general Malay population 105 3.2.2. Identification of a common haplotype at BRCA1 intragenic markers in breast/ovarian cancer patients with the recurrent BRCA1 c.2845insA mutation 114 3.2.3. The identification of the recurrent mutation-associated haplotype identified in a Malay fallopian tube cancer patient 117 3.2.4. Other common haplotypes identified in Malay breast/ovarian cancer patients 3.3. Epigenetic alterations of the BRCA1 gene in sporadic breast cancer 3.3.1. BRCA1 promoter hypermethylation 118 119 119 3.3.2. Detection of the BRCA1 promoter methylation in paraffin-embedded breast specimens 122 3.3.3. Loss of heterozygosity (LOH) at the BRCA1 locus 123 3.3.4. Expression of BRCA1 transcript in sporadic breast tumours 124 3.3.5. Summary of epigenetic alterations in the BRCA1 gene in sporadic breast cancer 126 3.3.6. High-resolution analysis of 29 cytosine residues in the BRCA1 promoter in tumours and their corresponding matched normal tissues 127 3.4. Site-directed mutagenesis and the in vitro expression of the truncated BRCA1 c.2845insA protein 131 3.4.1. Generation of BRCA1 c.2845insA mutant 131 3.4.2. Optimal plating density for HCC1937 132 viii 3.4.3. In vitro BRCA1 expression in HCC1937 Chapter 4: Discussion 133 136 4.1 Genetic alterations of the BRCA1 gene in Singapore Malay women with breast or ovarian cancer 137 4.1.1. BRCA1 mutations 138 4.1.2. Haplotype analysis at the BRCA1 locus 146 4.2. Epigenetic alterations via methylation of the BRCA1 promoter in Singapore women with sporadic breast cancer 151 4.2.1. Hypermethylation of the BRCA1 promoter, and its association with LOH and transcript expression 151 4.2.2. BRCA1 promoter methylation in paraffin-embedded breast specimens 156 4.2.3. Sequence analysis of methylation patterns in the BRCA1 promoter 158 4.3. The generation of functional BRCA1 c.2845insA recombinant vector 161 4.4. Conclusion 163 Chapter 5: References 166 ix % ethanol and centrifuged at 10,000 g for 10 mins at 4°C. The pellet was air-dried for 30 mins at room temperature, resuspended in 50 µl of nuclease-free water and stored at 20°C. The yield and purity of total RNA was determined spectrophotometrically at 260 nm, where absorbance unit (A260) = 40 µg of single-stranded RNA/ml. 2.3.2.3. Native agarose gel electrophoresis (RNA) All apparatus were treated with RNAse Away before use. 50 ml of % agarose gel was prepared with 0.5 g of agarose in 50 ml of X TBE (89 mM Tris-base, 89 mM boric acid and mM EDTA) buffer. The agarose was dissolved, cooled down to 55°C and allowed to solidify. µg of RNA was added to an equal volume of RNA sample buffer (10 % sucrose, 90 % deionized formamide, 0.05 % bromphenol blue, 0.05 % xylene cyanol) in a final volume of 15 µl. The sample was mixed and heated at 65°C for mins, cooled to room temperature and loaded onto the gel. The gel was run at 50 V in X TBE for hr. The gel was stained with 0.5 µg/ml of ethidium bromide and photographed under UV illumination. The integrity of the samples was confirmed by the presence of the 28S and 18S ribosomal RNA bands. 2.3.2.4. Reverse-transcription and PCR (Semi-quantitative) µg of total RNA was aliquoted into a sterile microcentrifuge tube with pmoles of oligo-dT (18-mer) and DEPC-treated water added to a final volume of 21 µl. The mixture was incubated at 65°C for 15 mins and immediately quenched on ice. A mastermix of 10 µl of X RT buffer, µl of 25 mM dNTPs, 0.5 µl of RNasin Inhibitor, µl of murine 75 reverse transcriptase and sterile water was prepared to a total volume of 29 µl for each sample. The mastermix was added to the RNA and mixed. The sample was incubated at 42°C for hr. 150 µl of TE and 20 µl of M sodium acetate pH 5.5 were added and the contents were mixed thoroughly. 100 µl of Tris-buffered phenol and 100 µl of chloroform: isoamyl alcohol was added and mixed by inverting times. The sample was centrifuged at 10,000 g for mins at room temperature. ml of ethanol was added to the aqueous phase in a fresh sterile tube and sample was incubated at -20°C for hr. The tube was then centrifuged at 10,000 g for 20 mins at 4°C. The supernatant was decanted and the pellet was rinsed with ml of 70 % of ethanol. The sample was centrifuged at 10,000 g for 10 mins at 4°C and the pellet was air-dried for hr at room temperature. The pellet was resuspended in 20 µl of sterile water and stored at -20°C. The sequences of the primers used for PCR were: BRCA1-F 5’- TTGAGGAACATTCAATGTCACC- 3’ (sense) and BRCA1-R 5’- TGTCACTCA GACCAACTCCCTGGCTTTCAGAC- 3’ (anti-sense), (GenBank entry for BRCA1, U14680) which amplify a kb fragment; and triose-phosphate isomerase (TPI-F) 5’CAGACAAAGGTCATCGCAGA- 3’ (sense) and TPI-R 5’- ACAAGGAAGCCATCCACATC- 3’ (anti-sense) (GenBank entry for TPI, BC007812), which amplify a 257 bp product. PCR amplification was carried out in 50 µl volumes (1 µl of 10 X or 100 X diluted template, X PCR reaction buffer, 200 nM of each dNTP, 0.8 µM of each primer and 1.5 units of DNA polymerase were used for each reaction) with annealing temperatures at 58°C and 33 cycles for BRCA1 and TPI respectively. All PCR products were electrophoresed on % ethidium bromide-stained agarose gels with 76 TPI used for normalization. All gel bands were quantified using the GeneTools™ software (Syngene, Cambridge, UK). 2.3.2.5. Sodium bisulfite conversion (using the CpGenome™ DNA Modification Kit) Reagent preparation The following reagents were prepared fresh prior each use. M of sodium hydroxide – g of sodium hydroxide pellets was dissolved in 8.3 ml of sterile water. 20 mM of sodium hydroxide with 90 % ethanol – 900 µl of 100 % ethanol was combined with 6.6 µl of M sodium hydroxide and topped up to ml with sterile water. Reagent I – For each sample, 0.227 g of DNA Modification Reagent I was dissolved in 0.571 ml of water and 20 µl of M sodium hydroxide was subsequently added. Reagent II – µl of 2-mercaptoethanol was added to 20 ml of deionized water. 750 µl of this solution was added to 1.35 g of DNA Modification II for each sample and mixed for complete dissolution. DNA Modification Step µg of genomic DNA was diluted in 100 µl of water in a microcentrifuge tube and µl of M sodium hydroxide was added. If the sample DNA was less than µg, µl of DNA Modification Reagent IV was added to the sample, to a final volume of 100 µl. 77 DNA was incubated for 10 mins at 50°C. 550 µl of freshly prepared DNA Modification Reagent I was added and contents were mixed by vortexing. The sample was incubated at 50°C for hrs in a heating block protected from light. Desalting step In order to minimize DNA loss in subsequent steps, µl of well-suspended DNA Modification Reagent III suspension was added to the DNA solution (the DNA binds to solids in Reagent III). 750 µl of DNA Modification Reagent II was then added to the mixture, mixed briefly and incubated at room temperature for 10 mins. The sample was centrifuged at 5,000 g for 10 sec to pellet the bound DNA-Reagent III solids. The DNAReagent III solids were rinsed with ml of 70 % ethanol and centrifuged for 10 sec at 5,000 g after which the supernatant was discarded. This step was repeated for a total of three times. After removal of the third supernatant, the tube was centrifuged at 10,000 g for mins, and the remaining supernatant was removed with a pipette. Desulfonation, second desalting and elution 50 µl of 20 mM of the sodium hydroxide / 90 % of ethanol solution was added to resuspend the pellet. The sample was briefly vortexed and incubated at room temperature for mins. The sample was then centrifuged at 5,000 g for 10 sec and ml of 90 % ethanol was added to rinse the pellet. The sample was centrifuged again and the supernatant removed. This step was repeated one additional time. After removing the second supernatant, the sample was centrifuged at 10,000 g for mins. The remaining supernatant was removed and the tube was air-dried for 10-20 mins at room temperature. 78 25 µl of TE buffer was added to resuspend DNA to a final concentration of 40 ng/µl. The tube was vortexed vigorously to resuspend the DNA and Reagent III solids afterwhich it was incubated for 15 mins at 55°C. The tube was centrifuged at 10,000 g for mins at room temperature and supernatant containing the resuspended DNA was transferred to a new tube and stored at -20°C. The remaining Reagent III solids were discarded. 2.3.2.6. Methylation-Specific PCR (MSP) 1-2 µl of the modified DNA was used as a template for methylation-specific PCR (MSPCR). BRCA1 primer sequences for the unmethylated and methylated reactions were as follow: methylated forward (sense) – 5’ GGTTAATTTAGAGTTTCGAGAGACG ‘3 and reverse (anti-sense) – 5’ CTATAATTCCCGCGCTTTTCC ‘3 which amplify a 143 bp product; and unmethylated GTGGTTAATTTAGAGTTTTGAGAGATG forward ‘3 and (sense) reverse – (anti-sense) 5’ – 5’ CCACACTTTTCCATTACCACA ‘3 which amplify a 136 bp product (Bae YK, et al, 2004). The methylated and unmethylated primer pairs were designed to amplify -150 to and -152 to -17 respectively, proximal to BRCA1 transcription start site (GenBank for BRCA1, U37574). The CpGenomeTM Universal Methylated DNA was used as a positive control. All PCR reactions were carried out in 40 µl volumes containing X PCR reaction buffer, 200 nM of each dNTP, 0.8 µM of each primer and 1.5 units of DNA polymerase. Amplification was carried out with an initial denaturation at 94°C for min, followed by 35 cycles of amplification [94°C for 30 sec, 55°C and 58°C (for the methylated and 79 unmethylated primers respectively) for 30 sec and 72°C for 45 sec] with a final extension at 72°C for mins. PCR products were loaded and visualized on % ethidium bromidestained agarose gels. Gel bands from the methylation-specific and unmethylated-specific PCR reactions were quantified using GeneTools™ software (Syngene, Cambridge, UK). The gel bands from samples with BRCA1 promoter hypermethylation were excised from the gel and purified for cloning using Wizard® PCR Preps DNA Purification System (Section 2.3.1.3.5.). 2.3.2.7. Cloning of the MSP products and transformation (using the TOPO-TA Cloning System) 0.5 to µl (50 ng) of the purified PCR product was added to a microcentrifuge tube containing µl of Salt Solution and sterile water was added to a total volume of µl. µl of TOPO® vector (pCR®8/GW/TOPO®) was added and the reaction was mixed by gentle pipetting several times. The reaction was incubated for 15 mins at room temperature (22-23°C). After incubation, the reaction was briefly centrifuged for secs and placed on ice. For each ligation, one vial of One Shot® cells was thawed on ice. µl of the ligation reaction was then pipetted into the competent cells and mixed by tapping gently. The vial was incubated on ice for 30 mins and was further incubated for exactly 30 sec at 42°C in a water bath. The vial was removed from the water bath, placed on ice and 250 µl of pre-warmed SOC medium was added to each vial. The vial was placed in a 37°C shaking incubator for hr at 225 rpm. 50 µl from each transformation vial was then spread onto separately labeled Luria-Bertani (LB) agar (1 % bacto-tryptone, 0.5 % bacto- 80 yeast extract, % sodium chloride and 1.5 % agarose) plates containing 100 µg/ml of ampicillin. The agar plates were inverted and incubated at 37°C overnight. The following day, colonies were picked, inoculated into ml of LB with 100 µg/ml of spectinomycin, incubated overnight at 37°C and the recombinant plasmids extracted with Wizard® Plus SV Minipreps DNA Purification System for sequencing. 2.3.2.8. Sequencing (using the BigDye Terminator v3.1 Cycle Sequencing Kit) 20 µl of the DNA sequencing reaction consisting of µl of 2.5 X Ready Reaction Premix, µl of X BigDye Sequencing Buffer, pmol of the sequencing primer and 200 ng of purified plasmid DNA was set up. The conditions for the sequencing cycle were: of denaturation at 96°C followed by 25 cycles of 10 sec at 96°C, sec at 50°C and mins at 60°C before cooling to 4°C. µl of 125 mM EDTA, µl of M sodium acetate pH 5.2 and 50 µl of ethanol were added into each reaction and mixed. The mixture was incubated at room temperature for 15 mins and centrifuged at 10,000 g for mins at 4°C. The supernatant was discarded and the DNA pellet was rinsed with 100 µl of 70 % ethanol. The pellet was centrifuged at 10,000 g for mins at 4°C. The supernatant was discarded and the pellet was air-dried for 15 mins. 10 µl of the HiDi Formamide was added to resuspend the pellet. Samples were then heated at 98°C for mins, pre-cooled to 25°C and analysed on an ABI PRISM DNA Analyzer Model 3100. Sequencing Analysis software v3.7 (Applied Biosystems, CA, USA) was used for sequencing analysis. The sequencing readouts were then manually compared against the original DNA sequence of the BRCA1 promoter (from nucleotide positions -125 to -29, GenBank entry for BRCA1 81 U37574) that had been converted using the MethPrimer software (Li LC and Dahiya R, 2002). 2.3.3. The generation of the BRCA1 c.2845insA construct and protein expression studies 2.3.3.1. Site-directed mutagenesis (using the GeneTailor™ Site-Directed Mutagenesis System) 1. Wild-type BRCA1 construct and primer specification The pCDNA3βHA/BRCA1 (11,656 bp) construct was a gift from Dr Roger Greenberg from the Dana Farber Cancer Institute, Boston, MA, USA (Figure 11). Figure 11. A schematic diagram of the wild-type BRCA1 construct (a gift from Dr Greenberg). The wild-type construct was used as a template to create BRCA1 c.2845insA by site-directed mutagenesis, as denoted by the asterisk (*). Neo – neomycin; Amp – ampicillin; CMV – cytomegalovirus; ORF – open reading frame; HA – haemagglutinin. 82 Forward and reverse primers were designed to generate the BRCA1 c.2841insA mutant. (GenBank entry for BRCA1 cDNA, U14680) The Tm for both primers (basic) was 56°C. Mutation site Extended region Overlapping region Forward primer 5’ Reverse primer 3’ GAATGTGAACAAAAGGAAG - A - AAAATCAAGG CAGTGAAAA - CTTACACTTGTTTTCCTTC Overlapping region Extended region 2. Methylation reaction Methylation of the plasmid DNA (Figure 10) was carried out in a final volume of 16 µl that consisted of 100 ng of plasmid DNA, 1.6 µl of Methylation buffer, 1.6 µl of 10 X Sadenosylmethionine (SAM), 1.0 µl of DNA methylase (4 U/ul) and sterile water. The reagents were mixed and incubated for hr at 37°C. 3. Mutagenesis reaction The mutagenesis reaction was carried out using µl of methylated plasmid, X of Buffer II, 0.3 µM each of the mutagenic forward and corresponding complementary reverse primer, 0.3 mM of each dNTP, 1.3 mM of magnesium acetate and µl (2 units) of rTtH 83 DNA Polymerase XL (for long range PCR). Sterile water was added to a final volume of 50 µl. The amplification reaction was performed with initial denaturation at 94°C for mins, 25 cycles of denaturation at 94°C for 10 sec, annealing at 56°C for 15 sec and extension at 68°C for 12 mins, with a final extension at 68°C for 20 mins. After the reaction, 10 µl of the product was analyzed on a 0.6 % agarose gel before transformation of the mutagenesis product. 2.3.3.2. Transformation One vial of DH5ά™-T1® E. Coli competent cells (provided with the mutagenesis system) for each reaction was thawed on ice for mins. µl of the mutagenesis reaction was pipetted into the competent cells and mixed by tapping gently. The vial was incubated on ice for 10 mins and further incubated for exactly 30 sec in a 42°C water bath. The vial was removed from water bath, placed on ice and 200 µl of pre-warmed SOC medium (2 % bacto-tryptone, 0.5 % bacto-yeast extract, 0.05 % sodium chloride and 20 mM glucose) was added to each vial. The vial was placed in a shaking incubator at 37°C for hr at 225 rpm. 50 µl from each transformation vial was then spread onto separately labeled LB agar plates with 100 µg/ml of ampicillin. The agar plates were inverted and incubated at 37°C overnight. The following day, a single and well isolated colony was picked and inoculated into ml of LB broth (1 % bacto-tryptone, 0.5 % bacto-yeast extract and % sodium chloride) with 100 µg/ml of ampicillin in green cap culture tubes. The inoculated culture was then incubated overnight at 37°C. 84 2.3.3.3. Plasmid extraction (using the Wizard® Plus SV Minipreps DNA Purification System) Overnight bacterial culture was harvested by centrifugation at 10,000 g for mins. The supernatant was discarded and cell pellet was resuspended completely in 250 µl of Cell Resuspension Solution. 250 µl of Cell Lysis Solution was added, mixed by inversion and incubated at room temperature for mins. 10 µl of Alkaline Protease Solution was added, mixed by inverting times and further incubated at room temperature for mins. 350 µl of the Wizard Plus SV Neutralization Solution was added and contents mixed by inversion. The mixture was then centrifuged at 14,000 g for 10mins at room temperature. The clear lysate was transferred to a prepared Spin Column and centrifuged at 14,000 g for at room temperature. The flowthrough was discarded from collection tube and 750 µl of the Column Wash Solution was added into the Spin Column. The Spin Column assembly was centrifuged at 14,000 g for at room temperature and the flowthrough was discarded from collection tube. The Spin Column was rinsed again with 250 µl of Column Wash Solution and centrifuged at 14,000 g for mins at room temperature. The Spin Column was then transferred to a new microcentrifuge tube and the DNA was eluted with 100µl of nuclease-free water by centrifuging at 14,000 g for at room temperature. The eluted DNA was kept at -20°C until further use. 85 2.3.3.4. Cell culture 2.3.3.4.1. Growth and maintenance The breast cancer cell line, HCC1937, with a doubling time of about 50 hrs, was grown in RPMI1640 supplemented with mM of L-glutamine and 10% of fetal bovine serum (FBS) at 37°C in a humidified atmosphere of % CO2 (Starcevic SL, et al, 2003). The medium was changed every three days. When the cells had reached 70-90 % confluency, the cells were rinsed with phosphate-buffered saline (PBS) and incubated with X trypsin at 37°C for 5mins until the cells had dissociated from the flask. The cells were then rinsed with complete medium and centrifuged down at 700 g for mins. The supernatant was discarded and the cells were resuspended with complete medium and plated onto new flasks. The ratio for subculture was 1:3. 2.3.3.4.2. Cell stocks and growth After harvesting and centrifugation, the cells were resuspended in freezing media (95 % complete medium and % DMSO). The resuspended cells were then placed in cryovials and slowly frozen down sequentially (4°C for hrs, -20°C for hrs, -80°C overnight and transferred to liquid nitrogen for long term storage). Revival of the frozen cells was carried out by removing the cryovials from liquid nitrogen and placing immediately in a 37°C water incubator until they were completely thawed. The cells were then rinsed once with complete medium to remove dimethylsulfoxide (DMSO) and subsequently placed in 86 flasks with fresh complete medium. The cells were only used for three passages after being thawed. Cells were plated at a density of x 105 cells per well in 6-well plates. After 24 hrs, the media was replaced with fresh media and incubated for up to 72 hrs. Adherent cells were trypsinized and harvested after 24, 48 and 72 hrs incubation. Cells were then counted using a haemocytometer to monitor cell growth. Experiments were carried out in duplicates and repeated three times. Results were expressed as an increase in mean cell number (± standard error of the mean; SEM) relative to the number of cells originally plated. 2.3.3.5. Transient transfection (using the lipofectamine and lipofectamine plus) One day before transfection, x 105 cells were plated in ml of complete medium in sixwell plates. The plates were placed in an incubator supplied with % CO2 at 37°C overnight. The cells were 50-80% confluent at the time of transfection. µg of DNA was diluted in medium without FBS and lipofectamine plus was added to a final volume of 100 µl, mixed and incubated at room temperature for 15 mins. Lipofectamine was then diluted into medium without FBS to a total volume of 100 µl. The pre-complexed DNA (DNA with lipofectamine plus) was combined with the diluted lipofectamine and the mixture was incubated at room temperature for another 15 mins. The medium in the plated cells were replaced with 800 µl of fresh medium without FBS. The DNAlipofectamine plus lipofectamine mixture was added to the wells and mixed gently. The 87 cells were then incubated at 37°C at % CO2 for hrs. After hrs incubation, ml of complete medium was added to each well, mixed gently and further incubated overnight at 37°C at % CO2. Transfection efficiency control was determined by co-transfecting cells with the firefly luciferase vector and after 48 hrs transfection, the cells were rinsed with PBS twice and incubated with 100 µl of X passive lysis buffer (Luciferase Assay System from Promega, WI, USA) (for 6-well plate) with gentle shaking for hr. The cell lysate was then centrifuged at 14,000 rpm for mins and the supernatant was transferred to a fresh microcentrifuge tube. The luminometer (Lumi-One for Lumi-Kleen, TOE Tampa, FL, USA) was programmed to perform a sec premeasurement delay followed by a 20 sec measurement period. 20 µl of cell lysate was transferred to a luminometer tube containing 80 µl of the Luciferase Assay Reagent II (LAR II) and mixed by pipetting several times. The tube was then placed in the luminometer and reading was initiated. The reading was recorded as the relative light unit (RLU) of the firefly luciferase. The ratio of the RLU of firefly to the RLU of blank (negative for luciferase firefly vector) represented the relative luciferase activity. 2.3.3.6. Protein extraction and quantification Cells from the 6-well plates were harvested by washing twice with ice-cold PBS, after which they were scraped off and collected by centrifugation at 1,500 g for mins. The cell pellet from each well was resuspended in 50 µl of lysis buffer (50 mM Tris-HCl pH 88 8.0, 120 mM sodium chloride, 0.5 % IgePal, 50 mM sodium fluoride, mM sodium orthovanadate, 100 µg/ml phenylmethylsulfonyl fluoride (PMSF), 10 µg/ml leupeptin and 20 µg/ml aprotinin). PMSF, leupeptin and aprotinin were added to lysis buffer just before use. Samples were incubated at room temperature for 30 mins and lysates were centrifuged at 10,000 g for mins. The supernatants were kept at -20°C for SDS-PAGE. Protein concentration was determined by the BioRad protein assay (based on the Bradford assay method). part of the Dye Reagent Concentrate was diluted with parts of deionized water and filtered through a filter to remove particulates. Bovine serum albumin (BSA) was used as the protein standard and five dilutions were used to construct the standard curve (0.2 to 1.0 mg/ml). 100 µl of protein extracts (including BSA) were pipetted into separate test tubes with each containing ml of diluted dye reagent. The contents were vortexed and incubated for about 10 mins. Absorbance was measured at 595 nm using a spectrophotometer. The concentrations of protein extracts were determined using the BSA standard curve. 2.3.3.7. Western blot analysis of BRCA1 c.2845insA mutant protein 10-15 µg of protein was mixed with 1/2 volume of Laemmli buffer and boiled for mins. Samples were then loaded onto a 7% SDS-PAGE gel in running buffer (25 mM Tris base, 192 mM glycine and 0.1 % SDS). After separation, proteins were transferred to a nitrocellulose membrane using the wet transfer method with the transfer buffer (25 mM 89 Tris base, 192 mM glycine, 0.1 % SDS and 20 % methanol). After blocking with 5% non-fat milk in the wash buffer for hrs (10 mM Tris-HCl pH 7.5, 100 mM sodium chloride and 0.1 % Tween-20), the membranes were then separately incubated with antiHA rabbit polyclonal antibody and anti-actin mouse monoclonal antibody (at µg/ml for each antibody) overnight. The membranes were then washed three times, mins per wash, with wash buffer and further incubated with horseradish peroxidase-conjugated goat anti-mouse (1:200) and anti-rabbit (1:200) antibodies for hr. Membranes were further washed three times with wash buffer and developed using the enhanced chemiluminescent (ECL) solution. The image was then captured using X-ray film. 2.3.4. Statistical analysis All statistical analyses were carried out using the SPSS version 12.0 software. The descriptive statistics used included mean, standard error mean (SEM) and the confidence interval (CI). A non-parametric test, the Chi-square, was chosen to compare the frequencies between two classes/groups. For continuous variables, the paired t-test was selected to compare matched samples. All tests were two-sided, with statistical significance set at 0.05. 90 [...]... Singapore Malay women with breast/ovarian cancer Table 13 Allele distribution of the D17S855 (BRCA1 Intron 20) in Singapore Malay women with breast/ovarian cancer Table 14 11 0 11 3 Genotyping at D17S1323, D17S1322 and D17S855 in Malay breast/ovarian cancer with the recurrent BRCA1 c.2845insA mutation Table 15 11 4 Common haplotypes (15 9 -12 7 -14 2 for D17S1323-D17S1322 -D17S855 respectively) in Singapore Malay women... text AA APC ATM ATP ATR BARD1 BASC BIC BRCA1 BRCA2 BRCT Brn-3b BSA cAMP CBP c-Myc CALCA CBFA2 CDH1 CDK4 CHK2 CI CMV CRE CREB CRC CtIP DBD DEPC DMSO DNA DNMT dNTP DSB EDTA ER FBS FIGO FPD/AML GABPα/β GADD45 GAL4 GIST GSTP1 Amino Acid Adenomatous Polyposis Coli Ataxia-Telangiectasia Mutated Adenosine Triphosphate Ataxia-Telangiectasia and RAD3-Related BRCA1-Associated Ring Domain 1 BRCA1-Associated Surveillance... breast/ Chapter 3 ovarian cancer 94 Table 9 BRCA1 mutations in Malay patients with family history of cancer 97 Table 10 BRCA1 mutations in Malay patients without or unknown family history of cancer Table 11 Allele distribution of the D17S1323 (BRCA1 Intron 12 ) in Singapore Malay women with breast/ovarian cancer Table 12 10 0 10 8 Allele distribution of the D17S1322 (BRCA1 Intron 19 ) in xiii Singapore Malay... patient, N 510 , and a novel BRCA1 rearrangement identified in an ovarian cancer patient of Indian ethnicity Figure 17 A representation of the haplotype analysis in 3 breast cancer patients Figure 18 10 9 Allele distribution of the D17S855 (BRCA1 Intron 20) marker in Singapore Malay women with breast/ovarian cancer Figure 21 107 Allele distribution of the D17S1322 (BRCA1 Intron 19 ) marker in Singapore Malay women... addition, a recurrent BRCA1 mutation, c.2845insA, has been identified in Malay women with earlyonset breast cancer Prior to this study, limited data was available on the genetic and epigenetic BRCA1 alterations in Singapore breast and/or ovarian cancers The aim of this study was to investigate genetic alterations of the BRCA1 gene in Singapore Malay women with breast and/or ovarian cancer In addition,... recurring mutation with a founder effect in Singapore Malay women with early onset breast/ovarian cancer Journal of Medical Genetics, 40 (10 ):E 117 , 2003 2 Zahar Damayanti, Azhar bin Ali, Philip Tsau Choong Iau, A Ilancheran and JenHwei Sng The founder mutation BRCA1 c.2845insA identified in a fallopian tube cancer patient: a case report International Journal of Gynecological Cancer, 16 : 362-365, 2006 3... 19 83) In primary breast tumours, LOH is the most common type of genetic alteration, having been found on chromosome arms 1p, 1q, 3p, 6q, 7q, 8p, 11 p, 13 p, 16 q, 17 p, 17 q, 18 q and 22q (Lasko D, et al, 19 91; Callahan R, et al, 19 93; Devilee P and Cornelisse CJ, 19 94; Callahan R, 19 98) BRCA1 is one example of a TSG that has been identified in breast and ovarian cancers through genetic linkage studies studying... Tsau Choong Iau, Azhar bin Ali, Soo Chin Lee, John Eu-Li Wong, Thomas Choudary Putti and Jen-Hwei Sng Identification of novel BRCA large genomic rearrangements in Singapore Asian breast and ovarian cancer patients Clinical Genetics, 71: 3 31- 342, 2007 4 Azhar bin Ali, Philip Tsau Choong Iau, Thomas Choudary Putti and Jen-Hwei Sng BRCA1 disease-associated haplotypes in Singapore Malay women with early-onset... (10 6kDa) in HCC1937 after transfection (for 48 and 72 hrs) 13 5 xii List of tables Page Chapter 1 Table 1 Staging of breast cancer by TMN classification according to the American Joint Committee on Cancer Table 2 General staging of ovarian cancer according to FIGO and the International Gynecologic Cancer Society Table 3 19 22 General staging of fallopian tube cancer according to FIGO and the International... breast/ovarian cancer Table 16 11 6 Genotyping of Malay fallopian tube cancer patient with the recurrent BRCA1 c.2845insA mutation together with five of her family members Table 17 Identification of other haplotypes in Malay women with breast/ovarian cancer Table 18 11 7 11 8 Methylation-specific PCR (MSP) of the BRCA1 promoter in matched non-tumour and tumour tissue from twenty-three sporadic breast cancer . Polyposis Coli ATM Ataxia-Telangiectasia Mutated ATP Adenosine Triphosphate ATR Ataxia-Telangiectasia and RAD3-Related BARD1 BRCA1-Associated Ring Domain 1 BASC BRCA1-Associated Surveillance Complex. Singapore Malay women with breast/ovarian cancer. 11 3 Table 14 Genotyping at D17S1323, D17S1322 and D17S855 in Malay breast/ovarian cancer with the recurrent BRCA1 c.2845insA mutation. 11 4. BRCA1 27 1. 3.2 .1. BRCA1 and regulation of cell proliferation 28 1. 3.2.2. BRCA1 and DNA damage repair 29 1. 3.2.3. Other functions of BRCA1 32 1. 4. BRCA1 and hereditary breast and ovarian