Analysis of gonad differentiation in zebrafish by histology and transgenics

ANALYSIS OF GONAD DIFFERENTIATION IN ZEBRAFISH BY HISTOLOGY AND TRANSGENICS WANG XINGANG NATIONAL UNIVERSITY OF SINGAPORE 2007 ANALYSIS OF GONAD DIFFERENTIATION IN ZEBRAFISH BY HISTOLOGY AND TRANSGENICS WANG XINGANG (B. Sc., Ocean University of Qingdao, China) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES & TEMASEK LIFE SCIENCES LABORATORY NATIONAL UNIVERSITY OF SINGAPORE 2007 Dedicated to my family Acknowledgements I thank my supervisor A/Prof. Laszlo Orban from the bottom of my heart for his kind guidance and full support for my PhD project. What I learned from him drove me to complete the PhD studies, and it will help me through my future research career. I also acknowledge my colleague Dr. Richard Bartfai who gave me many valuable suggestions about the techniques in experiments and the writing of my papers and thesis. Ms. Rajini Sreenivasan did most of the work in microarray hybridization and the data analysis. Mr. Liew Woei Chang and Alex Chang Kuok Weai helped me to quantify the concentration of 11-KT by ELISA assay. I also thank the other current colleagues Mohammad Sorowar Hossain, Kwan Hsiao Yuen, Leslie Beh Yee Ming and Oxana Barabitskaya, the former colleagues Minnie Cai, Li Yang, Inna Sleptsova-Freidrich and Yue Genhua, and all the attachment students for all kinds of help during my experiments and studies. I acknowledge Drs. Anne Vatland Krøvel and Lisbeth Charlotte Olsen for providing the vas::egfp transgenic zebrafish, without it the study of gonad transformation would be impossible. Prof. John H. Postlethwait passed me a great protocol for RNA in situ hybridization, which makes the expression pattern analysis much easier. Drs. Alexander Emelyanov and Serguei Parinov provided their transposon-based transgenic technology that allows the high success rate in generating transgenic zebrafish. I also acknowledge my PhD committee members A/Prof. Vladimir Korzh, Dr. Philippa Melamed and Dr. Toshie Kai for analyzing my data and helping me to remain in the right direction during the long PhD journey. Finally, I would like to thank all TLL core facilities, such as sequencing lab, medium preparation lab, and the fish facility, and all the other researchers who shared their reagents and knowledge generously. I Table of Contents Chapter Introduction 1.1 Sex determination and differentiation . 1.2 Sex determination mechanism of some invertebrates (fruit fly and worm) 1.3 Sex of mammal is determined by sex chromosomes (XX female / XY male) . 1.4 Avian sex is determined by ZW female / ZZ male chromosomal system 1.5 Sex is determined by temperature in some reptiles . 1.6 Sex determination in fish 1.7 Testicular differentiation of mammals . 1.7.1 Differentiation of Sertoli cells 1.7.2 Differentiation of Leydig cells . 1.7.3 Differentiation of primordial germ cells 10 1.8 Ovarian differentiation of mammals . 11 1.9 Zebrafish sex determination . 11 1.10 Morphology of zebrafish gonad differentiation . 14 1.11 Observing zebrafish gonad differentiation by transgenic reporter gene – GFP . 15 1.12 Candidate genes with potential role in zebrafish gonad differentiation . 16 1.12.1 Aromatase: an enzyme converting testosterone into 17β-estradiol 16 1.12.2 11β-hydroxylase: the key enzyme to synthesize 11-ketotestosterone from testosterone.………………………….…………………………………….18 1.13 1.12.3 amh: a candidate gene inhibiting the expression of aromatase in zebrafish 19 1.12.4 Other genes (sox9, sf1 and dmrt1) 20 The purpose of this study 22 II Chapter Materials and Methods .24 2.1 Origin, breeding and rearing of fish . 24 2.2 Observation of vas:egfp expression 24 2.3 Hematoxylin and Eosin staining . 25 2.4 Immunohistochemistry 25 2.5 In situ hybridization 26 2.6 Tissue collection and RNA isolation . 27 2.7 Cloning of zebrafish cyp11b full length cDNA . 28 2.8 Real-time PCR 29 2.9 Detection of 11-Ketotestosterone by ELISA essay 30 2.10 Artificial sex reversal of zebrafish by Fadrozole treatment . 30 2.11 RNA amplification, labeling and hybridization with cDNA microarray . 31 2.12 Transgene constructs 32 Chapter 2.12.1 amh:tdtomato, cyp11b:tdtomato and ankmy:tdTomato . 32 2.12.2 hsp70:amh 33 2.12.3 cyp19a1a:amh and β-actin1:amh 34 Results 35 3.1 Germ cell morphology during gametogenesis in zebrafish . 35 3.2 Sexually dimorphic expression of vas::egfp transgene . 38 3.3 The zygotic EGFP expression marked the onset of ovary differentiation 40 3.4 The decrease of EGFP signals coincided with “juvenile ovary-to-testis” transformation . 41 III 3.5 The onset, duration and extent of “juvenile ovary” development in zebrafish males showed high individual variation 41 3.6 Establishing transgenic lines with testis-specific marker 46 3.6.1 Expression of amh:tdTomato and bioinformatic analysis of amh promoter 46 3.6.2 Molecular cloning and characterization of cyp11b and creation of cyp11b:tdTomato transgenic line 48 3.6.2.1 Zebrafish Cyp11b enzyme showed well conserved motifs when compared to other teleost orthologs 48 3.6.2.2 cyp11b mRNA was localized to Leydig cells in the adult testis and its level was four magnitudes higher than that in the ovary 50 3.6.2.3 3.6.3 cyp11b:tdTomato failed to show any fluorescence . 52 ankmy:tdTomato also failed to be expressed in the testis . 53 3.7 Inhibition of aromatase led to “ovary-to-testis” transformation in females 54 3.8 Sexually dimorphic expression of amh, cyp11b and cyp19a1a during gonad development 56 3.9 cyp19a1a was down-regulated, while amh and cyp11b were both up-regulated during “juvenile ovary-to-testis” transformation 58 3.10 amh expression preceded that of cyp11b during gonad transformation 60 3.11 Overexpression of amh by transgenics 63 3.12 Other genes involved in gonad transformation screened by cDNA microarray 64 IV Chapter Discussion 69 4.1 The usefulness of vas::egfp reporter gene in analyzing zebrafish gonad development .69 4.2 Males differ vastly in the extent of their commitment toward femaleness at their “juvenile ovary” stage 70 4.3 The expression of amh:tdTomat is Sertoli cell-specific but too weak for observing testis differentiation in vivo 73 4.4 Up-regulation of cyp19a1a is required for ovarian differentiation, while that of amh and cyp11b is required for testis differentiation 74 4.5 Down-regulation of cyp19a1a, possibly by amh, might be the mechanism of gonadal transformation in male zebrafish. . 76 4.6 The most predominant male steroid hormone, 11-KT, is not the first signal during zebrafish testicular differentiation 79 4.7 Global transcriptome analysis by microarray discovered more novel genes involved in gonad transformation 80 4.8 Sequential differentiation of granulosa cells, Sertoli cells and Leydig cells during testis development is indicated but needs to be proven . 82 4.9 The hermaphroditic gonad of juvenile zebrafish males: A potential model for the sex change of protogynous sequential hermaphrodites 83 Conclusions … 85 References: . 86 V Abstract Gonad differentiation is an important process in reproductive biology, as it creates the fully mature sexual organs that are essential for the production of the next generation in sexually reproducing organisms. In this study, the widely used zebrafish was chosen as a model organism. The study of zebrafish gonad differentiation will not only help to understand some of the basic biological questions of gonad formation, but also shed light on the reproduction of other teleosts important for aquaculture production. The differentiation of male zebrafish involves the formation of a “juvenile ovary” which later degenerates and transforms into a testis. Although a few studies have described the morphology of “juvenile ovary-to-testis” transformation process based on histology of randomly collected individuals, the molecular mechanism has not been studied so far. In this study, EGFP from vas::egfp transgenic zebrafish was found to be a faithful marker for observing “juvenile ovary-to-testis” transformation in the male, during which the EGFP intensity decreased and disappeared eventually. At the same time, varied intensity of EGFP signal was observed among male zebrafish at their juvenile ovary stage. By histology, the level of EGFP was found to be correlated to the degree of juvenile ovarian development. Individuals undergoing gonad transformation were selected and analyzed by real-time PCR, in situ hybridization and on a custom-made microarray which contains over 6.3K gonad-derived unique cDNAs isolated in our laboratory. During natural gonad transformation in male, cyp19a1a was also found to be down-regulated. In contrast, AntiMüllerian hormone (amh) showed reciprocal expression level to cyp19a1a. It was up- VI regulated in those regions where cyp19a1a had previously been expressed before transformation, i.e. in the somatic cells surrounding the oocytes. The gene synthesizing 11-ketotestosterone (11-KT), 11β-hydroxylase (cyp11b), was also found to be upregulated during gonad transformation, but it was expressed later than amh and its localization was not related to the position of oocytes. Comparative global analysis of transcriptomes between transforming gonads and non-transforming gonads (ovaries) also identified other genes (over 200) differentially expressed by at least fold during transformation. The data lead to a hypothesis that the down-regulation of cyp19a1a by amh may be the mechanism of “juvenile ovary-to-testis” transformation. To prove this hypothesis, three different transgenic lines have been created to overexpress amh, and they will be analyzed in the future. The data also suggest that the most predominant fish androgen, 11-KT, does not appear to be the inducer for testis differentiation or gonad transformation in zebrafish as proposed by studies performed on other teleosts. Candidate genes pulled out from cDNA microarray will enable the further investigation of gonad transformation process. VII Nagahama, Y. (1999). Gonadal steroid hormones: major regulators of gonadal sex differentiation and gametogenesis in fish. In "Sixth Int. Symp. on the Reproductive Physiology of Fish." Bergen, Norway. Nakamura, M., Hourigan, T. F., Yamauchi, K., and Nagahama, Y. (1989). Histological and ultrastructural evidence for the role of gonadal steroid hormones in sex change in the protogynous wrasse, Thalassoma duperrey. Environmental Biology of Fishes 24, 117–136. Nakamura, M., Kobayashi, T., Chang, X. T., and Nagahama, Y. (1998). Gonadal sex differentiation in teleost fish. Journal of Experimental Zoology 281, 362 - 372. Nakamura, S., Aoki, Y., Saito, D., Kuroki, Y., Fujiyama, A., Naruse, K., and Tanaka, M. (2007). Sox9b/sox9a2-EGFP transgenic medaka reveals the morphological reorganization of the gonads and a common precursor of both the female and male supporting cells. Mol Reprod Dev. Nanda, I., Kondo, M., Hornung, U., Asakawa, S., Winkler, C., Shimizu, A., Shan, Z., Haaf, T., Shimizu, N., Shima, A., Schmid, M., and Schartl, M. (2002). A duplicated copy of DMRT1 in the sex-determining region of the Y chromosome of the medaka, Oryzias latipes. Proc Natl Acad Sci U S A 99, 11778-83. Noce, T., Okamoto-Ito, S., and Tsunekawa, N. (2001). Vasa homolog genes in mammalian germ cell development. Cell Struct Funct 26, 131-6. O'Neill, M., Binder, M., Smith, C., Andrews, J., Reed, K., Smith, M., Millar, C., Lambert, D., and Sinclair, A. (2000). ASW: a gene with conserved avian W-linkage and female specific expression in chick embryonic gonad. Dev Genes Evol 210, 243-9. 99 Onichtchouk, D., Aduroja, K., Belting, H. G., Gnugge, L., and Driever, W. (2003). Transgene driving GFP expression from the promoter of the zona pellucida gene zpc is expressed in oocytes and provides an early marker for gonad differentiation in zebrafish. Developmental Dynamics 228, 393-404. Orn, S., Holbech, H., Madsen, T. H., Norrgren, L., and Petersen, G. I. (2003). Gonad development and vitellogenin production in zebrafish (Danio rerio) exposed to ethinylestradiol and methyltestosterone. Aquat Toxicol 65, 397-411. Ottolenghi, C., Omari, S., Garcia-Ortiz, J. E., Uda, M., Crisponi, L., Forabosco, A., Pilia, G., and Schlessinger, D. (2005). Foxl2 is required for commitment to ovary differentiation. Hum Mol Genet 14, 2053-62. Palmer, M. S., Sinclair, A. H., Berta, P., Ellis, N. A., Goodfellow, P. N., Abbas, N. E., and Fellous, M. (1989). Genetic evidence that ZFY is not the testis-determining factor. Nature 342, 937-9. Parinov, S., Kondrichin, I., Korzh, V., and Emelyanov, A. (2004). Tol2 transposonmediated enhancer trap to identify developmentally regulated zebrafish genes in vivo. Dev Dyn 231, 449-59. Park, S. Y., and Jameson, J. L. (2005). Minireview: transcriptional regulation of gonadal development and differentiation. Endocrinology 146, 1035-42. Parkhurst, S. M., and Meneely, P. M. (1994). Sex determination and dosage compensation: lessons from flies and worms. Science 264, 924-32. Patino, R., and Redding, J. M. (2000). Reproductive systems. In "The Laboratory Fish" (G. K. Ostrander, Ed.), pp. 489-450. Academic Press. 100 Paul-Prasanth, B., Matsuda, M., Lau, E. L., Suzuki, A., Sakai, F., Kobayashi, T., and Nagahama, Y. (2006). Knock-down of DMY initiates female pathway in the genetic male medaka, Oryzias latipes. Biochem Biophys Res Commun 351, 815-9. Pelegri, F., and Schulte-Merker, S. (1999). A gynogenesis-based screen for maternaleffect genes in the zebrafish, Danio rerio. Methods Cell Biol 60, 1-20. Picard, J. Y., Goulut, C., Bourrillon, R., and Josso, N. (1986). Biochemical analysis of bovine testicular anti-Mullerian hormone. FEBS Lett 195, 73-6. Pieau, C., and Dorizzi, M. (2004). Oestrogens and temperature-dependent sex determination in reptiles: all is in the gonads. J Endocrinol 181, 367-77. Pieau, C., Dorizzi, M., and Richard-Mercier, N. (1999). Temperature-dependent sex determination and gonadal differentiation in reptiles. Cell Mol Life Sci 55, 887900. Pieau, C., Dorizzi, M., and Richard-Mercier, N. (2001). Temperature-dependent sex determination and gonadal differentiation in reptiles. Exs, 117-41. Piferrer, F., Blazquez, M., Navarro, L., and Gonzalez, A. (2005). Genetic, endocrine, and environmental components of sex determination and differentiation in the European sea bass (Dicentrarchus labrax L.). Gen Comp Endocrinol 142, 102-10. Qin, Y., and Bishop, C. E. (2005). Sox9 is sufficient for functional testis development producing fertile male mice in the absence of Sry. Hum Mol Genet 14, 1221-9. Qin, Y., Kong, L. K., Poirier, C., Truong, C., Overbeek, P. A., and Bishop, C. E. (2004). Long-range activation of Sox9 in Odd Sex (Ods) mice. Hum Mol Genet 13, 12138. 101 Raymond, C. S., Kettlewell, J. R., Hirsch, B., Bardwell, V. J., and Zarkower, D. (1999). Expression of Dmrt1 in the genital ridge of mouse and chicken embryos suggests a role in vertebrate sexual development. Dev Biol 215, 208-20. Raymond, C. S., Murphy, M. W., O'Sullivan, M. G., Bardwell, V. J., and Zarkower, D. (2000). Dmrt1, a gene related to worm and fly sexual regulators, is required for mammalian testis differentiation. Genes Dev 14, 2587-95. Raymond, C. S., Shamu, C. E., Shen, M. M., Seifert, K. J., Hirsch, B., Hodgkin, J., and Zarkower, D. (1998). Evidence for evolutionary conservation of sex-determining genes. Nature 391, 691-5. Raz, E. (2000). The function and regulation of vasa-like genes in germ-cell development. Genome Biol 1, REVIEWS1017. Reed, K. J., and Sinclair, A. H. (2002). FET-1: a novel W-linked, female specific gene up-regulated in the embryonic chicken ovary. Mech Dev 119 Suppl 1, S87-90. Rey, R., Lukas-Croisier, C., Lasala, C., and Bedecarras, P. (2003). AMH/MIS: what we know already about the gene, the protein and its regulation. Mol Cell Endocrinol 211, 21-31. Rodriguez-Mari, A., Yan, Y. L., Bremiller, R. A., Wilson, C., Canestro, C., and Postlethwait, J. H. (2005). Characterization and expression pattern of zebrafish Anti-Mullerian hormone (Amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr Patterns 5, 655-67. Ross, A. J., and Capel, B. (2005). Signaling at the crossroads of gonad development. Trends Endocrinol Metab 16, 19-25. 102 Saccone, G., Pane, A., and Polito, L. C. (2002). Sex determination in flies, fruitflies and butterflies. Genetica 116, 15-23. Sawyer, S. J., Gerstner, K. A., and Callard, G. V. (2006). Real-time PCR analysis of cytochrome P450 aromatase expression in zebrafish: gene specific tissue distribution, sex differences, developmental programming, and estrogen regulation. Gen Comp Endocrinol 147, 108-17. Schartl, M. (2004). Sex chromosome evolution in non-mammalian vertebrates. Curr Opin Genet Dev 14, 634-41. Schmahl, J., Eicher, E. M., Washburn, L. L., and Capel, B. (2000). Sry induces cell proliferation in the mouse gonad. Development 127, 65-73. Schmahl, J., Kim, Y., Colvin, J. S., Ornitz, D. M., and Capel, B. (2004). Fgf9 induces proliferation and nuclear localization of FGFR2 in Sertoli precursors during male sex determination. Development 131, 3627-36. Schulte-Merker, S. (2002). Looking at embryos. In "Zebrafish" (C. Nusslein-Volhard, Ed.), pp. 39-58. Oxford University Press. Sekido, R., Bar, I., Narvaez, V., Penny, G., and Lovell-Badge, R. (2004). SOX9 is upregulated by the transient expression of SRY specifically in Sertoli cell precursors. Dev Biol 274, 271-9. Sekido, R., and Lovell-Badge, R. (2006). Mechanisms of gonadal morphogenesis are not conserved between chick and mouse. Dev Biol. Selman, K., Wallace, R. A., Sarka, A., and Qi, a. X. (1993). Stages of oocyte development in the zebrafish, Brachydanio rerio. Journal of Morphology 218, 203-224. 103 Shaner, N. C., Campbell, R. E., Steinbach, P. A., Giepmans, B. N. G., Palmer, A. E., and Tsien, R. Y. (2004). Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp red fluorescent protein. Nature Biotechnology 22, 1567-1572. Shapiro, D. Y., and Rasotto, M. B. (1993). Sex differentiation and gonadal development in the diandric, protogynous wrasse, Thalassoma bifasciatum (Pisces, Labridae). Journal of Zoology 230, 231-245. Shimoda, N., Knapik, E. W., Ziniti, J., Sim, C., Yamada, E., Kaplan, S., Jackson, D., de Sauvage, F., Jacob, H., and Fishman, M. C. (1999). Zebrafish genetic map with 2000 microsatellite markers. Genomics 58, 219-32. Sinclair, A. H., Berta, P., Palmer, M. S., Hawkins, J. R., Griffiths, B. L., Smith, M. J., Foster, J. W., Frischauf, A. M., Lovell-Badge, R., and Goodfellow, P. N. (1990). A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature 346, 240-4. Slanchev, K., Stebler, J., de la Cueva-Mendez, G., and Raz, E. (2005). Development without germ cells: the role of the germ line in zebrafish sex differentiation. Proc Natl Acad Sci U S A 102, 4074-9. Smith, C. A., McClive, P. J., Western, P. S., Reed, K. J., and Sinclair, A. H. (1999). Conservation of a sex-determining gene. Nature 402, 601-2. Smith, C. A., and Sinclair, A. H. (2004). Sex determination: insights from the chicken. Bioessays 26, 120-32. Sola, L., and Gornung, E. (2001). Classical and molecular cytogenetics of the zebrafish, Danio rerio (Cyprinidae, Cypriniformes): an overview. Genetica 111, 397-412. 104 Sreenivasan, R., Cai, M., Bartfai, R., Wang, X. G., Chuah, A., Christoffels, A., and Orban, L. (2007). A gonad-derived microarray reveals novel genes showing sexually dimorphic expression in the zebrafish gonad and brain. in preparation. Strahle, U., Blader, P., Adam, J., and Ingham, P. W. (1994). A simple and efficient procedure for non-isotopic in situ hybridization to sectioned material. Trends Genet 10, 75-6. Streisinger, G., Walker, C., Dower, N., Knauber, D., and Singer, F. (1981). Production of clones of homozygous diploid zebra fish (Brachydanio rerio). Nature 291, 293-6. Takahashi, H. (1977). Juvenile hermaphroditism in the zebrafish, Brachydanio rerio. Bulletin of Faculty of Fisheries of Hokkaido University 28, 57-65. Thermes, V., Grabher, C., Ristoratore, F., Bourrat, F., Choulika, A., Wittbrodt, J., and Joly, J. S. (2002). I-SceI meganuclease mediates highly efficient transgenesis in fish. Mech Dev 118, 91-8. Thisse, C., and Zon, L. I. (2002). Organogenesis--heart and blood formation from the zebrafish point of view. Science 295, 457-62. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25, 4876-82. Traut, W., and Winking, H. (2001). Meiotic chromosomes and stages of sex chromosome evolution in fish: zebrafish, platyfish and guppy. Chromosome Res 9, 659-72. Tremblay, J. J., and Viger, R. S. (1999). Transcription factor GATA-4 enhances Mullerian inhibiting substance gene transcription through a direct interaction with the nuclear receptor SF-1. Mol Endocrinol 13, 1388-401. 105 Tremblay, J. J., and Viger, R. S. (2003). A mutated form of steroidogenic factor (SF-1 G35E) that causes sex reversal in humans fails to synergize with transcription factor GATA-4. J Biol Chem 278, 42637-42. Uchida, D., Yamashita, M., Kitano, T., and Iguchi, T. (2002). Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J Exp Biol 205, 711-8. Uchida, D., Yamashita, M., Kitano, T., and Iguchi, T. (2004). An aromatase inhibitor or high water temperature induce oocyte apoptosis and depletion of P450 aromatase activity in the gonads of genetic female zebrafish during sex-reversal. Comp Biochem Physiol A Mol Integr Physiol 137, 11-20. Vigier, B., Forest, M. G., Eychenne, B., Bezard, J., Garrigou, O., Robel, P., and Josso, N. (1989). Anti-Mullerian hormone produces endocrine sex reversal of fetal ovaries. Proc Natl Acad Sci U S A 86, 3684-8. von Hofsten, J., Larsson, A., and Olsson, P. E. (2005). Novel steroidogenic factor-1 homolog (ff1d) is coexpressed with anti-Mullerian hormone (AMH) in zebrafish. Dev Dyn 233, 595-604. von Hofsten, J., and Olsson, P. E. (2005). Zebrafish sex determination and differentiation: involvement of FTZ-F1 genes. Reprod Biol Endocrinol 3, 63. Wagner, T., Wirth, J., Meyer, J., Zabel, B., Held, M., Zimmer, J., Pasantes, J., Bricarelli, F. D., Keutel, J., Hustert, E., and et al. (1994). Autosomal sex reversal and campomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9. Cell 79, 1111-20. 106 Wallace, B. M., and Wallace, H. (2003). Synaptonemal complex karyotype of zebrafish. Heredity 90, 136-40. Wang, X. G., Bartfai, R., Sleptsova-Freidrich, I., and Orban, L. (2007). The timing and extent of 'juvenile ovary' phase are highly variable during zebrafish testis differentiation. J Fish Biol 70 (sa), 33–44. Watanabe, K., Clarke, T. R., Lane, A. H., Wang, X., and Donahoe, P. K. (2000). Endogenous expression of Mullerian inhibiting substance in early postnatal rat sertoli cells requires multiple steroidogenic factor-1 and GATA-4-binding sites. Proc Natl Acad Sci U S A 97, 1624-9. Westerfield, M. (1995). The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). Western, P. S., and Sinclair, A. H. (2001). Sex, genes, and heat: triggers of diversity. J Exp Zool 290, 624-31. Wilhelm, D., Hiramatsu, R., Mizusaki, H., Widjaja, L., Combes, A. N., Kanai, Y., and Koopman, P. (2007). SOX9 regulates prostaglandin D synthase gene transcription in vivo to ensure testis development. J Biol Chem. Wilhelm, D., Martinson, F., Bradford, S., Wilson, M. J., Combes, A. N., Beverdam, A., Bowles, J., Mizusaki, H., and Koopman, P. (2005). Sertoli cell differentiation is induced both cell-autonomously and through prostaglandin signaling during mammalian sex determination. Dev Biol 287, 111-24. Wilkins, A. S. (1995). Moving up the hierarchy: a hypothesis on the evolution of a genetic sex determination pathway. Bioessays 17, 71-7. 107 Yamamoto, T. (1969). Sex differentiation. In "Fish Physiology" (D. J. R. W.S. Hoar, Ed.), pp. 117–175. Academic Press, New York. Yao, H. H., Whoriskey, W., and Capel, B. (2002). Desert Hedgehog/Patched signaling specifies fetal Leydig cell fate in testis organogenesis. Genes Dev 16, 1433-40. Yeung, W. S., and Chan, S. T. (1987). The plasma sex steroid profiles in the freshwater, sex-reversing teleost fish, Monopterus albus (Zuiew). Gen Comp Endocrinol 65, 233-42. Yokota, H., Abe, T., Nakai, M., Murakami, H., Eto, C., and Yakabe, Y. (2005). Effects of 4-tert-pentylphenol on the gene expression of P450 11beta-hydroxylase in the gonad of medaka (Oryzias latipes). Aquat Toxicol 71, 121-32. Young, G., Kusakabe, M., and Nakamura, I. (2005). Gonadal Steroidogenesis in Teleost Fish. In "Hormones and their receptors in fish reproduction" (P. Melamed and N. Sherwood, Eds.), pp. 155-223. World Scientific Publishing Co. Pte. Ltd. Yusa, Y., and Suzuki, Y. (2003). A snail with unbiased population sex ratios but highly biased brood sex ratios. Proc Biol Sci 270, 283-8. Zarkower, D. (2001). Establishing sexual dimorphism: conservation amidst diversity? Nat Rev Genet 2, 175-85. 108 Bibliography Paper published • Wang, X. G., Bartfai, R., Sleptsova-Freidrich, I., and Orban, L. (2007). The timing and extent of 'juvenile ovary' phase are highly variable during zebrafish testis differentiation. Journal of Fish Biology 70 (sa), 33–44. • Wang, X. G., and Orban, L. (2007). Anti-Müllerian hormone and 11βhydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males. Developmental Dynamics 236:1329–1338. Conference presentations • Wang, X.G., I. Sleptsova-Freidrich and L. Orban. Testis Differentiation in Zebrafish: Two Different Pathways? Oral presentation at the “9th Biological Science Graduate Congress.” Bangkok, Thailand, 2004. • Wang, X.G., R. Bartfai, I. Sleptsova-Freidrich, R. Sreeinivasan, M. Cai and L. Orban. Analyzing gonad transformation in vas::egfp transgenic zebrafish line. Poster presentation at the “5th international Society of Developmental Biologists Congress.” Sydney, Australia, 2005. • Bartfai, R., X.G. Wang, R. Sreenivasan, M. Cai, H. Srinivasan, M. S. Hossain, J. Komen, A. Christoffels and L. Orban: Gonad differentiation in zebrafish: Comparative and functional genomic studies. Oral presentation at the “Fourth International Symposium on the Biology of Vertebrate Sex Determination”, Kona, Hawaii, USA, 2006. • Bartfai, R., X.G. Wang, R. Sreenivasan, M. Cai, H. Srinivasan, M. S. Hossain, J. Komen, A. Christoffels and L. Orban: Cyprinid gonad differentiation: A comparative genomic study. Oral presentation at "Genetics in Aquaculture IX", Montpellier, France, 2006. I Appendices Table 1. Primer sequences Purpose cyp11b Cloning Real-time PCR Transgenic construct Primer name Sequence (5’-->3’) cyp11b _5’ RACE outer GCAGCGAACGGCAGAAATCC cyp11b _ 5’ RACE inner GAAGGACTCCTCCATGTGTTTGTGC cyp11b _3’ RACE GAAGGGGACCATCAAGGAGAC cyp11b _ F AGGTGATGGTGTCCTCGTC cyp11b _ R TGAAGGTCCTCAGAATGTGC cyp11b _RT_F 5' CCTCGGGCCCATATACAGAGA cyp11b _RT_R 5' CGTCCCGTTCTTGAGGAAGA cyp19a1a_RT_F GATATTTGCTCAGAGCCATGGA cyp19a1a_RT_R GCTCTGGCCAGCTAAAACACT amh_RT_F1 GGGTGTGCATGCTACAGAAGAT amh_RT_R1 CTCAGAAATGCAAACAGTCTGTGT β-actin_RT_F CCATCCTTCTTGGGTATGGAATC β-actin_RT_R GGTGGGGCAATGATCTTGATC hsp70_F_SalI AAAgtcgacTCAGGGGTGTCGCTTGGT hsp70_R_KpnI AAAggtaccCAGGAAAAAAAAACAATTAGAATTA amh_ORF_F_KpnI AAA ggtacc CATGCTTTTCCAGACAAGATTTG amh_ORF_R_XbaI AAA tctaga TCAGCGGCATTCGCACTTG cyp11b _ORF_F_KpnI AAAggtacc CATGTTCTCCTCCTGCGCTG cyp11b _ORF_R_XbaI AAA tctaga TCAGTGCTGGTGTGTGAGTGT pTol2EGFP_F_IsceI tagggataacagggtaatTCTTGGTCCAGGACTCGTGA pTol2EGFP_R_IsceI tagggataacagggtaat AAGACATTCCGCTGCACTTG amh_ORF_F_Xmal AAAcccgggATGCTTTTCCAGACAAGATTTG amh_ORF_R_XbaI AAA tctaga TCAGCGGCATTCGCACTTG cyp19a1a_Pro_F_NdeI AAAcatatgTTGGGTGTAGGATTAGGGATGT cyp19a1a_Pro_R_Xmal AAAcccgggAAGAACGGATTAAGAAGCAAGTC bactin1_pro_F_NdeI AAAcatatgGACAAGCTGCTTTCGTCACTAG bactin1_pro_R_XmaI AAAcccgggGGCTGTAGGGAAAAAAAGCGA tdTomato_F_BamHI AAA ggatcc ATGGTGAGCAAGGGCGAGGA tdTomato_R_XbaI AAA tctaga TTACTTGTACAGCTCGTCCATG amh_Pro_F _SalI AAAgtcgacGAGGAAACCGATTGCTACA amh_Pro_R_BamHI AAAggatccCATCTTCTCACATTCAGTCAGA cyp11b _Pro_F_EcoRI AAAgaattcGATCCTGCTTTTCCCCAGA cyp11b _Pro_R_BamHI AAAggatccCATGCTGCCGATGCTGA ankmy_Pro_F_EcoRI AAAgaattcTATTTGTTGGCTTTCTGTG ankmy_Pro_R_BamHI AAAggatccCATTATACTGTTCTTGTCCTT pEGFP1_F_IsceI tagggataacagggtaatCCTGATTCTGTGGATAACCG pEGFP1_R_IsceI tagggataacagggtaatAACGCTTACAATTTACGCCTT II Table 2. Genes differentially expressed by folds during gonad transformation Gene ID a_O FL09_C08 FL29_A11 FL03_H07 FL12_B06 FL08_A11 FL38_G07 FL28_D06 FL27_D06 FL03_D03 FL29_C01 FL26_A06 FL27_A03 FL18_H03 FL01_A02 FL23_H11 FL17_B03 FL08_D11 FL32_G11 FL07_F04 FL20_A09 FL15_H06 FL22_A02 FL18_A09 FL24_B07 FL40_E05 FL10_G09 FL08_E08 FL23_F01 FL31_B10 FL26_B06 FL27_A07 FL52_C01 FL64_F11 FL28_E08 FL19_E07 FL21_F12 FL23_H06 FL11_G12 FL20_D05 FL41_D12 FL09_F05 FL28_G02 FL22_B01 FL27_F06 FL24_D09 FL11_F08 FL10_C03 FL20_A06 FL43_G01 FL20_D07 FL15_E03 FL09_B09 FL27_C06 FL49_G04 FL44_C08 FL09_B06 FL38_H01 FL26_B07 FL25_E06 FL11_B05 FL23_F07 FL47_D02 FL09_F02 0.47 0.13 0.32 0.02 0.63 0.28 0.46 0.13 0.02 1.39 0.05 0.37 0.17 0.14 0.67 0.07 0.47 0.27 0.86 0.14 0.17 0.25 0.47 0.09 0.18 0.08 0.07 0.25 0.03 0.80 0.55 0.02 0.57 0.45 0.44 0.03 0.01 0.12 0.52 0.12 0.37 0.21 0.02 0.36 0.11 0.06 1.77 0.05 0.73 0.16 0.03 0.06 0.53 0.36 0.64 0.06 0.08 0.23 0.05 0.07 0.11 1.11 0.28 35d_O 35d_OT 0.76 0.20 0.78 0.03 0.04 0.34 0.07 0.65 0.10 1.10 1.32 0.09 0.42 1.42 1.39 0.10 0.48 0.80 1.84 0.06 0.59 1.82 1.60 0.15 0.19 0.29 0.27 0.88 0.06 0.78 0.63 0.21 0.48 0.17 0.28 0.19 0.49 0.16 0.67 0.36 0.25 0.55 0.41 0.99 0.28 0.22 1.24 0.11 1.32 0.16 0.31 0.04 0.86 0.51 1.13 0.15 0.31 0.69 0.14 1.65 0.22 0.99 0.41 22.91 3.36 8.83 0.29 0.38 3.61 0.55 5.06 0.79 8.23 7.97 0.54 2.29 7.71 7.42 0.54 2.46 4.01 8.90 0.27 2.88 8.68 7.64 0.73 0.80 1.21 1.12 3.58 0.22 3.10 2.46 0.81 1.84 0.66 1.07 0.72 1.84 0.59 2.50 1.31 0.89 1.97 1.44 3.50 1.00 0.79 4.36 0.39 4.60 0.55 1.08 0.13 2.89 1.71 3.80 0.49 1.00 2.24 0.45 5.24 0.71 3.11 1.26 a_T 35d_OT /35d_ O 4.66 29.99 0.25 16.68 2.33 11.32 2.04 11.01 21.83 10.81 3.78 10.67 29.01 8.01 0.63 7.81 0.58 7.61 1.55 7.50 3.08 6.02 18.93 5.93 0.48 5.49 4.03 5.42 1.36 5.34 0.68 5.32 0.84 5.10 0.97 5.04 1.27 4.85 1.51 4.84 4.47 4.84 2.26 4.78 6.89 4.77 3.09 4.75 2.50 4.32 2.71 4.13 2.00 4.09 1.87 4.06 0.10 4.04 1.71 3.97 1.32 3.94 2.33 3.88 1.20 3.85 15.59 3.85 2.42 3.81 1.65 3.77 0.08 3.76 5.18 3.73 3.21 3.73 5.74 3.62 3.31 3.59 0.64 3.58 0.42 3.55 1.14 3.55 1.38 3.54 1.19 3.53 1.17 3.53 1.21 3.53 1.18 3.49 0.45 3.45 7.38 3.43 0.66 3.42 2.25 3.37 0.69 3.36 2.17 3.35 3.73 3.24 1.41 3.24 1.43 3.23 0.51 3.18 0.42 3.17 1.47 3.15 1.16 3.14 1.65 3.08 Blast Results differentially regulated trout protein [Salvelinus fontinalis] progranulin-b [Danio rerio] chimera galectin Gal3 [Danio rerio] similar to sperm protein Sp17 [Danio rerio] cyp11b Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide similar to Testican-2 precursor similar to Receptor-type tyrosine-protein phosphatase mu precursor similar to SPARCL1, partial [Danio rerio] major histocompatibility complex class II DAB gene [Danio rerio] ubiquitin C [Danio rerio] similar to adiponectin [Danio rerio] peripheral myelin protein [Danio rerio] olfactomedin [Danio rerio] actin related protein 2/3 complex, subunit 1A [Danio rerio] hypothetical protein LOC405809 [Danio rerio] transducer of ERBB2, 1a [Danio rerio] similar to Keratin 18 [Danio rerio] keratin 12 [Danio rerio] claudin [Danio rerio] calmodulin 2, gamma [Danio rerio] hypothetical protein LOC445025 [Danio rerio] similar to transgelin [Danio rerio] similar to Transmembrane superfamily member (Tetraspanin 3) keratin 12 [Danio rerio] lysozyme [Danio rerio] similar to podocan protein [D . similar to retinol binding protein isoform [Danio rerio] similar to connexin 43 isoform [Danio rerio] MHC class II integral membrane protei . similar to alpha globin type-2 isoform [Danio rerio] similar to ring finger protein 128 isoform 2, partial [Danio rerio] putative ISG12-2 protein [Danio rerio] similar to Ckii protein isoform [Danio rerio] similar to Exocyst complex component Sec15B [Danio rerio] similar to testican [Danio rerio] similar to Coronin-1B (Coronin-2) isoform [Danio rerio] similar to cadherin 1, epithelial [Danio rerio] similar to cadherin 1, epithelial [Danio rerio] similar to Receptor-type tyrosine-protein phosphatase mu precursor thymosin, beta [Danio rerio] hypothetical protein XP_701492 [Danio rerio] annexin A11b [Danio rerio] envelope protein [Danio rerio] similar to complement component C7-2 [Danio rerio] similar to Histone H1.5 (H1 VAR.5) (H1b) isoform [Danio rerio] similar to HLA class II histo . hypothetical protein LOC436968 [Danio rerio] MHC class II integral membrane protein alpha chain [Danio rerio] similar to solute carrier family 22 member isoform a [Danio rerio] similar to 40S ribosomal protein S27-2 isoform [Danio rerio] III FL07_H04 FL29_B01 FL07_B12 FL25_D06 FL44_C10 FL13_A06 FL28_F12 FL37_B11 FL28_E07 FL10_C12 FL64_A11 FL25_B11 FL10_A10 FL12_E03 FL15_G08 FL49_G06 FL22_B02 FL28_B10 FL12_A04 FL30_D01 FL01_F10 FL14_B11 FL29_A05 FL30_F12 FL08_F07 FL31_C06 FL12_C08 FL19_F08 FL26_B09 FL25_B12 FL31_F10 FL28_E10 FL25_B10 FL14_F05 FL16_H11 FL63_A04 FL26_D07 CAND_B04 FL25_H07 FL21_H10 FL32_G02 FL42_E01 FL17_G07 FL12_G11 FL27_B11 FL08_H02 FL30_G09 FL38_H03 FL35_E05 FL37_A10 FL12_A02 FL36_E07 FL09_D02 FL22_B03 FL41_D01 FL41_B09 FL08_A10 FL38_C07 FL39_E11 FL41_B05 FL13_B10 FL05_C03 FL11_A09 FL05_H10 FL29_B02 FL41_D07 FL09_D10 FL29_D03 FL38_E09 0.04 0.06 0.40 0.07 0.56 0.10 0.97 0.68 0.50 0.12 0.11 0.10 0.15 0.16 0.14 1.03 0.58 0.44 0.13 0.45 0.37 0.02 0.44 0.34 0.49 0.21 0.02 0.37 0.77 0.22 0.32 0.08 0.46 0.04 0.50 0.35 0.02 0.64 0.37 0.63 0.64 0.68 1.10 0.23 0.43 0.63 0.40 0.08 0.09 0.09 0.97 0.98 0.01 1.60 0.11 0.44 0.22 0.57 0.55 0.80 0.70 0.22 0.50 0.66 0.69 0.10 0.73 0.19 0.62 0.64 0.76 0.19 0.14 0.34 0.80 0.46 0.98 0.40 1.25 0.24 0.25 0.18 0.24 0.72 0.83 0.36 0.17 0.22 0.21 0.29 0.05 0.84 0.30 0.99 0.33 0.03 0.90 0.31 0.24 0.50 0.17 0.22 0.19 0.31 0.58 0.46 0.77 0.35 0.37 0.93 1.11 1.59 0.31 0.30 0.26 0.58 0.28 0.17 0.29 0.26 1.03 0.02 0.34 0.31 0.25 0.15 0.35 0.29 1.36 0.52 0.25 0.22 0.73 0.69 0.29 0.47 0.09 0.80 1.96 2.32 0.59 0.43 1.01 2.36 1.37 2.89 1.17 3.60 0.70 0.71 0.51 0.68 2.04 2.35 1.00 0.46 0.60 0.57 0.80 0.15 2.33 0.84 2.74 0.89 0.09 2.43 0.83 0.63 1.32 0.45 0.59 0.49 0.80 1.51 1.18 1.98 0.89 0.95 2.35 2.80 3.98 0.77 0.74 0.66 1.43 0.69 0.41 0.71 0.64 2.53 0.05 0.84 0.75 0.61 0.35 0.85 0.71 3.28 1.24 0.61 0.52 1.73 1.65 0.69 1.11 0.22 1.88 2.30 0.14 0.38 0.67 1.71 0.38 1.50 1.74 1.51 2.23 0.57 7.89 0.88 4.21 3.11 1.34 1.01 1.80 3.70 0.62 1.74 7.35 1.07 3.31 1.64 1.99 10.40 0.60 1.54 3.85 1.88 0.59 1.58 2.38 1.96 0.70 0.39 3.14 0.67 1.51 1.65 0.97 1.06 3.28 1.73 2.52 0.73 1.40 0.59 0.79 1.59 0.60 7.76 3.58 1.02 1.60 1.84 3.29 1.66 1.97 0.92 1.57 1.55 1.29 0.38 6.58 2.14 16.11 2.23 3.07 3.06 3.02 3.01 2.98 2.96 2.95 2.93 2.93 2.89 2.88 2.86 2.85 2.84 2.83 2.82 2.81 2.79 2.79 2.79 2.78 2.77 2.76 2.76 2.76 2.73 2.72 2.70 2.70 2.68 2.65 2.64 2.63 2.62 2.60 2.59 2.56 2.56 2.55 2.55 2.54 2.52 2.50 2.50 2.50 2.50 2.47 2.46 2.46 2.45 2.45 2.45 2.45 2.44 2.43 2.43 2.42 2.42 2.41 2.40 2.39 2.39 2.39 2.38 2.38 2.38 2.38 2.37 2.36 similar to mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase [Danio rerio] similar to zinc finger protein, subfamily 1A, [Danio rerio] CCAAT/enhancer binding protein (C/EBP) [Danio rerio] ribosomal protein S18 [Danio rerio] MHC class II integral membrane protein alpha chain [Danio rerio] UTP11-like, U3 small nucleolar ribonucleoprotein [Danio rerio] hypothetical protein XP_701322 [Danio rerio] bcl2-associated X protein [Danio rerio] annexin [Danio rerio] similar to synaptonemal complex protein [Danio rerio] similar to ring finger protein 128 isoform 2, partial [Danio rerio] similar to Transgelin isoform [Danio rerio] hypothetical protein LOC368901 [Danio rerio] similar to Hyperion protein, 419 kD isoform, partial [Danio rerio] hypothetical protein LOC406307 [Danio rerio] cytidylate kinase [Danio rerio] similar to Histone H1.5 (H1 VAR.5) (H1b) isoform [Danio rerio] hypothetical protein LOC503596 [Danio rerio] hypothetical protein XP_701342 [Danio rerio] similar to Histone H1.5 (Histone H1a) [Danio rerio] similar to Ankyrin-3 (ANK-3) . major histocompatibility complex class II DAB gene [Danio rerio] similar to nascent polypeptide-associated complex alpha polypeptide similar to amyloid precursor protein [Danio rerio] similar to zinc finger protein 569 [Danio rerio] similar to muscle-specific creatine kinase isoform [Danio rerio] ribosomal protein L28-like [Danio rerio] similar to Complement factor D precursor (C3 convertase activator) similar to Tumor differentially expressed [Danio rerio] similar to protein phosphatas . hypothetical protein LOC494053 [Danio rerio] similar to lysozyme-like [Danio rerio] annexin [Danio rerio] similar to cathepsin F [Danio rerio] ribosomal protein L26 [Danio rerio] signal transduction and activation of transcription [Danio rerio] hypothetical protein LOC393183 [Danio rerio] similar to DNA directed RNA polymerase II polypeptide E, partial [Danio rerio] cytochrome c oxidase subunit VIa polypeptide [Danio rerio] similar to Isocitrate dehydrogenase (NADP+), soluble [Danio rerio] Rho GDP dissociation inhibitor (GDI) alpha [Danio rerio] similar to mKIAA1148 protein [Danio rerio] similar to cadherin 1, epithelial [Danio rerio] ribosomal protein L24 [Danio rerio] similar to cyclin I [Danio rerio] ribosomal protein S5 [Danio rerio] similar to Dickkopf related protein-3 precursor (Dkk-3) (Dickkopf-3) (mDkk-3) similar to 40S ribosomal protein S30 [Danio rerio] ribosomal protein L24 [Danio rerio] similar to ATP synthase coupling factor 6, mitochondrial precursor small nuclear ribonucleoprotein polypeptide A [Danio rerio] similar to ring finger protein 128 isoform 2, partial [Danio rerio] NADH dehydrogenase (ubiquinone) alpha subcomplex 4, like [Danio rerio] similar to Cullin-4B (CUL-4B) isoform [Danio rerio] IV FL12_F08 FL04_D05 FL29_B10 FL25_F07 FL27_F12 FL12_H03 FL63_E06 FL26_G05 FL45_G07 FL48_F01 FL43_H01 FL07_F10 FL11_E03 FL18_B03 FL29_E03 FL52_H02 FL21_H05 FL35_C07 FL16_H10 FL16_D10 FL23_G04 FL25_A08 FL07_C12 FL45_B06 FL33_E06 FL07_A02 FL10_C08 FL37_G11 FL35_C02 FL58_D12 FL07_F07 FL31_A10 FL26_D02 FL17_B05 FL37_B10 FL11_H04 FL05_C09 FL02_B09 FL07_G06 FL15_D09 FL06_E10 FL26_A11 FL31_F02 FL07_D12 FL15_D11 CAND_C05 FL11_G08 FL34_H02 FL40_H07 FL52_C05 FL28_C04 FL44_H07 FL27_D08 FL16_G03 FL07_B09 FL37_D08 FL11_B10 FL19_C10 FL60_F02 FL11_B11 FL62_B12 FL35_F05 FL36_F03 FL37_F02 FL17_D06 FL09_H08 FL27_D10 FL22_E06 0.46 3.98 0.76 0.62 0.64 0.73 0.83 1.47 0.35 0.31 1.29 1.31 0.14 0.45 0.93 0.45 0.71 0.99 1.14 0.58 0.90 0.24 0.52 0.31 0.82 0.43 0.02 0.98 1.98 3.94 0.38 0.84 0.35 0.35 0.70 0.45 0.14 1.55 0.31 1.29 0.31 0.33 0.77 0.47 0.33 0.80 0.51 0.22 0.55 0.48 0.15 0.43 0.95 1.65 0.72 0.50 1.02 1.36 0.53 0.63 2.91 0.44 0.40 0.49 0.69 0.16 0.40 0.21 0.40 0.18 0.43 0.35 1.25 0.64 0.63 1.25 0.85 0.77 2.43 0.99 0.17 0.32 0.86 0.50 0.46 0.60 0.33 0.45 0.33 0.41 0.38 0.48 1.09 0.53 0.02 1.28 0.30 0.67 0.93 1.36 0.37 0.44 0.67 0.43 0.53 1.47 0.20 0.30 0.94 0.75 1.43 0.33 0.18 0.60 0.41 0.42 0.69 0.89 0.36 0.63 0.47 0.91 0.78 0.23 0.77 0.59 0.31 1.09 0.35 0.63 0.30 1.36 0.11 0.13 0.58 0.21 0.93 0.41 1.02 0.82 2.92 1.48 1.46 2.92 1.98 1.76 5.58 2.28 0.38 0.74 1.95 1.13 1.05 1.37 0.75 1.02 0.74 0.91 0.85 1.08 2.44 1.19 0.04 2.85 0.67 1.49 2.05 3.00 0.81 0.97 1.47 0.94 1.17 3.21 0.43 0.65 2.04 1.63 3.09 0.71 0.38 1.29 0.88 0.90 1.49 1.92 0.76 1.36 1.01 1.94 1.66 0.50 1.64 1.25 0.67 2.31 0.74 1.34 0.64 2.88 0.23 0.28 1.22 0.45 2.92 0.75 1.93 1.71 3.03 1.99 2.76 2.79 1.35 1.05 2.35 0.44 1.28 1.13 5.53 1.66 2.41 1.13 1.82 1.31 3.41 1.68 1.47 1.49 3.32 1.33 9.07 1.64 2.13 2.49 2.02 3.36 0.95 1.81 3.84 1.73 1.68 1.32 2.37 1.45 1.88 1.56 1.53 2.07 1.79 3.73 2.07 0.63 1.18 1.54 1.87 1.51 2.28 0.86 1.83 1.56 1.58 0.87 0.79 1.51 2.09 1.58 2.72 1.37 1.65 6.11 4.07 1.58 2.35 2.35 2.34 2.34 2.34 2.33 2.33 2.32 2.32 2.30 2.30 2.30 2.29 2.29 2.28 2.28 2.27 2.27 2.26 2.26 2.26 2.25 2.25 2.24 2.24 2.24 2.22 2.22 2.22 2.22 2.21 2.21 2.20 2.20 2.20 2.18 2.18 2.18 2.18 2.17 2.17 2.17 2.17 2.17 2.17 2.17 2.16 2.16 2.16 2.16 2.15 2.15 2.14 2.14 2.14 2.13 2.13 2.13 2.13 2.12 2.12 2.12 2.12 2.11 2.11 2.10 2.09 2.09 similar to phosphodiesterase 11A [Danio rerio] similar to SI:dZ125J23.11 (Gypsy polyprotein) [Danio rerio] similar to 26S proteasome non-ATPase regulatory subunit similar to Diamine acetyltransferase similar to Kunitz protease inhibitor [Danio rerio] similar to Dolichol-phosphate mannosyltransferase subunit prothymosin, alpha [Danio rerio] similar to kinesin family member [Danio rerio] similar to Guanine nucleotide-binding protein G(I)/G(S)/G(O) gamma-12 subunit GABA(A) receptor-associated protein-like [Danio rerio] eukaryotic translation initiation factor 3, subunit [Danio rerio] similar to ribosomal protein L18a [Danio rerio] similar to Dickkopf related protein-3 precursor (Dkk-3) (Dickkopf-3) (mDkk-3) hypothetical protein LOC402989 [Danio rerio] hypothetical protein LOC503759 [Danio rerio] ribosomal protein L5 [Danio rerio] putative ISG12-2 protein [Danio rerio] ribosomal protein L23a [Danio rerio] hypothetical protein LOC554105 [Danio rerio] es1 protein [Danio rerio] similar to Nebulin [Danio rerio] ribosomal protein S16 [synthetic construct] similar to interferon-induced, hepatitis C-associated microtubular aggregat similar to Kazal-type serine proteinase inhibitor precursor isoform 60S acidic ribosomal protein P1 [Danio rerio] amh 60S acidic ribosomal protein P1 [Danio rerio] similar to chromosome open reading frame [Danio rerio] ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d similar to : F-box protein 44 [Danio rerio] ribosomal protein L8 [Danio rerio] hemoglobin alpha embryonic-1 [Danio rerio] FK506 binding protein [Danio rerio] annexin [Danio rerio] similar to MGC97606 protein [Danio rerio] similar to interferon-induced, hepatitis C-associated microtubular aggregat similar to Atrxl protein [Danio rerio] keratin 12 [Danio rerio] similar to Wu:fc15g08 protein isoform [Danio rerio] ribosomal protein S25 [Danio rerio] similar to MGC78790 protein [Danio rerio] similar to glutamate receptor, ionotropic, N-methyl D-asparate-associated protein similar to glutathione S-transferase [Danio rerio] V FL29_F11 FL13_F06 FL33_E08 FL31_E06 FL12_D10 FL41_F08 FL24_D12 FL41_E05 FL31_C11 FL45_G01 FL12_B11 FL35_F03 FL29_B08 FL08_G10 FL10_B02 FL07_G04 FL33_G11 FL19_H08 FL15_D10 FL14_A07 FL11_G01 FL29_D02 FL41_C12 FL33_E07 FL17_H04 FL45_G11 FL40_C03 FL10_F05 FL11_A06 FL12_A11 FL33_D05 FL12_D02 FL07_C06 FL15_H11 FL30_A02 FL15_A02 FL16_B01 FL17_E06 CAND_B06 FL60_H08 FL53_H04 FL06_B04 FL20_B03 FL20_F08 FL52_E07 0.60 1.15 0.32 0.31 1.31 0.61 0.37 0.42 0.57 1.62 1.74 0.51 0.03 0.01 0.92 1.35 0.45 0.76 0.81 0.41 0.18 0.47 0.50 0.34 0.06 0.75 2.95 0.22 0.55 1.01 0.27 0.53 1.60 1.77 1.91 0.41 0.52 2.03 2.33 3.50 2.40 3.41 2.60 1.44 6.30 0.77 0.23 0.46 0.47 0.29 0.94 1.00 0.57 0.55 1.31 0.62 0.38 0.14 0.08 0.75 0.38 0.46 0.67 0.37 0.62 0.12 0.39 0.30 0.51 0.18 0.97 0.80 0.30 0.26 0.74 0.66 0.34 0.49 0.56 2.83 0.65 0.46 4.05 3.86 3.40 32.55 9.90 2.98 10.44 9.20 1.61 0.48 0.96 0.97 0.61 1.96 2.07 1.19 1.14 2.72 1.29 0.79 0.29 0.17 1.55 0.78 0.94 1.37 0.75 1.26 0.24 0.80 0.61 1.04 0.36 1.97 1.61 0.61 0.53 1.50 1.33 0.69 0.99 1.13 5.67 1.30 0.91 2.04 1.74 1.53 14.01 4.14 1.22 3.44 2.46 2.64 1.45 1.04 3.12 4.92 2.87 1.29 1.59 1.31 1.91 3.51 1.94 8.36 2.64 3.81 4.49 5.91 2.52 2.35 1.33 4.33 3.49 1.57 5.62 1.70 1.24 1.02 4.43 1.57 2.02 1.08 3.68 2.45 1.94 0.72 1.57 1.67 1.43 1.42 1.15 0.83 0.08 1.29 1.40 0.69 2.09 2.09 2.09 2.08 2.08 2.08 2.08 2.08 2.08 2.08 2.07 2.07 2.07 2.07 2.06 2.05 2.05 2.04 2.04 2.04 2.04 2.03 2.03 2.03 2.03 2.03 2.02 2.02 2.02 2.02 2.02 2.01 2.01 2.01 2.01 2.01 2.00 0.50 0.45 0.45 0.43 0.42 0.41 0.33 0.27 similar to family with sequence similarity 13, member A1 isoform a [Danio rerio] similar to Tax1 (human T-cell leukemia virus type I) binding protein [Danio rerio] similar to High affinity immunoglobulin epsilon receptor alpha-subunit precursor hypothetical protein XP_682250 [Danio rerio] heterogeneous nuclear ribonucleoprotein D-like [Danio rerio] proteasome activator subunit [Danio rerio] similar to casein kinase 1, gamma [Danio rerio] similar to cyclin I [Danio rerio] eukaryotic translation elongation factor beta [Danio rerio] hypothetical protein LOC445043 [Danio rerio] hypothetical protein LOC550529 [Danio rerio] similar to RAB1A, member RAS oncogene family isoform [Danio rerio] similar to cytochrome c oxidase subunit Vb precursor [Danio rerio] similar to heterochromatin protein alpha isoform [Danio rerio] similar to Gamma-aminobutyric acid type B receptor, subunit precursor similar to retinoic acid induced 14 (predicted), partial [Danio rerio] hypothetical protein LOC447845 [Danio rerio] similar to CG10739-PA [Danio rerio] similar to growth factor independent [Danio rerio] similar to high-mobility group box [Danio rerio] RNA polymerase II transcriptional coactivator [Danio rerio] similar to glycerol-3-phosphate dehydrogenase, partial [Danio rerio] bone morphogenetic protein [Danio rerio] similar to glyceraldehyde-3-phosphate dehydrogenase isoform [Danio rerio] hypothetical protein LOC393742 [Danio rerio] ribosomal protein L24 [Danio rerio] similar to Voltage-dependent anion-selective channel protein (VDAC-1) CCAAT/enhancer binding protein (C/EBP) [Danio rerio] FK506 binding protein 1b [Danio rerio] proteasome (prosome, macropain) subunit, beta type, 11 [Danio rerio] hypothetical protein LOC613140 [Danio rerio] similar to Tetratricopeptide repeat protein 11 (TPR repeat protein 11) similar to predicted CDS, polyprotein family member (4B673) [Danio rerio] cyp19a1a similar to nudix-type motif [Danio rerio] paraxis [Danio rerio] similar to eukaryotic translation elongation factor alpha [Danio rerio] similar to Ras association (RalGDS/AF-6) domain family isoform a [Danio rerio] similar to Arylalkylamine N-acetyltransferase, partial [Danio rerio] similar to melanosomal matrix protein precursor, partial [Danio rerio] VI [...]... description and genetic analysis of the gonadal transformation process during male gonad development The sex determining mechanism and the early differentiation of ovary are not the main purpose of this study This study will contribute to the zebrafish- related research by providing a detailed view of gonadal differentiation in males, and establishing a method to obtain samples undergoing this key process by. .. thesis, the variety of sex determination in both invertebrates and vertebrates will be reviewed and gonad differentiation pathway will be generalized from the best studied vertebrate model - mice The emphasis will be on discussing the mode of sex determination and candidate genes involved in gonad differentiation of zebrafish 2 1.2 Sex determination mechanism of some invertebrates (fruit fly and worm) The... over 10 µm in diameter Thus whether gonadal transformation was due to oocyte apoptosis or not can not be concluded 1.11 Observing zebrafish gonad differentiation by transgenic reporter gene – GFP In the absence of a sex linked marker zebrafish cannot be sexed, which hinders the studies of molecular mechanism of gonadal differentiation Traditional method using Hematoxylin and Eosin staining requires... identified in zebrafish, cyp19a1a mainly expressed in ovary, and cyp19a1b mainly in brain (Chiang et al., 2001b) By real-time RT-PCR analysis, the transcript level of cyp19a1a showed nearly 100 times higher in adult ovary than in testis, but there was no obvious difference of cyp19a1b between female brain and male brain [Figure 1 of (Sawyer et al., 2006)] By in situ hybridization, cyp19a1a showed a pattern of. .. studied in zebrafish before this study Gonadal differentiation of zebrafish can also be affected by synthesized hormones, like methyltestosterone (MT) and ethinylestradiol (EE2) Oran et al (2003) observed complete masculization of zebrafish treated in MT from 26 to 1000ng/l, and feminization when treated with EE2 at 2, 5 and 10 ng/l 1.12.3 amh: a candidate gene inhibiting the expression of aromatase in zebrafish. .. inducing and maintaining ovarian development in fish (Yamamoto, 1969) Exposing zebrafish to E2 at 100ng/l prior to and during the time of sex differentiation resulted in a female-biased sex ratio at maturity (Brion et al., 2004) This feminizing effect was also found in medaka The fertilized eggs immersed in 1 µg/ml of E2 for 24 hours all developed into females (Kobayashi and Iwamatsu, 2005) Chemical inhibition... The SRY gene was first found in human by searching through a 35-kilobase region of the human Y chromosome (Sinclair et al., 1990) The function of SRY as a sex determining 3 gene was proven by the finding of SRY in XX males (Palmer et al., 1989) and mutation of SRY in XY females (Berta et al., 1990; Jager et al., 1990) Its sex-determining function was also proven in mice by transgenic studies When chromosomally... expressed in the Sertoli cells of fetal testes, and induces regression of the Müllerian ducts, the anlage of the female internal reproductive organs which may differentiate into Fallopian tubes, uterus 8 and the upper part of the vagina in both sexes (Josso et al., 1993; Lee and Donahoe, 1993; Munsterberg and Lovell-Badge, 1991) Chronic expression of human AMH in mice by transgenesis led to a blind vagina,... expression in the adult gonads by in situ hybridization 52 Figure 13 Cloning and characterization of ankmy gene……………………………… 54 Figure 14 Induced “ovary-to-testis” transformation in the females by Fadrozole…… 56 Figure 15 The comparative analysis of expression levels of amh, cyp19a1a and cyp11b during zebrafish development……………….…………………………… 57 Figure 16 Expression pattern of cyp19a1a, amh and cyp11b in the... expressed in testicular Leydig cells and Sertoli cells, which is identical to the localization of mammalian Sf1 Thus, it has been proposed to be a candidate gene for sex determination and differentiation in zebrafish (von Hofsten et al., 2005; von Hofsten and Olsson, 2005) Dmrt1, is also a candidate gene regulating gonad differentiation found in fish, reptiles, birds and mammals It contains a conserved . ANALYSIS OF GONAD DIFFERENTIATION IN ZEBRAFISH BY HISTOLOGY AND TRANSGENICS WANG XINGANG NATIONAL UNIVERSITY OF SINGAPORE 2007 ANALYSIS OF GONAD DIFFERENTIATION. discussing the mode of sex determination and candidate genes involved in gonad differentiation of zebrafish. 3 1.2 Sex determination mechanism of some invertebrates (fruit fly and worm). found in human by searching through a 35-kilobase region of the human Y chromosome (Sinclair et al., 1990). The function of SRY as a sex determining 4 gene was proven by the finding of SRY in