Characterisation of alternative splicing of the cav1 4 calcium channel gene

CHARACTERISATION OF ALTERNATIVE SPLICING OF THE CaV1.4 CALCIUM CHANNEL GENE GREGORY TAN MING YEONG BACHELOR OF SCIENCE (HONS), NATIONAL UNIVERSITY OF SINGAPORE A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF PHYSIOLOGY NATIONAL UNIVERSITY OF SINGAPORE ACKNOWLEDGEMENTS First and foremost, I would like to express my heartfelt gratitude to my supervisor, Assoc Prof Soong Tuck Wah, for his patience, guidance and support throughout the course of the graduate program I also thank all the members, past and present, of the Ion Channel and Transporter Laboratory for their support, encouragement and friendship Of special mention is Ms Yu Dejie, who performed a third of the electrophysiological recordings presented here I express my sincere thanks to my examiners for making time and effort to examine this thesis I thank the following people for the invaluable gifts of molecular clones: Dr Roger D Zühlke (University of Bern, Switzerland) for the CaV pBluescript) Dr John E McRory (University of British Columbia, Canada) for the CaV V1.4 pcDNA3.1) Dr Roger Y Tsien (University of California, San Diego, CA) for the mCherry clone (pRSET-B mCherry) I thank the following institutions and departments for the support and opportunities provided in the course of the research: National University of Singapore, Department of Physiology, Office of Life Sciences (Neurobiology Program) and National Neuroscience Institute i I thank Assoc Prof Tan Chee Hong and Assoc Prof Khoo Hoon Eng for refereeing my entry into the graduate program Some preliminary work involving the identification and characterisation of transcription regulatory elements using comparative genomics was performed but are not presented in this thesis I would like to acknowledge the following people who were invaluable in this phase of work: Dr Yap Wai Ho for advice and guidance in the field of comparative genomics, and for gift of cell line Dr Fu Jianlin and laboratory for work in Xenopus oocyte expression Dr Yu Weiping for guidance and gifts of molecular clones Assoc Prof Gan Yunn Hwen for gifts of various cell lines Mr Paul Chen Zi Jian (summer student) for the work rendered during the course of the attachment ii TABLE OF CONTENTS ACKNOWLEDGEMENTS i TABLE OF CONTENTS iii LIST OF PUBLICATIONS vii ABSTRACT viii LIST OF TABLES x LIST OF FIGURES xi LIST OF ABBREVIATIONS xiii CHAPTER INTRODUCTION 1.1 Voltage-gated calcium channels 1.1.1 subunit 1.2 CaV1.4 1.2.1 Discovery and night blindness etiology 1.2.2 Characteristics of the disease mouse model 1.2.3 Restricted tissue distribution and roles 1.2.4 Unique biophysical and pharmacological properties 1.2.5 The C-terminal Modulator a novel regulatory domain 3 1.3 Alternative splicing diversifies the function of calcium channels 1.3.1 Effects of alternative splicing in L-type calcium channels 1.3.2 CaV1.4 in the retina are alternatively spliced 12 14 15 1.4 16 Rationale and hypotheses iii CHAPTER METHODS 19 2.1 Materials 19 2.2 Reference sequences 20 2.3 Nomenclature for describing alternatively spliced exon variants 21 2.4 Transcript-scanning Method 21 2.5 Construction of cloned full-length CaV1.4 library 25 2.6 Screening full-length library to determine abundance of splice variants 26 2.7 Cloning strategies employed in the generating of -subunit constructs for electrophysiology experiments 2.7.1 Cloning of Ch-WT 2.7.2 Cloning of Ch- 37 2.7.3 Cloning of Ch-42d+ 2.7.4 Cloning of Ch-43* 2.7.5 Cloning of Ch-45a2.7.6 Cloning of Ch-1718 2.7.7 Cloning of Ch-1878 2.7.8 Cloning of C1878-mCherry 27 27 29 34 36 38 38 41 43 2.8 Transient expression of calcium channels in HEK-293 cells 45 2.9 Whole-cell patch-clamp electrophysiology 46 2.10 Data and statistical analyses 49 CHAPTER RESULTS 50 3.1 Transcript scanning of CaV1.4 from human retina 50 3.2 Abundance of each splice variant in CaV1.4 transcripts 62 iv CHAPTER RESULTS 64 4.1 Electrophysiological characterisation of CaV1.4 c-terminal splice variants 64 4.1.1 Characterising the CaV1.4 c-terminal splice variants using chimeras 64 2+ 4.1.2 43* splice-variant inactivates more rapidly in Ca and activates in more hyperpolarised potential 65 4.1.3 43* splicing caused a narrowing and a pronounced negative shift in window current 67 4.1.4 Calcium-dependent inactivation (CDI) is restored by 43* splicing 71 4.1.5 Voltage-dependent inactivation (VDI) is suppressed by 43* splicing 75 4.1.6 43* splicing resulted in a channel that, although inactivated rapidly in 2+ Ca , inactivated more slowly in Ba2+ 75 4.1.7 Recovery from inactivation is modulated by 43* and 45a- splicing 76 4.1.8 Ch-43* mediates four-fold greater current density 78 4.2 Determinants for activation, inactivation and fast recovery in Ca V1.4 c-tail.80 4.2.1 Hyperpolarised I-V shift in Ch-43* is caused by loss of CTM 81 4.2.2 Co-expression with C1878-mCherry suppressed CDI and increased VDI in Ch-43* 84 4.2.3 Determinants for channel recovery lie upstream of the CTM 89 CHAPTER Discussion 92 5.1 Alternative splice variants in CaV1.4 in human retina 5.1.1 Amino-terminus splice variants 5.1.2 Splice variation at the I-II loop 5.1.3 Splice variation at domain IIS6 5.1.4 Splice variation at IVS3-S4 linker 5.1.5 Splice variation at the carboxyl-terminus 5.1.6 Hemichannels and deleting entire transmembrane segments 92 92 93 94 95 95 98 5.2 Modulation of channel biophysical properties by c-tail splice variants 5.2.1 Hyperpolarised I-V 5.2.2 Hyperpolarised window current 5.2.3 Increased current density 5.2.4 Restoration of fast CDI and suppression of VDI 5.2.5 Slowing the rate of recovery 99 100 100 101 101 102 v 5.3 Physiological implications of the exon 43* splice variants in the retina 104 5.3.1 43* and ICa kinetics in rod photoreceptors 104 5.3.2 43*and CDI in retinal neurons 105 5.3.3 Activation of 43* during rod photoreceptor recovery from light pulse and possible consequences 105 CHAPTER FUTURE PROJECTIONS AND CONCLUSION 110 6.1 New issues raised 6.1.1 Does CaV1.4 (43*) bind CaBP4? 6.1.2 Other important splice-variants for characterisation 6.1.3 Recovery accelerating modulator 6.1.4 Current density 6.1.5 Various curiosities 110 110 110 111 112 112 6.2 End notes 113 REFERENCES 115 vi LIST OF PUBLICATIONS Tao J, Lin M, Sha J, Tan G, Soong TW, Li S (2007) Separate locations of urocortin and its receptors in mouse testis: function in male reproduction and the relevant mechanisms Cell Physiol Biochem 19(5-6):303-12 Tang ZZ, Liao P, Li G, Jiang FL, Yu D, Hong X, Yong TF, Tan G, Lu S, Wang J, Soong TW (2008) Differential splicing patterns of L-type calcium channel CaV1.2 subunit in hearts of Spontaneously Hypertensive Rats and Wistar Kyoto Rats Biochim Biophys Acta 1783(1):118-30 Tao J, Hildebrand ME, Liao P, Liang MC, Tan G, Li S, Snutch TP, Soong TW (2008) Activation of corticotropin-releasing factor receptor selectively inhibits CaV3.2 Ttype calcium channels Mol Pharmacol 73(6):1596-609 Posters Presented: Tan G and Soong TW (2004) Alternative Splicing of Human L-Type Voltage Gated Calcium Channel Gene, Cav1.4 : A Regulation of Retinal Phototransduction 5th Combined Scientific Meeting of the 4th Graduate Students' Society-Faculty of Medicine, the Singapore Society for Biochemistry and Molecular Biology, the Singapore Society for Microbiology & Biotechnology, and the Biomedical Research and Experimental Therapeutics Society of Singapore, 12-14 May 2004 Tan G, Wong E, Yu W, Yap WH, Venkatash B and Soong TW (2005) Comparative Genomics Between Human and Fugu Voltage-Gated Calcium Channel Genes The Society for Neuroscience 35th Annual Meeting 2005, 12-16 November, Washington DC, USA vii ABSTRACT CaV1.4 is a member of the L-type family of voltage-gated calcium channels (LTCC) CaV1.4 is predominantly expressed in the rod photoreceptor synapse and is etiological in congenital stationary night blindness type-2 (CSNB2) characterised by various visual impairments in addition to night blindness Electroretinography of CNSB2 patients suggest that CaV1.4 mediate neurotransmitter release at the photoreceptor synapse CaV1.4 was the last among the LTCC to be cloned and characterised The biophysical properties of this channel display a slow voltagedependent inactivation (VDI) and a unique absence of calcium-dependent inactivation (CDI) LTCC properties are extensively diversified by alternative splicing Using the transcript-scanning method, we identified nineteen different splice variants of CaV1.4 in the human retina Electrophysiological characterisation of the splice variants at the carboxyl cytosolic tail (c-tail) demonstrated modulations to activation, inactivation and recovery properties Cassette exon 43* negatively shifted the I-V relationship by -20 mV, hyperpolarised shifted the window current, increased current density by four-fold, induced robust CDI, suppressed VDI and halved the rate of recovery from inactivation Exon 45a- was derived from an alternative acceptor site This shortened exon caused an intermediate slowing of the recovery rate A novel c-terminal modulator (CTM) domain was recently described in CaV1.4 that was responsible for the abolishment of CDI Here, we demonstrated that modulated activation and inactivation properties by exon 43* splicing was a regulation targeted at the CTM Furthermore, we provide evidence that implicates another c-terminal viii domain responsible for the post-inactivation recovery of the channel Splicing of 43* and 45a- both regulate this domain The biophysical properties of the 43* splice variant suggest that it opens early when the rod photoreceptor recovers from a light pulse, and thus serve to initiate neurotransmitter release at the synapse as well as various mechanisms that maintain sustained exocytosis ix CHAPTER FUTURE PROJECTIONS AND CONCLUSION 6.1 New issues raised 6.1.1 Does CaV1.4 (43*) bind CaBP4? The -20 mV shift in I-V by exon 43* splicing alone cannot account for the 30 mV more negative activation of rod calcium currents compare to WT CaV1.4 expressed in HEK cells Only with the additional -10 mV shift from CaBP4 interaction will 43*-spliced CaV1.4 exhibit the endogenous I-V profile Therefore, it is important to ascertain if CaBP4 binds the alternatively spliced channel in the first place The next issue to address would then be whether the I-V shift modulated by CaBP4 does combine with the I-V shift of 43* in an additive manner 6.1.2 Other important splice-variants for characterisation Combined effects of exon 43* and CaBP4 can, in theory, produce a Ca V1.4 channel that mediates rod-like calcium current However, 43* splicing only comprise 13.6% of the CaV1.4 population Even with the four-fold greater current density, this only boosts its current contribution to around 40% It is altogether possible that the remaining contribution be met out by other splice variants 110 Alternative splicing at the exons 16-18 loci display a >50% occurrence, moreover the IIS6 segment encompassed by these exons exhibited importance in CaV1.4 activation properties Thus it is of much interest to characterise the Ca V1.4 (16a&17a+1) var comprised almost a fifth of the CaV1.4 population, affects the IVS3-S4 linker The length of this linker had been demonstrated to affect channel activation Therefore, characterisation of this variant is also of importance CaBP interacts with the CaV1.2 at the IQ-, pre-IQ and N-ter domains (H Zhou et al., 2004; H Zhou et al., 2005) Splicing of mutually exclusive exon 2x at the N-ter begs the question of whether this variant can still be modulated by CaBP4 6.1.3 Recovery accelerating modulator Modulation of recovery characteristics by exon 43* and 45a-, together with ctail deletion experiments implicated the presence of a domain that accelerates the rate of recovery Whether it does so by channel facilitation or another mechanism remains an open question Subsequent deletion and mutation analyses will help delineate the sequences that comprise this domain We had raised that question of whether the four proline residues that were removed by 45a- splicing had a role in the recovery rate; targeted mutation of these residues will give an indication Once the recovery accelerating modulator has been identified, chimeric expression in other LTCC c-tails will confirm the robustness of its functional properties Coexpression as a complement peptide will determine if it may act independently like 111 the CTM After which it is also important to determine its binding partner/s (i.e proximal c-tail, I- -subunit) so as to shed light on the mechanism in which this domain may have destabilised the inactivated state of the channel and promote recovery 6.1.4 Current density Increased current density in truncated c-tail is a common phenomenon in LTCC However, its mechanism remains elusive It is possible to ascribe this to the loss of the multi-modulating CTM in CaV1.4 and CaV1.3 However, the lack of current density increase in the K1591X CNSB2 mutant (A Singh et al., 2006) suggests that there is more than meets the eye Still, the cut-off point provided by this mutant, residing midway in exon 41, narrows the span of search to between here and exon 43 Scouring the region within this span may yet bring another mechanism to light 6.1.5 Various curiosities Different isoforms of CaV1.4 were suggested to distribute separately to the photoreceptor cell body and synaptic terminus It is therefore curious to determine which these are CaV1.4 is also expressed in other tissues like the adrenal gland and Tlymphocytes (J E McRory et al., 2004) and was grossly up-regulated in the DRG in response to pain stimulation (S P Yusaf et al., 2001b; S P Yusaf et al., 2001a) Speculating on the importance of slow channel inactivation in endocrine release and 112 pain sensitisation, CDI-conferring exon 43* may actually be absent in the adrenal gland and DRG While how CaV1.4 get activated in T-lymphocytes remains to be seen Higher L-type VGCC current amplitudes were detected in photoreceptor and bipolar cells at night than in the day (C Hull et al., 2006; M L Ko et al., 2007) Thus suggesting circadian regulation of channel expression In addition, we also wonder if the repertoire of splice variants may be regulated in a circadian fashion or even regulated in response to prolonged light or dark adaptation 6.2 End notes In this work, we provide evidence that the CaV1.4 gene is alternatively spliced in a multitude of ways Nineteen different types of CaV1.4 splice variants were found in the human retina, occurring with different levels of abundance Each splice variant has the potential to diversify the function of the channel in different ways We demonstrated that two of the alternatively spliced exons from the c-tail altered the activation, inactivation and recovery properties of the channel Exon 43* shifted the I-V relationship of the channel by -20 mV, caused a more hyperpolarised window current, increased the current density by four-fold, restored robust CDI, suppressed VDI and delayed the post-inactivation recovery of the channel by half Splicing of exon 45a- induced an intermediate rate of recovery The CTM was recently described and shown to be responsible for the absence of CDI that is unique to CaV1.4 We demonstrated that modulation of 113 activation and inactivation properties by 43* splicing was solely due to its regulation of the CTM Furthermore, we provide evidence that indicates another c-terminal domain responsible for the post-inactivation recovery of the channel Likewise, the function of this domain was regulated by alternative splicing The biophysical properties of the CaV1.4 (43*) splice variants suggests that it may contribute to the more hyperpolarised-activated nature of rod photoreceptors calcium currents as well as play a role in the CDI observed in rod and bipolar synapses In addition, it may be a suitable candidate to first mediate calcium entry into the rod photoreceptor after its recovers from a light pulse Thus acting like a spark-plug that kick-starts the sustained neurotransmission enginery in the rod photoreceptor synapse 114 REFERENCES Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs Nucleic Acids Res 25:3389-3402 Bader CR, MacLeish PR, Schwartz EA (1978) Responses to light of solitary rod photoreceptors isolated from tiger salamander retina Proc Natl Acad Sci U S A 75:3507-3511 Bader CR, Bertrand D, Schwartz EA (1982) Voltage-activated and calcium-activated currents studied in solitary rod inner segments from the salamander retina J Physiol 331:253-284 Ball SL, Powers PA, Shin HS, Morgans CW, Peachey NS, Gregg RG (2002) Role of the beta(2) subunit of voltage-dependent calcium channels in the retinal outer plexiform layer Invest Ophthalmol Vis Sci 43:1595-1603 Barnes S (1994) After transduction: response shaping and control of transmission by ion channels of the photoreceptor inner segments Neuroscience 58:447-459 Baumann L, Gerstner A, Zong X, Biel M, Wahl-Schott C (2004) Functional characterization of the L-type Ca2+ channel Cav1.4alpha1 from mouse retina Invest Ophthalmol Vis Sci 45:708-713 Baylor DA, Nunn BJ (1986) Electrical properties of the light-sensitive conductance of rods of the salamander Ambystoma tigrinum J Physiol 371:115-145 Baylor DA, Lamb TD, Yau KW (1979) The membrane current of single rod outer segments J Physiol 288:589-611 Bech-Hansen NT, Naylor MJ, Maybaum TA, Pearce WG, Koop B, Fishman GA, Mets M, Musarella MA, Boycott KM (1998) Loss-of-function mutations in a calcium-channel alpha1-subunit gene in Xp11.23 cause incomplete X-linked congenital stationary night blindness Nat Genet 19:264-267 Berntson A, Taylor WR, Morgans CW (2003) Molecular identity, synaptic localization, and physiology of calcium channels in retinal bipolar cells J Neurosci Res 71:146-151 Bichet D, Cornet V, Geib S, Carlier E, Volsen S, Hoshi T, Mori Y, De Waard M (2000) The I-II loop of the Ca2+ channel alpha1 subunit contains an endoplasmic reticulum retention signal antagonized by the beta subunit Neuron 25:177-190 Boycott KM, Maybaum TA, Naylor MJ, Weleber RG, Robitaille J, Miyake Y, Bergen AA, Pierpont ME, Pearce WG, Bech-Hansen NT (2001) A summary of 20 CACNA1F mutations identified in 36 families with incomplete X-linked congenital stationary night blindness, and characterization of splice variants Hum Genet 108:91-97 Burkhardt DA, Zhang SQ, Gottesman J (1991) Prolonged depolarization in rods in situ Vis Neurosci 6:607-614 115 Cadetti L, Bryson EJ, Ciccone CA, Rabl K, Thoreson WB (2006) Calcium-induced calcium release in rod photoreceptor terminals boosts synaptic transmission during maintained depolarization Eur J Neurosci 23:2983-2990 Calin-Jageman I, Yu K, Hall RA, Mei L, Lee A (2007) Erbin enhances voltage-dependent facilitation of Ca(v)1.3 Ca2+ channels through relief of an autoinhibitory domain in the Ca(v)1.3 alpha1 subunit J Neurosci 27:1374-1385 Carabelli V, Marcantoni A, Comunanza V, Carbone E (2007) Fast exocytosis mediated by Tand L-type channels in chromaffin cells: distinct voltage-dependence but similar Ca2+ -dependence Eur Biophys J 36:753-762 Catterall WA (2000) Structure and regulation of voltage-gated Ca2+ channels Annu Rev Cell Dev Biol 16:521-555 Catterall WA, Perez-Reyes E, Snutch TP, Striessnig J (2005) International Union of Pharmacology XLVIII Nomenclature and structure-function relationships of voltagegated calcium channels Pharmacol Rev 57:411-425 Cens T, Restituito S, Galas S, Charnet P (1999) Voltage and calcium use the same molecular determinants to inactivate calcium channels J Biol Chem 274:5483-5490 Chenchik A, Diachenko L, Moqadam F, Tarabykin V, Lukyanov S, Siebert PD (1996) Full-length cDNA cloning and determination of mRNA 5' and 3' ends by amplification of adaptor-ligated cDNA Biotechniques 21:526-534 Cia D, Bordais A, Varela C, Forster V, Sahel JA, Rendon A, Picaud S (2005) Voltage-gated channels and calcium homeostasis in mammalian rod photoreceptors J Neurophysiol 93:1468-1475 Corey DP, Dubinsky JM, Schwartz EA (1984) The calcium current in inner segments of rods from the salamander (Ambystoma tigrinum) retina J Physiol 354:557-575 Dick IE, Tadross MR, Liang H, Tay LH, Yang W, Yue DT (2008) A modular switch for spatial Ca2+ selectivity in the calmodulin regulation of CaV channels Nature 451:830-834 Doering CJ, Rehak R, Bonfield S, Peloquin JB, Stell WK, Mema SC, Sauve Y, McRory JE (2008) Modified Ca(v)1.4 expression in the Cacna1f(nob2) mouse due to alternative splicing of an ETn inserted in exon PLoS ONE 3:e2538 Erickson MG, Liang H, Mori MX, Yue DT (2003) FRET two-hybrid mapping reveals function and location of L-type Ca2+ channel CaM preassociation Neuron 39:97-107 Fain GL, Quandt FN, Bastian BL, Gerschenfeld HM (1978) Contribution of a caesium-sensitive conductance increase to the rod photoresponse Nature 272:466-469 Fisher SE, Ciccodicola A, Tanaka K, Curci A, Desicato S, D'Urso M, Craig IW (1997) Sequencebased exon prediction around the synaptophysin locus reveals a gene-rich area containing novel genes in human proximal Xp Genomics 45:340-347 116 Gao T, Cuadra AE, Ma H, Bunemann M, Gerhardstein BL, Cheng T, Eick RT, Hosey MM (2001) C-terminal fragments of the alpha 1C (CaV1.2) subunit associate with and regulate Ltype calcium channels containing C-terminal-truncated alpha 1C subunits J Biol Chem 276:21089-21097 Gray AC, Raingo J, Lipscombe D (2007) Neuronal calcium channels: splicing for optimal performance Cell Calcium 42:409-417 Gullapalli S, Ramarao P (2002) L-type Ca2+ channel modulation by dihydropyridines potentiates kappa-opioid receptor agonist induced acute analgesia and inhibits development of tolerance in rats Neuropharmacology 42:467-475 Haeseleer F, Imanishi Y, Maeda T, Possin DE, Maeda A, Lee A, Rieke F, Palczewski K (2004) Essential role of Ca2+-binding protein 4, a Cav1.4 channel regulator, in photoreceptor synaptic function Nat Neurosci 7:1079-1087 Halling DB, Aracena-Parks P, Hamilton SL (2006) Regulation of voltage-gated Ca2+ channels by calmodulin Sci STKE 2006:er1 Heidelberger R, Thoreson WB, Witkovsky P (2005) Synaptic transmission at retinal ribbon synapses Prog Retin Eye Res 24:682-720 Hemara-Wahanui A, Berjukow S, Hope CI, Dearden PK, Wu SB, Wilson-Wheeler J, Sharp DM, Lundon-Treweek P, Clover GM, Hoda JC, Striessnig J, Marksteiner R, Hering S, Maw MA (2005) A CACNA1F mutation identified in an X-linked retinal disorder shifts the voltage dependence of Cav1.4 channel activation Proc Natl Acad Sci USA 102:75537558 Hermosilla R, Schulein R (2001) Sorting functions of the individual cytoplasmic domains of the G protein-coupled vasopressin V(2) receptor in Madin Darby canine kidney epithelial cells Mol Pharmacol 60:1031-1039 Hoda JC, Zaghetto F, Koschak A, Striessnig J (2005) Congenital stationary night blindness type mutations S229P, G369D, L1068P, and W1440X alter channel gating or functional expression of Ca(v)1.4 L-type Ca2+ channels J Neurosci 25:252-259 Hofmann F, Biel M, Flockerzi V (1994) Molecular basis for Ca2+ channel diversity Annu Rev Neurosci 17:399-418 Hohaus A, Beyl S, Kudrnac M, Berjukow S, Timin EN, Marksteiner R, Maw MA, Hering S (2005) Structural determinants of L-type channel activation in segment IIS6 revealed by a retinal disorder J Biol Chem 280:38471-38477 Huang Z, Li G, Pei W, Sosa LA, Niu L (2005) Enhancing protein expression in single HEK 293 cells J Neurosci Methods 142:159-166 Hull C, Studholme K, Yazulla S, von Gersdorff H (2006) Diurnal changes in exocytosis and the number of synaptic ribbons at active zones of an ON-type bipolar cell terminal J Neurophysiol 96:2025-2033 117 Hulme JT, Yarov-Yarovoy V, Lin TW, Scheuer T, Catterall WA (2006) Autoinhibitory control of the CaV1.2 channel by its proteolytically processed distal C-terminal domain J Physiol 576:87-102 Hulme JT, Konoki K, Lin TW, Gritsenko MA, Camp DG, 2nd, Bigelow DJ, Catterall WA (2005) Sites of proteolytic processing and noncovalent association of the distal C-terminal domain of CaV1.1 channels in skeletal muscle Proc Natl Acad Sci U S A 102:52745279 Ivanina T, Blumenstein Y, Shistik E, Barzilai R, Dascal N (2000) Modulation of L-type Ca2+ channels by gbeta gamma and calmodulin via interactions with N and C termini of alpha 1C J Biol Chem 275:39846-39854 Jalkanen R, Mäntyjärvi M, Tobias R, Isosomppi J, Sankila EM, Alitalo T, Bech-Hansen NT (2006) X linked cone-rod dystrophy, CORDX3, is caused by a mutation in the CACNA1F gene J Med Genet 43:699-704 Jalkanen R, Bech-Hansen NT, Tobias R, Sankila EM, Mantyjarvi M, Forsius H, de la Chapelle A, Alitalo T (2007) A novel CACNA1F gene mutation causes Aland Island eye disease Invest Ophthalmol Vis Sci 48:2498-2502 Johnson JM, Castle J, Garrett-Engele P, Kan Z, Loerch PM, Armour CD, Santos R, Schadt EE, Stoughton R, Shoemaker DD (2003) Genome-wide survey of human alternative premRNA splicing with exon junction microarrays Science 302:2141-2144 Jurkat-Rott K, Lehmann-Horn F (2004) The impact of splice isoforms on voltage-gated calcium channel alpha1 subunits J Physiol 554:609-619 Katsura M, Mohri Y, Shuto K, Hai-Du Y, Amano T, Tsujimura A, Sasa M, Ohkuma S (2002) Upregulation of L-type voltage-dependent calcium channels after long term exposure to nicotine in cerebral cortical neurons J Biol Chem 277:7979-7988 Kawai F, Horiguchi M, Suzuki H, Miyachi E (2002) Modulation by hyperpolarization-activated cationic currents of voltage responses in human rods Brain Res 943:48-55 Ko ML, Liu Y, Dryer SE, Ko GY (2007) The expression of L-type voltage-gated calcium channels in retinal photoreceptors is under circadian control J Neurochem 103:784-792 Koschak A, Reimer D, Walter D, Hoda JC, Heinzle T, Grabner M, Striessnig J (2003) Cav1.4alpha1 subunits can form slowly inactivating dihydropyridine-sensitive L-type Ca2+ channels lacking Ca2+-dependent inactivation J Neurosci 23:6041-6049 Kotturi MF, Carlow DA, Lee JC, Ziltener HJ, Jefferies WA (2003) Identification and functional characterization of voltage-dependent calcium channels in T lymphocytes J Biol Chem 278:46949-46960 Krawczak M, Reiss J, Cooper DN (1992) The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences Hum Genet 90:41-54 118 Krizaj D, Lai FA, Copenhagen DR (2003) Ryanodine stores and calcium regulation in the inner segments of salamander rods and cones J Physiol 547:761-774 Lee TS, Karl R, Moosmang S, Lenhardt P, Klugbauer N, Hofmann F, Kleppisch T, Welling A (2006) Calmodulin kinase II is involved in voltage-dependent facilitation of the L-type Cav1.2 calcium channel: Identification of the phosphorylation sites J Biol Chem 281:25560-25567 Liao P, Yong TF, Liang MC, Yue DT, Soong TW (2005) Splicing for alternative structures of Cav1.2 Ca2+ channels in cardiac and smooth muscles Cardiovasc Res 68:197-203 Liao P, Yu D, Li G, Yong TF, Soon JL, Chua YL, Soong TW (2007) A smooth muscle Cav1.2 calcium channel splice variant underlies hyperpolarized window current and enhanced state-dependent inhibition by nifedipine J Biol Chem 282:35133-35142 Liao P, Yu D, Lu S, Tang Z, Liang MC, Zeng S, Lin W, Soong TW (2004) Smooth muscleselective alternatively spliced exon generates functional variation in Cav1.2 calcium channels J Biol Chem 279:50329-50335 Little HJ (1991) The role of neuronal calcium channels in dependence on ethanol and other sedatives/hypnotics Pharmacol Ther 50:347-365 Mansergh F, Orton NC, Vessey JP, Lalonde MR, Stell WK, Tremblay F, Barnes S, Rancourt DE, Bech-Hansen NT (2005) Mutation of the calcium channel gene Cacna1f disrupts calcium signaling, synaptic transmission and cellular organization in mouse retina Hum Mol Genet 14:3035-3046 Marcantoni A, Carabelli V, Comunanza V, Hoddah H, Carbone E (2008) Calcium channels in chromaffin cells: focus on L and T types Acta Physiol (Oxf) 192:233-246 McRory JE, Hamid J, Doering CJ, Garcia E, Parker R, Hamming K, Chen L, Hildebrand M, Beedle AM, Feldcamp L, Zamponi GW, Snutch TP (2004) The CACNA1F gene encodes an L-type calcium channel with unique biophysical properties and tissue distribution J Neurosci 24:1707-1718 Mezghrani A, Monteil A, Watschinger K, Sinnegger-Brauns MJ, Barrere C, Bourinet E, Nargeot J, Striessnig J, Lory P (2008) A destructive interaction mechanism accounts for dominant-negative effects of misfolded mutants of voltage-gated calcium channels J Neurosci 28:4501-4511 Michelsen K, Yuan H, Schwappach B (2005) Hide and run Arginine-based endoplasmicreticulum-sorting motifs in the assembly of heteromultimeric membrane proteins EMBO Rep 6:717-722 Mittman S, Guo J, Agnew WS (1999a) Structure and alternative splicing of the gene encoding alpha1G, a human brain T calcium channel alpha1 subunit Neurosci Lett 274:143146 Mittman S, Guo J, Emerick MC, Agnew WS (1999b) Structure and alternative splicing of the gene encoding alpha1I, a human brain T calcium channel alpha1 subunit Neurosci Lett 269:121-124 119 Miyake Y, Yagasaki K, Horiguchi M, Kawase Y, Kanda T (1986) Congenital stationary night blindness with negative electroretinogram A new classification Arch Ophthalmol 104:1013-1020 Morgans CW (2001) Localization of the alpha(1F) calcium channel subunit in the rat retina Invest Ophthalmol Vis Sci 42:2414-2418 Morgans CW, Gaughwin P, Maleszka R (2001) Expression of the alpha1F calcium channel subunit by photoreceptors in the rat retina Mol Vis 7:202-209 Morgans CW, Bayley PR, Oesch NW, Ren G, Akileswaran L, Taylor WR (2005) Photoreceptor calcium channels: insight from night blindness Vis Neurosci 22:561-568 Mori MX, Erickson MG, Yue DT (2004) Functional stoichiometry and local enrichment of calmodulin interacting with Ca2+ channels Science 304:432-435 Moriondo A, Pelucchi B, Rispoli G (2001) Calcium-activated potassium current clamps the dark potential of vertebrate rods Eur J Neurosci 14:19-26 Morrill JA, Cannon SC (2000) COOH-terminal truncated alpha(1S) subunits conduct current better than full-length dihydropyridine receptors J Gen Physiol 116:341-348 Nakamura M, Ito S, Terasaki H, Miyake Y (2001) Novel CACNA1F mutations in Japanese patients with incomplete congenital stationary night blindness Invest Ophthalmol Vis Sci 42:1610-1616 Naylor MJ, Rancourt DE, Bech-Hansen NT (2000) Isolation and characterization of a calcium channel gene, Cacna1f, the murine orthologue of the gene for incomplete X-linked congenital stationary night blindness Genomics 66:324-327 Page KM, Heblich F, Davies A, Butcher AJ, Leroy J, Bertaso F, Pratt WS, Dolphin AC (2004) Dominant-negative calcium channel suppression by truncated constructs involves a kinase implicated in the unfolded protein response J Neurosci 24:5400-5409 Peloquin JB, Rehak R, Doering CJ, McRory JE (2007) Functional analysis of congenital stationary night blindness type-2 CACNA1F mutations F742C, G1007R, and R1049W Neuroscience 150:335-345 Perez-Alvarez A, Hernandez-Vivanco A, Cano-Abad M, Albillos A (2008) Pharmacological and biophysical properties of Ca(2+) channels and subtype distributions in human adrenal chromaffin cells Pflugers Arch 456:1149-1162 Peterson BZ, DeMaria CD, Adelman JP, Yue DT (1999) Calmodulin is the Ca2+ sensor for Ca2+ -dependent inactivation of L-type calcium channels Neuron 22:549-558 Pitt GS (2007) Calmodulin and CaMKII as molecular switches for cardiac ion channels Cardiovasc Res 73:641-647 Pragnell M, De Waard M, Mori Y, Tanabe T, Snutch TP, Campbell KP (1994) Calcium channel beta-subunit binds to a conserved motif in the I-II cytoplasmic linker of the alpha 1subunit Nature 368:67-70 120 Rabl K, Thoreson WB (2002) Calcium-dependent inactivation and depletion of synaptic cleft calcium ions combine to regulate rod calcium currents under physiological conditions Eur J Neurosci 16:2070-2077 Raghib A, Bertaso F, Davies A, Page KM, Meir A, Bogdanov Y, Dolphin AC (2001) Dominantnegative synthesis suppression of voltage-gated calcium channel Cav2.2 induced by truncated constructs J Neurosci 21:8495-8504 Ren D, Hall LM (1997) Functional expression and characterization of skeletal muscle dihydropyridine receptors in Xenopus oocytes J Biol Chem 272:22393-22396 Schneeweis DM, Schnapf JL (1995) Photovoltage of rods and cones in the macaque retina Science 268:1053-1056 Schneeweis DM, Schnapf JL (2000) Noise and light adaptation in rods of the macaque monkey Vis Neurosci 17:659-666 Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY (2004) Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp red fluorescent protein Nat Biotechnol 22:1567-1572 Sharp PA, Burge CB (1997) Classification of introns: U2-type or U12-type Cell 91:875-879 Shen Y, Yu D, Hiel H, Liao P, Yue DT, Fuchs PA, Soong TW (2006) Alternative splicing of the Ca(v)1.3 channel IQ domain, a molecular switch for Ca2+-dependent inactivation within auditory hair cells J Neurosci 26:10690-10699 Shistik E, Ivanina T, Blumenstein Y, Dascal N (1998) Crucial role of N terminus in function of cardiac L-type Ca2+ channel and its modulation by protein kinase C J Biol Chem 273:17901-17909 Singh A, Hamedinger D, Hoda JC, Gebhart M, Koschak A, Romanin C, Striessnig J (2006) Cterminal modulator controls Ca2+-dependent gating of Ca(v)1.4 L-type Ca2+ channels Nat Neurosci 9:1108-1116 Singh A, Gebhart M, Fritsch R, Sinnegger-Brauns MJ, Poggiani C, Hoda JC, Engel J, Romanin C, Striessnig J, Koschak A (2008) Modulation of voltage- and Ca2+-dependent gating of CaV1.3 L-type calcium channels by alternative splicing of a C-terminal regulatory domain J Biol Chem 283:20733-20744 Sluka KA (1997) Blockade of calcium channels can prevent the onset of secondary hyperalgesia and allodynia induced by intradermal injection of capsaicin in rats Pain 71:157-164 Soderling TR (1996) Structure and regulation of calcium/calmodulin-dependent protein kinases II and IV Biochim Biophys Acta 1297:131-138 Somlyo AP, Walz B (1985) Elemental distribution in Rana pipiens retinal rods: quantitative electron probe analysis J Physiol 358:183-195 121 Soong TW, DeMaria CD, Alvania RS, Zweifel LS, Liang MC, Mittman S, Agnew WS, Yue DT (2002) Systematic identification of splice variants in human P/Q-type channel alpha1(2.1) subunits: implications for current density and Ca2+-dependent inactivation J Neurosci 22:10142-10152 Stotz SC, Hamid J, Spaetgens RL, Jarvis SE, Zamponi GW (2000) Fast inactivation of voltagedependent calcium channels A hinged-lid mechanism? J Biol Chem 275:2457524582 Stroffekova K (2008) Ca2+/CaM-dependent inactivation of the skeletal muscle L-type Ca2+ channel (Cav1.1) Pflugers Arch 455:873-884 Strom TM, Nyakatura G, Apfelstedt-Sylla E, Hellebrand H, Lorenz B, Weber BH, Wutz K, Gutwillinger N, Rüther K, Drescher B, Sauer C, Zrenner E, Meitinger T, Rosenthal A, Meindl A (1998) An L-type calcium-channel gene mutated in incomplete X-linked congenital stationary night blindness Nat Genet 19:260-263 Suryanarayanan A, Slaughter MM (2006) Synaptic transmission mediated by internal calcium stores in rod photoreceptors J Neurosci 26:1759-1766 Szikra T, Cusato K, Thoreson WB, Barabas P, Bartoletti TM, Krizaj D (2008) Depletion of calcium stores regulates calcium influx and signal transmission in rod photoreceptors J Physiol 586:4859-4875 Tadross MR, Dick IE, Yue DT (2008) Mechanism of local and global Ca2+ sensing by calmodulin in complex with a Ca2+ channel Cell 133:1228-1240 Tang ZZ, Liang MC, Lu S, Yu D, Yu CY, Yue DT, Soong TW (2004) Transcript scanning reveals novel and extensive splice variations in human l-type voltage-gated calcium channel, Cav1.2 alpha1 subunit J Biol Chem 279:44335-44343 Tang ZZ, Liao P, Li G, Jiang FL, Yu D, Hong X, Yong TF, Tan G, Lu S, Wang J, Soong TW (2008) Differential splicing patterns of L-type calcium channel Cav1.2 subunit in hearts of Spontaneously Hypertensive Rats and Wistar Kyoto Rats Biochim Biophys Acta 1783:118-130 Thoreson WB (2007) Kinetics of synaptic transmission at ribbon synapses of rods and cones Mol Neurobiol 36:205-223 Thoreson WB, Nitzan R, Miller RF (2000) Chloride efflux inhibits single calcium channel open probability in vertebrate photoreceptors: chloride imaging and cell-attached patchclamp recordings Vis Neurosci 17:197-206 Thoreson WB, Tranchina D, Witkovsky P (2003) Kinetics of synaptic transfer from rods and cones to horizontal cells in the salamander retina Neuroscience 122:785-798 Thoreson WB, Rabl K, Townes-Anderson E, Heidelberger R (2004) A highly Ca2+-sensitive pool of vesicles contributes to linearity at the rod photoreceptor ribbon synapse Neuron 42:595-605 122 von Gersdorff H, Matthews G (1996) Calcium-dependent inactivation of calcium current in synaptic terminals of retinal bipolar neurons J Neurosci 16:115-122 Wahl-Schott C, Baumann L, Cuny H, Eckert C, Griessmeier K, Biel M (2006) Switching off calcium-dependent inactivation in L-type calcium channels by an autoinhibitory domain Proc Natl Acad Sci U S A 103:15657-15662 Walker D, De Waard M (1998) Subunit interaction sites in voltage-dependent Ca2+ channels: role in channel function Trends Neurosci 21:148-154 Wei J, Hemmings GP (2006) A further study of a possible locus for schizophrenia on the X chromosome Biochem Biophys Res Commun 344:1241-1245 Wei X, Neely A, Lacerda AE, Olcese R, Stefani E, Perez-Reyes E, Birnbaumer L (1994) Modification of Ca2+ channel activity by deletions at the carboxyl terminus of the cardiac alpha subunit J Biol Chem 269:1635-1640 Wilton SD, Fletcher S (2005) RNA splicing manipulation: strategies to modify gene expression for a variety of therapeutic outcomes Curr Gene Ther 5:467-483 Witkovsky P, Schmitz Y, Akopian A, Krizaj D, Tranchina D (1997) Gain of rod to horizontal cell synaptic transfer: relation to glutamate release and a dihydropyridine-sensitive calcium current J Neurosci 17:7297-7306 Xu JW, Slaughter MM (2005) Large-conductance calcium-activated potassium channels facilitate transmitter release in salamander rod synapse J Neurosci 25:7660-7668 Xu W, Lipscombe D (2001) Neuronal Ca(V)1.3alpha(1) L-type channels activate at relatively hyperpolarized membrane potentials and are incompletely inhibited by dihydropyridines J Neurosci 21:5944-5951 Yusaf SP, Goodman J, Pinnock RD, Dixon AK, Lee K (2001a) Expression of voltage-gated calcium channel subunits in rat dorsal root ganglion neurons Neurosci Lett 311:137141 Yusaf SP, Goodman J, Gonzalez IM, Bramwell S, Pinnock RD, Dixon AK, Lee K (2001b) Streptozocin-induced neuropathy is associated with altered expression of voltagegated calcium channel subunit mRNAs in rat dorsal root ganglion neurones Biochem Biophys Res Commun 289:402-406 Zerangue N, Schwappach B, Jan YN, Jan LY (1999) A new ER trafficking signal regulates the subunit stoichiometry of plasma membrane K(ATP) channels Neuron 22:537-548 Zhou H, Yu K, McCoy KL, Lee A (2005) Molecular mechanism for divergent regulation of Cav1.2 Ca2+ channels by calmodulin and Ca2+-binding protein-1 J Biol Chem 280:29612-29619 Zhou H, Kim SA, Kirk EA, Tippens AL, Sun H, Haeseleer F, Lee A (2004) Ca2+-binding protein-1 facilitates and forms a postsynaptic complex with Cav1.2 (L-type) Ca2+ channels J Neurosci 24:4698-4708 123 Zhuchenko O, Bailey J, Bonnen P, Ashizawa T, Stockton DW, Amos C, Dobyns WB, Subramony SH, Zoghbi HY, Lee CC (1997) Autosomal dominant cerebellar ataxia (SCA6) associated with small polyglutamine expansions in the alpha 1A-voltagedependent calcium channel Nat Genet 15:62-69 Zuhlke RD, Pitt GS, Tsien RW, Reuter H (2000) Ca2+-sensitive inactivation and facilitation of L-type Ca2+ channels both depend on specific amino acid residues in a consensus calmodulin-binding motif in the(alpha)1C subunit J Biol Chem 275:21121-21129 Zuhlke RD, Pitt GS, Deisseroth K, Tsien RW, Reuter H (1999) Calmodulin supports both inactivation and facilitation of L-type calcium channels Nature 399:159-162 124 ... over the stop codon of the CaV1. 4 gene The PCR product was cloned into the pGEM® T Easy vector This clone was labelled as CaV1. 4 (43 51 5977) pGEM® T Easy B, the c ter of CaV1. 4 was excised out of. .. vector 42 d+ SbfI Clone into CaV1. 4 (43 51 5977) pGEM T Easy via SbfI sites SbfI CaV1. 4 (43 51 5977) SbfI SbfI pGEM® T Easy vector CaV1. 4 (43 51 5977, 42 d+) E Ch 42 d+: NotI BclI CaV1. 2 CaV1. 4 42d+... exons 44 -47 40 44 45 46 Forward primer for transcript scanning exons 47 -48 TGGGTAAATCCTCACAACTG 46 46 Forward primer for transcript scanning exon 48 Reverse primer for transcript scanning exons 44 -47