Structural studies of glycogen branching enzyme (GLGB) CRFE2alpha urucortin complexes

STRUCTURAL STUDIES OF GLYCOGEN BRANCHING ENZYME (GLGB) AND CRFR2α:UROCORTIN COMPLEXES KUNTAL PAL A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2010 STRUCTURAL STUDIES OF GLYCOGEN BRANCHING ENZYME (GLGB) AND CRFR2α:UROCORTIN COMPLEXES KUNTAL PAL (M.Tech Biotech. And Biochem. Engg.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2010 To my dear parents and teachers “If we ask further what significance belongs to the results gained in this study of tuberculosis it must be considered a gain for science that it has been possible for the first credible breadth of the mycobacterial literature, but time to establish the complete proof of the parasitic nature of a human infectious disease, and this of the most important one. So far such proof was established only for anthrax, while in a number of other infectious diseases in human beings, for example relapsing fever, wound infections, leprosy, gonorrhoea, it was only known that parasites occur simultaneously with the pathogenic process, but the causal connection between the two has not been established. It may be expected that the elucidation of the aetiology of tuberculosis will provide new viewpoints for the study of other infectious diseases.” —Robert Koch, 1882 First of all, a heartfelt ‘Thank you’ to my family and especially, my parents and all friends, whose continuous inspiration and moral support helped me a lot to reach my destination. My supervisor Dr. K. Swaminathan has been a constant source of guidance, encouragement and support in pursuing my PhD. During the past four years he not only provided me an opportunity to learn protein biochemistry and crystallography, but also a level of confidence to handle a project independently. I wish to thank him for paving my way for a good scientific future. Next, I want to convey my special thanks to Dr. Eric H. Xu, Laboratory of Structural Sciences, Van Andel Research Institute (VAI), Michigan for the opportunity he gave me to work in his lab on the hCRFR2α project. His proper guidance and ideas on every weekend meeting really helped me a lot to finish my project in limited time. I cannot forget the help I received at the VAI lab from Drs. Augen A. Pioszak, Krishna Vukoti and Abhisekh Bandyopadhyay, along with Jennifer and Amanda. I extend my special thanks to Dr. Pushpa Agarwal for the collaboration on the GlgB project. I This is a great opportunity to say thanks to the previous lab members of Lab4 and 5. Initial help from Dileep Vaasudevan, research related support and other discussions with Jobichen Chako, Cherlyn Ng and Rajesh Shenoy gradually trained me in performing experiments in the proper direction. It was a great experience and pleasure to work with them. Also, good friendship with Shiva Kumar, Vinod Roy, Sunil Tewary, Smarajit and Soumyo, provided me a constant support throughout the four years of my PhD. Thanks to everyone in the structural biology corridor, including Toan, Vindhya, Anupama, Feng Xia, Kanmani, Umar, Suguna, Moorthy, Vamsi, Deepthi, Thangavelu, Manjeet, Abhilash, Priyanka, Vivek , Kartik, Tan and Sang. Finally, I want to thank NUS for my research scholarship, which supported my four years of stay in Singapore and the short term attachment visit in the US and thus helped me to pursue my research. II TABLE OF CONTENTS ACKNOWLEDGEMENTS TABLE OF CONTENTS LIST OF FIGURES LIST OF TABLES LIST OF PUBLICATION SUMMARY CHAPTER 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 1.10 I III VI VII IX X X-RAY CRYSTALLOGRAPHY STRUCTURAL STUDIES OF MACROMOLECULES CRSYTALLOGRAPHY 1.2.1 The Unit Cell 1.2.2 Lattices,planes and indices 1.2.3 Symmetry operation, point groups and space groups 1.2.4 Bragg’s law: the condition that produces diffraction 1.2.5 Braggs’s law in reciprocal lattice 1.2.6 Ewald Sphere PROTEIN CRYSTALLIZATION AND DATA COLLECTION X-RAY DIFFRACTION 1.4.1 X-ray sources 1.4.2 Geometric data collection DATA REDUCTION WAVES, FOURIER SYNTHESIS AND FOURIER TRANSFORM ELECTRON DENSITY AS FOURIER SERIES PHASE PROBLEM 1.8.1 Patterson function 1.8.2 Isomorphous replacement 1.8.3 Direct methods 1.8.4 Anamolous dispersion 1.8.5 Molecular replacement MODEL BUILDING AND REFINEMENT 1.9.1 Least-square methods 1.9.2 Molecular dynamics refinement 1.9.3 Additional parameters for refinement IMPROVEMENT IN MAP 1.10.1 Solvent flattening 1.10.2 Extension of phases 2 10 11 12 12 13 14 15 16 16 17 17 18 18 20 21 22 22 24 24 24 III 1.11 1.12 1.10.3 Non-crystallographic symmetry averaging FINAL STRUCTURE DEPOSITION OF PROTEIN STRUCTURE CHAPTER 2.1 2.2 2.3 2.4 2.5 3.1. 3.2. 4.2. 4.3 5.1 5.2 5.3 5.4 5.5 40 40 40 41 RESULTS AND DISCUSSION STRUCTURE OF FULL LENGTH MYCOBACTERIUM TUBERCULOSIS GLGB 4.1.1 Structural overview of WTMtbGlgB 4.1.2 Catalytic domain 4.1.3 Structural details of N1 domain 4.1.4 Structural alignment of WTMtbGlgB with ECΔ117GlgB ENZYME ACTIVITY/KINETICS 4.2.1 Substrate utilization 4.2.2 Enzyme Inhibition DISCUSSION 4.3.1 Influence of the N1 domain 4.3.2 Catalytic mechanism 4.3.3 Truncation mutants 4.3.4 Clinical significance 4.3.5 GlgB as a drug target CHAPTER 30 31 32 36 38 MATERIALS AND METHODS PROTEIN EXPRESSION AND PURIFICATION 3.1.1 Protein expression 3.1.2 Protein purification X-RAY CRYSTALLOGRAPHY CHAPTER 4.1. BIOLOGICAL SIGNIFICANCE OF GLGB TUBERCULOSIS MYCOBACTERIUM TUBERCULOSIS H37RV GLYCOGEN BIOSYNTHESIS α- GLUCAN GLYCOGEN BRANCHING ENZYME CHAPTER 25 26 26 45 45 46 49 50 51 51 52 54 54 54 55 56 57 BIOLOGICAL SIGNIFICANCE OF CRFR2α G-PROTEIN COUPLED RECEPTORS AND G PROTEINS CLASS B GPCRS CRF PEPTIDE FAMILY CORTICOTROPHIN RELEASE FACTOR RECEPTORS STRUCTURAL AND FUNCTIONAL IMPLICATION 64 66 68 70 73 IV CHAPTER 6.1 6.2 6.3 6.4 MOLECULAR CLONING PROTEIN EXPRESSION AND PURIFICATION X-RAY CRYSTALLOGRAPHY ALPHA SCREEN COMPETITIVE ASSAY CHAPTER 7.1 7.2 MATERIALS AND METHODS 74 75 77 79 RESULT AND DISCUSSION RESULTS 81 7.1.1 Expression and purification of active MBP-hCRFR2α 81 7.1.2 Selective ligand binding properties by extracellular domain of CRFRs 83 7.1.3 Crystal structure of HCRFR2α-ECD and alignment with HCRFR1ECD 85 7.1.4 Crystal structure of MBP-HCRFR2α-ECD-UCN1 complex 90 7.1.5 Crystal structure of MBP-HCRFR2α-ECD in complex with UCN and 94 7.1.6 ECD binding studies with recipocaly exchanged UCN1 and mutants 97 DISCUSSION 101 7.2.1 The crystal structure of MBP-hCRFR2α-ECD 101 7.2.2 The crystal structures of MBP-hCRFR2α-ECD in complex Urocortin 1, and 101 7.2.3 CRF/UCN selectivity is determined by ECDs alone and Ucn1 has highest affinity 104 7.2.4 Role of structures in drug designing 106 V LIST OF FIGURES Page Figure 1.1 Seven basic unit-cells Figure 1.2 The 14 Bravais lattices Figure 1.3 Miller indices of some planes in a unit-cell Figure 1.4 Bragg’s law, that governs diffraction Figure 1.5 The reciprocal lattice Figure 1.6 The Ewald Sphere Figure 1.7 The four-circle diffractometer 13 Figure 2.1 The glycogen biosynthesis pathway representing the related enzymes. 34 Figure 2.2 Formation of a glycogen branch 35 Figure 2.3 The glucan biosynthesis pathway in prokaryotes 37 Figure 3.1 The gel filtration and SDS-PAGE purification profile of MtbGlgBWT using a Superdex S200 26/60 column 42 Figure 3.2 The initial crystal of GlgB 43 Figure 4.1 Structure of full length WTMtbGlgB at 2.33 Å 45 Figure 4.2 The catalytic pocket of GlgB 47 Figure 4.3 Structural details of N1 domain 50 Figure 4.4 Superimposition of MtbGlgB and ECΔ112GlgB 51 Figure 4.5 MtbGlgBWT Enzyme assays and kinetic studies 53 Figure 4.6 Lineweaver-Burke plots for MtbGlgBWT and MtbΔ108GlgB 53 Figure 4.7 Mechanism of glycogen branching 55 Figure 4.8 Sequence alignment of GlgB from pathogenic strains 60 VI References Cywes, C., Hoppe, H.C., Daffe, M. and Ehlers, M.R. (1997). Nonopsonic binding of Mycobacterium tuberculosis to complement receptor type is mediated by capsular polysaccharides and is strain dependent. Infect Immun, 65, 4258-66. Daffe, M. and Draper, P. (1998). The envelope layers of mycobacteria with reference to their pathogenicity. Adv Microb Physiol, 39, 131-203. Davis, I.W., Leaver-Fay, A., Chen, V.B., Block, J.N., Kapral, G.J., Wang, X., Murray, L.W., Arendall, W.B., 3rd, Snoeyink, J., Richardson, J.S. and Richardson, D.C. (2007). MolProbity: all-atom contacts and structure validation for proteins and nucleic acids. Nucleic Acids Res, 35, W375-83. DeLano, W. (2002). DeLano Scientific, Palo Alto, CA. Deussing, J.M., Breu, J., Kuhne, C., Kallnik, M., Bunck, M., Glasl, L., Yen, Y.C., Schmidt, M.V., Zurmuhlen, R., Vogl, A.M., Gailus-Durner, V., Fuchs, H., Holter, S.M., Wotjak, C.T., Landgraf, R., de Angelis, M.H., Holsboer, F. and Wurst, W. (2010). Urocortin modulates social discrimination abilities via corticotropin-releasing hormone receptor type 2. J Neurosci, 30, 9103-16. Devillers, C.H., Piper, M.E., Ballicora, M.A. and Preiss, J. (2003). Characterization of the branching patterns of glycogen branching enzyme truncated on the Nterminus. Arch Biochem Biophys, 418, 34-8. Diederichs, K. and Karplus, P.A. (1997). Improved R-factors for diffraction data analysis in macromolecular crystallography. Nat Struct Biol, 4, 269-75. Dodson, E., Kleywegt, G.J. and Wilson, K. (1996). Report of a workshop on the use of statistical validators in protein X-ray crystallography. Acta Crystallogr D Biol Crystallogr, 52, 228-34. Dong, M., Pinon, D.I., Cox, R.F. and Miller, L.J. (2004). Importance of the amino terminus in secretin family G protein-coupled receptors. Intrinsic photoaffinity labeling establishes initial docking constraints for the calcitonin receptor. J Biol Chem, 279, 1167-75. Doyle, D.A., Morais Cabral, J., Pfuetzner, R.A., Kuo, A., Gulbis, J.M., Cohen, S.L., Chait, B.T. and MacKinnon, R. (1998). The structure of the potassium channel: molecular basis of K+ conduction and selectivity. Science, 280, 6977. Dye, C. (2006). Global epidemiology of tuberculosis. Lancet, 367, 938-40. Emsley, P. and Cowtan, K. (2004). Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr, 60, 2126-32. Engh, R.A. and Huber, R. (2006). Structure quality and target parameters. International Tables for Crystallography, Vol F, ch. 18.3,382-392. References Florio, P., Torres, P.B., Torricelli, M., Toti, P., Vale, W. and Petraglia, F. (2006). Human endometrium expresses urocortin II and III messenger RNA and peptides. Fertil Steril, 86, 1766-70. Foord, S.M., Bonner, T.I., Neubig, R.R., Rosser, E.M., Pin, J.P., Davenport, A.P., Spedding, M. and Harmar, A.J. (2005). International Union of Pharmacology. XLVI. G protein-coupled receptor list. Pharmacol Rev, 57, 279-88. Gagliardi, M.C., Lemassu, A., Teloni, R., Mariotti, S., Sargentini, V., Pardini, M., Daffe, M. and Nisini, R. (2007). Cell wall-associated alpha-glucan is instrumental for Mycobacterium tuberculosis to block CD1 molecule expression and disable the function of dendritic cell derived from infected monocyte. Cell Microbiol, 9, 2081-92. Garg, S.K., Alam, M.S., Kishan, K.V. and Agrawal, P. (2007). Expression and characterization of alpha-(1,4)-glucan branching enzyme Rv1326c of Mycobacterium tuberculosis H37Rv. Protein Expr Purif, 51, 198-208. Ghosh, J., Larsson, P., Singh, B., Pettersson, B.M., Islam, N.M., Sarkar, S.N., Dasgupta, S. and Kirsebom, L.A. (2009). Sporulation in mycobacteria. Proc Natl Acad Sci U S A, 106, 10781-6. Gilpin, N.W., Richardson, H.N. and Koob, G.F. (2008). Effects of CRF1-receptor and opioid-receptor antagonists on dependence-induced increases in alcohol drinking by alcohol-preferring (P) rats. Alcohol Clin Exp Res, 32, 1535-42. Grace, C.R., Perrin, M.H., Gulyas, J., Digruccio, M.R., Cantle, J.P., Rivier, J.E., Vale, W.W. and Riek, R. (2007). Structure of the N-terminal domain of a type B1 G protein-coupled receptor in complex with a peptide ligand. Proc Natl Acad Sci U S A, 104, 4858-63. Grossini, E., Caimmi, P.P., Molinari, C., Mary, D.A., Uberti, F. and Vacca, G. (2010). Modulation of calcium movements by urocortin II in endothelial cells. Cell Physiol Biochem, 25, 221-32. Gruswitz, F., Frishman, M., Goldstein, B.M. and Wedekind, J.E. (2005). Coupling of MBP fusion protein cleavage with sparse matrix crystallization screens to overcome problematic protein solubility. Biotechniques, 39, 476, 478, 480. Guss, J.M., Merritt, E.A., Phizackerley, R.P., Hedman, B., Murata, M., Hodgson, K.O. and Freeman, H.C. (1988). Phase determination by multiple-wavelength x-ray diffraction: crystal structure of a basic "blue" copper protein from cucumbers. Science, 241, 806-11. Hanson, M.A. and Stevens, R.C. (2009). Discovery of new GPCR biology: one receptor structure at a time. Structure, 17, 8-14. Hao, Z., Huang, Y., Cleman, J., Jovin, I.S., Vale, W.W., Bale, T.L. and Giordano, F.J. (2008). Urocortin2 inhibits tumor growth via effects on vascularization and cell proliferation. Proc Natl Acad Sci U S A, 105, 3939-44. References Harikumar, K.G., Pinon, D.I. and Miller, L.J. (2007). Transmembrane segment IV contributes a functionally imporatant interface for oligomerization of the class II G protein -coupled secretin receptor. J. Biol. Chem., 282, 30363-30372. Harikumar, K.G., Happs, R.M. and Miller, L.J. (2008). Dimerization in the absence of higher-order oligomerization of the G protein -coupled secretin receptor. Biochim. Biophys. Acta., 1778, 2555-2563. Hauptman, H. (1997). Phasing methods for protein crystallography. Curr Opin Struct Biol, 7, 672-80. Helliwell, J.R. (2005). Protein crystal perfection and its application. Acta Crystallogr D Biol Crystallogr, 61, 793-8. Henrissat, B., Deleury, E. and Coutinho, P.M. (2002). Glycogen metabolism loss: a common marker of parasitic behaviour in bacteria? Trends Genet, 18, 437-40. Hillhouse, E.W., Randeva, H., Ladds, G. and Grammatopoulos, D. (2002). Corticotropin-releasing hormone receptors. Biochem Soc Trans, 30, 428-32. Hoare, S.R. (2005). Mechanisms of peptide and nonpeptide ligand binding to Class B G-protein-coupled receptors. Drug Discov Today, 10, 417-27. Holm, L., Kaariainen, S., Rosenstrom, P. and Schenkel, A. (2008). Searching protein structure databases with DaliLite v.3. Bioinformatics, 24, 2780-1. Hong, S., Mikkelsen, R. and Preiss, J. (2001). Analysis of the amino terminus of maize branching enzyme II by polymerase chain reaction random mutagenesis. Arch Biochem Biophys, 386, 62-8. Hsu, S.Y. and Hsueh, A.J. (2001). Human stresscopin and stresscopin-related peptide are selective ligands for the type corticotropin-releasing hormone receptor. Nat Med, 7, 605-11. Kones, T.A., Zou, J.Y., Cowan, S.W. and Kjeldgaard, M. (1991). Improved methods for building protein models in electron density maps and the locatio of errors in these models. Acta Crystallogr. A47, 110-119. Iino, K., Sasano, H., Oki, Y., Andoh, N., Shin, R.W., Kitamoto, T., Totsune, K., Takahashi, K., Suzuki, H., Nagura, H. and Yoshimi, T. (1997). Urocortin expression in human pituitary gland and pituitary adenoma. J Clin Endocrinol Metab, 82, 3842-50. Jasmer, R.M., Nahid, P. and Hopewell, P.C. (2002). Clinical practice. Latent tuberculosis infection. N Engl J Med, 347, 1860-6. Kalscheuer, R., Syson, K., Veeraraghavan, U., Weinrick, B., Biermann, K.E., Liu, Z., Sacchettini, J.C., Besra, G., Bornemann, S. and Jacobs, W.R., Jr. (2010). Selfpoisoning of Mycobacterium tuberculosis by targeting GlgE in an alphaglucan pathway. Nat Chem Biol, 6, 376-84. References Kelleher, R.J., 3rd, Flanagan, P.M. and Kornberg, R.D. (1990). A novel mediator between activator proteins and the RNA polymerase II transcription apparatus. Cell, 61, 1209-15. Kimura, Y., Takahashi, K., Totsune, K., Muramatsu, Y., Kaneko, C., Darnel, A.D., Suzuki, T., Ebina, M., Nukiwa, T. and Sasano, H. (2002). Expression of urocortin and corticotropin-releasing factor receptor subtypes in the human heart. J Clin Endocrinol Metab, 87, 340-6. Klose, J., Fechner, K., Beyermann, M., Krause, E., Wendt, N., Bienert, M., Rudolph, R. and Rothemund, S. (2005). Impact of N-terminal domains for corticotropinreleasing factor (CRF) receptor-ligand interactions. Biochemistry, 44, 161423. Koob, G.F. (2010). The role of CRF and CRF-related peptides in the dark side of addiction. Brain Res, 1314, 3-14. Kumar, V., Abbas, A.K., Fausto, N. and Mitchell, R.N. (2007). Robbins Basic Pathology (8th ed.). Saunders Elsevier, 516-522. Kuperman, Y., Issler, O., Regev, L., Musseri, I., Navon, I., Neufeld-Cohen, A., Gil, S. and Chen, A. (2010). Perifornical Urocortin-3 mediates the link between stress-induced anxiety and energy homeostasis. Proc Natl Acad Sci U S A, 107, 8393-8. Lares, C., Frixon, C., Creuzet-Sigal, N. and Thomas, P. (1974). Characterization and ultrastructure of mutants of Escherichia coli deficient in alpha-1,4-glucanalpha-1,4-glucan 6-glycosytransferase (branching enzyme). J Gen Microbiol, 82, 279-93. Laskowsi, R.A., MacArthur, M.W., Moss, D.S., and Thornton, J.M. (1993). PROCHECK: a program to check the stereochemical qality of protein structures. J. Appl Crystallogr. 26, 283-291. Lefkowitz, R.J. (2004). Historical review: a brief history and personal retrospective of seven-transmembrane receptors. Trends Pharmacol Sci, 25, 413-22. Lemassu, A. and Daffe, M. (1994). Structural features of the exocellular polysaccharides of Mycobacterium tuberculosis. Biochem J, 297 ( Pt 2), 3517. Lemassu, A., Ortalo-Magne, A., Bardou, F., Silve, G., Laneelle, M.A. and Daffe, M. (1996). Extracellular and surface-exposed polysaccharides of non-tuberculous mycobacteria. Microbiology, 142 ( Pt 6), 1513-20. Lewis, K., Li, C., Perrin, M.H., Blount, A., Kunitake, K., Donaldson, C., Vaughan, J., Reyes, T.M., Gulyas, J., Fischer, W., Bilezikjian, L., Rivier, J., Sawchenko, P.E. and Vale, W.W. (2001). Identification of urocortin III, an additional References member of the corticotropin-releasing factor (CRF) family with high affinity for the CRF2 receptor. Proc Natl Acad Sci U S A, 98, 7570-5. Li, H. and Thanassi, D.G. (2009). Use of a combined cryo-EM and X-ray crystallography approach to reveal molecular details of bacterial pilus assembly by the chaperone/usher pathway. Curr Opin Microbiol, 12, 326-32. Li, X., Fan, M., Shen, L., Cao, Y., Zhu, D. and Hong, Z. (2010). Excitatory responses of cardiovascular activities to urocortin3 administration into the PVN of the rat. Auton Neurosci, 154, 108-11. Liaw, C.W., Lovenberg, T.W., Barry, G., Oltersdorf, T., Grigoriadis, D.E. and de Souza, E.B. (1996). Cloning and characterization of the human corticotropinreleasing factor-2 receptor complementary deoxyribonucleic acid. Endocrinology, 137, 72-7. Lougheed, K.E., Taylor, D.L., Osborne, S.A., Bryans, J.S. and Buxton, R.S. (2009). New anti-tuberculosis agents amongst known drugs. Tuberculosis (Edinb), 89, 364-70. Machovie, M. and Janecek, S. (2008). Domain evolution in the GH1 pullulanase subfamily with focus on the carbohydrate-binding module family 48. Biologia, 63,1057-1068. Malbon, C.C. (2004). Frizzleds: new members of the superfamily of G-proteincoupled receptors. Front Biosci, 9, 1048-58. Markovic, D. and Grammatopoulos, D.K. (2009). Focus on the splicing of secretin GPCRs transmembrane-domain 7. Trends Biochem Sci, 34, 443-52. McCoy, A.J., Grosse-Kunstleve, R.W., Adams, P.D., Winn, M.D., Storoni, L.C. and Read, R.J. (2007). Phaser crystallographic software. J Appl Crystallogr, 40, 658-674. McPherson, A. (2009). Introduction to Macromolecular Crystallography, nd Edition, Wiley, Newyork. McRee, D.E., Pratical Protein Crystallography. 2nd ed. 1999, San Diego: Academic Press. McGuffin, L.J., Bryson, K. and Jones, D.T. (2000). The PSIPRED protein structure prediction server. Bioinformatics, 16, 404-405. Meena, L.S. and Rajni (2010). Survival mechanisms of pathogenic Mycobacterium tuberculosis H37Rv. FEBS J, 277, 2416-27. Mercier, J.F., Salahpour, A., Angers, S., Breit, A. and Bouvier, M. (2002). Quantitative assessment of beta 1- and beta 2-adrenergic receptor homo- and heterodimerization by bioluminescence resonance energy transfer. J Biol Chem, 277, 44925-31. References Merritt, E.A. and Bacon, D.J. (1997). Raster3D: photorealistic molecular graphics. Methods Enzymol, 277, 505-24. Mirza, O., Skov, L.K., Remaud-Simeon, M., Potocki de Montalk, G., Albenne, C., Monsan, P. and Gajhede, M. (2001). Crystal structures of amylosucrase from Neisseria polysaccharea in complex with D-glucose and the active site mutant Glu328Gln in complex with the natural substrate sucrose. Biochemistry, 40, 9032-9. Morris, A.L., MacArthur, M.W., Hutchinson, E.G. and Thornton, J.M. (1992). Stereochemical quality of protein structure coordinates. Proteins, 12, 345-64. Murshudov, G.N., Vagin, A.A. and Dodson, E.J. (1997). Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr D Biol Crystallogr, 53, 240-55. Nathan, C., Gold, B., Lin, G., Stegman, M., de Carvalho, L.P., Vandal, O., Venugopal, A. and Bryk, R. (2008). A philosophy of anti-infectives as a guide in the search for new drugs for tuberculosis. Tuberculosis (Edinb), 88 Suppl 1, S25-33. Neumann, J.M., Couvineau, A., Murail, S., Lacapere, J.J., Jamin, N. and Laburthe, M. (2008). Class-B GPCR activation: is ligand helix-capping the key? Trends Biochem Sci, 33, 314-9. Okita, T.W., Rodriguez, R.L. and Preiss, J. (1981). Biosynthesis of bacterial glycogen. Cloning of the glycogen biosynthetic enzyme structural genes of Escherichia coli. J Biol Chem, 256, 6944-52. Ortalo-Magne, A., Dupont, M.A., Lemassu, A., Andersen, A.B., Gounon, P. and Daffe, M. (1995). Molecular composition of the outermost capsular material of the tubercle bacillus. Microbiology, 141 ( Pt 7), 1609-20. Ostwinowski, Z. and Minor, W. (1997). Processing of X-ray diffraction data collected in oscillation mode. Methods in Enzymology, 276, 307-326. Overington, J.P., Al-Lazikani, B. and Hopkins, A.L. (2006). How many drug targets are there? Nat Rev Drug Discov, 5, 993-6. Owens, M.J. and Nemeroff, C.B. (1991). Physiology and pharmacology of corticotropin-releasing factor. Pharmacol Rev, 43, 425-73. Palczewski, K., Kumasaka, T., Hori, T., Behnke, C.A., Motoshima, H., Fox, B.A., Le Trong, I., Teller, D.C., Okada, T., Stenkamp, R.E., Yamamoto, M. and Miyano, M. (2000). Crystal structure of rhodopsin: A G protein-coupled receptor. Science, 289, 739-45. Palomo, M., Kralj, S., van der Maarel, M.J. and Dijkhuizen, L. (2009). The unique branching patterns of Deinococcus glycogen branching enzymes are References determined by their N-terminal domains. Appl Environ Microbiol, 75, 135562. Parthier, C., Kleinschmidt, M., Neumann, P., Rudolph, R., Manhart, S., Schlenzig, D., Fanghanel, J., Rahfeld, J.U., Demuth, H.U. and Stubbs, M.T. (2007). Crystal structure of the incretin-bound extracellular domain of a G protein-coupled receptor. Proc Natl Acad Sci U S A, 104, 13942-7. Parthier, C., Reedtz-Runge, S., Rudolph, R. and Stubbs, M.T. (2009). Passing the baton in class B GPCRs: peptide hormone activation via helix induction? Trends Biochem Sci, 34, 303-10. Pastor, R., McKinnon, C.S., Scibelli, A.C., Burkhart-Kasch, S., Reed, C., Ryabinin, A.E., Coste, S.C., Stenzel-Poore, M.P. and Phillips, T.J. (2008). Corticotropinreleasing factor-1 receptor involvement in behavioral neuroadaptation to ethanol: a urocortin1-independent mechanism. Proc Natl Acad Sci U S A, 105, 9070-5. Perrakis, A., Morris, R. and Lamzin, V.S. (1999). Automated protein model building combined with iterative structure refinement. Nat Struct Biol, 6, 458-63. Pioszak, A.A., Harikumar, K.G., Parker, N.R., Miller, L.J. and Xu, H.E. (2010). Dimeric arrangement of the parathyroid hormone receptor and a structural mechanism for ligand-induced dissociation. J Biol Chem, 285, 12435-44. Pioszak, A.A., Parker, N.R., Suino-Powell, K. and Xu, H.E. (2008). Molecular recognition of corticotropin-releasing factor by its G-protein-coupled receptor CRFR1. J Biol Chem, 283, 32900-12. Pioszak, A.A. and Xu, H.E. (2008). Molecular recognition of parathyroid hormone by its G protein-coupled receptor. Proc Natl Acad Sci U S A, 105, 5034-9. Preiss, J. (l989) Chemistry and metabolism of intracellular reserves. In: Bacteria in Nature. Vol. (A treatise on the interactions of bacteria and their habitats), E.R. Leadbetter and J.S. Poindexter, eds., pp. l89-258. New York. Preiss, J. (2006). Bacterial Glycogen Inclusions: Enzymology and Regulation of synthesis. In Microbiology Monographs Vol. 1, Chapter (J.M. Shively, editor) Springer, Heidelberg, Germany. Pp. 71-108. Preiss, J. (2009). Encyclopedia of Microbiology (3rd ed.). Elsevier. Ravelli, R.B. and Garman, E.F. (2006). Radiation damage in macromolecular cryocrystallography. Curr Opin Struct Biol, 16, 624-9. Reyes, T.M., Lewis, K., Perrin, M.H., Kunitake, K.S., Vaughan, J., Arias, C.A., Hogenesch, J.B., Gulyas, J., Rivier, J., Vale, W.W. and Sawchenko, P.E. (2001). Urocortin II: a member of the corticotropin-releasing factor (CRF) References neuropeptide family that is selectively bound by type CRF receptors. Proc Natl Acad Sci U S A, 98, 2843-8. Rhodes, G. (2000) Crystallography Made Crystal Clear. Academic Press, San Diego. Rosenbaum, D.M., Rasmussen, S.G. and Kobilka, B.K. (2009). The structure and function of G-protein-coupled receptors. Nature, 459, 356-63. Rossmann, M.G. (1990). The molecular replacement method. Acta Crystallogr A, 46 ( Pt 2), 73-82. Rueda, B., Miguelez, E.M., Hardisson, C. and Manzanal, M.B. (2001). Changes in glycogen and trehalose content of Streptomyces brasiliensis hyphae during growth in liquid cultures under sporulating and non-sporulating conditions. FEMS Microbiol Lett, 194, 181-5. Rutz, C., Renner, A., Alken, M., Schulz, K., Beyermann, M., Wiesner, B., Rosenthal, W. and Schulein, R. (2006). The corticotropin-releasing factor receptor type 2a contains an N-terminal pseudo signal peptide. J Biol Chem, 281, 24910-21. Salahpour, A., Angers, S. and Bouvier, M. (2000). Functional significance of oligomerization of G-protein-coupled receptors. Trends Endocrinol Metab, 11, 163-8. Sambou, T., Dinadayala, P., Stadthagen, G., Barilone, N., Bordat, Y., Constant, P., Levillain, F., Neyrolles, O., Gicquel, B., Lemassu, A., Daffe, M. and Jackson, M. (2008). Capsular glucan and intracellular glycogen of Mycobacterium tuberculosis: biosynthesis and impact on the persistence in mice. Mol Microbiol, 70, 762-74. Sassetti, C.M., Boyd, D.H. and Rubin, E.J. (2003). Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol, 48, 77-84. Sivakumar, N., Li, N., Tang, J.W., Patel, B.K. and Swaminathan, K. (2006). Crystal structure of AmyA lacks acidic surface and provide insights into protein stability at poly-extreme condition. FEBS Lett, 580, 2646-52. Skov, L.K., Mirza, O., Sprogoe, D., Dar, I., Remaud-Simeon, M., Albenne, C., Monsan, P. and Gajhede, M. (2002). Oligosaccharide and sucrose complexes of amylosucrase. Structural implications for the polymerase activity. J Biol Chem, 277, 47741-7. Stokes, R.W., Norris-Jones, R., Brooks, D.E., Beveridge, T.J., Doxsee, D. and Thorson, L.M. (2004). The glycan-rich outer layer of the cell wall of Mycobacterium tuberculosis acts as an antiphagocytic capsule limiting the association of the bacterium with macrophages. Infect Immun, 72, 5676-86. Strotmann, R., Schrock, K., Boselt, I., Staubert, C., Russ, A. and Schoneberg, T. (2010). Evolution of GPCR: Change and continuity. Mol Cell Endocrinol, References Sutherland, I. W. (2002). Vandamme, E. J., Ed ed. Polysaccharides from Microorganisms, Plants and Animals, in: Biopolymers, Volume 5, Polysaccharides I: Polysaccharides from Prokaryotes. Weiheim Wiley VCH. pp. 1–19 Takahashi, K., Totsune, K., Murakami, O., Saruta, M., Nakabayashi, M., Suzuki, T., Sasano, H. and Shibahara, S. (2004). Expression of urocortin III/stresscopin in human heart and kidney. J Clin Endocrinol Metab, 89, 1897-903. Tam, P.H. and Lowary, T.L. (2009). Recent advances in mycobacterial cell wall glycan biosynthesis. Curr Opin Chem Biol, 13, 618-25. Tan, T.C., Mijts, B.N., Swaminathan, K., Patel, B.K. and Divne, C. (2008). Crystal structure of the polyextremophilic alpha-amylase AmyB from Halothermothrix orenii: details of a productive enzyme-substrate complex and an N domain with a role in binding raw starch. J Mol Biol, 378, 852-70. Tarling, C.A., Woods, K., Zhang, R., Brastianos, H.C., Brayer, G.D., Andersen, R.J. and Withers, S.G. (2008). The search for novel human pancreatic alphaamylase inhibitors: high-throughput screening of terrestrial and marine natural product extracts. Chembiochem, 9, 433-8. Taylor, G. (2003). The phase problem. Acta Crystallogr D Biol Crystallogr, 59, 188190. Tezval, H., Jurk, S., Atschekzei, F., Serth, J., Kuczyk, M.A. and Merseburger, A.S. (2009). The involvement of altered corticotropin releasing factor receptor expression in prostate cancer due to alteration of anti-angiogenic signaling pathways. Prostate, 69, 443-8. Traag, B.A., Driks, A., Stragier, P., Bitter, W., Broussard, G., Hatfull, G., Chu, F., Adams, K.N., Ramakrishnan, L. and Losick, R. (2010). Do mycobacteria produce endospores? Proc Natl Acad Sci U S A, 107, 878-81. Uitdehaag, J.C., Mosi, R., Kalk, K.H., van der Veen, B.A., Dijkhuizen, L., Withers, S.G. and Dijkstra, B.W. (1999). X-ray structures along the reaction pathway of cyclodextrin glycosyltransferase elucidate catalysis in the alpha-amylase family. Nat Struct Biol, 6, 432-6. Underwood, C.R., Garibay, P., Knudsen, L.B., Hastrup, S., Peters, G.H., Rudolph, R. and Reedtz-Runge, S. (2010). Crystal structure of glucagon-like peptide-1 in complex with the extracellular domain of the glucagon-like peptide-1 receptor. J Biol Chem, 285, 723-30. Uson, I. and Sheldrick, G.M. (1999). Advances in direct methods for protein crystallography. Curr Opin Struct Biol, 9, 643-8. Vagin, A. and Teplyakov, A. (2000). An approach to multi-copy search in molecular replacement. Acta Crystallogr. D56, 1622-1624. References Valberg, S.J., Ward, T.L., Rush, B., Kinde, H., Hiraragi, H., Nahey, D., Fyfe, J. and Mickelson, J.R. (2001). Glycogen branching enzyme deficiency in quarter horse foals. J Vet Intern Med, 15, 572-80. Valdenaire, O., Giller, T., Breu, V., Gottowik, J. and Kilpatrick, G. (1997). A new functional isoform of the human CRF2 receptor for corticotropin-releasing factor. Biochim Biophys Acta, 1352, 129-32. Vale, W., Spiess, J., Rivier, C. and Rivier, J. (1981). Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and betaendorphin. Science, 213, 1394-7. Vaughan, J., Donaldson, C., Bittencourt, J., Perrin, M.H., Lewis, K., Sutton, S., Chan, R., Turnbull, A.V., Lovejoy, D., Rivier, C. and et al. (1995). Urocortin, a mammalian neuropeptide related to fish urotensin I and to corticotropinreleasing factor. Nature, 378, 287-92. Wang, B.C. (1985). Resolution of phase ambiguity crystallography. Methods Enzymol, 115, 90-112. in macromolecular Wang, J., Xu, Y., Zhu, H., Zhang, R., Zhang, G. and Li, S. (2008). Urocortin's inhibition of tumor growth and angiogenesis in hepatocellular carcinoma via corticotrophin-releasing factor receptor 2. Cancer Invest, 26, 359-68. Wimberly, B.T., Brodersen, D.E., Clemons, W.M., Jr., Morgan-Warren, R.J., Carter, A.P., Vonrhein, C., Hartsch, T. and Ramakrishnan, V. (2000). Structure of the 30S ribosomal subunit. Nature, 407, 327-39. Winn, M.D., Isupov, M.N. and Murshudov, G.N. (2001). Use of TLS parameters to model anisotropic displacements in macromolecular refinement. Acta Crystallogr D Biol Crystallogr, 57, 122-33. Stop TB Partnership (2006) The global plan to stop TB 2006–2015. Geneva: WHO. World Health Organization (2009) Global tuberculosis control - surveillance, planning, financing. Geneva, Switzerland: WHO. APPENDIX A Representation of gene sequence with translated aminoacid sequence of Mycobacterium tuberculosis glucan branching enzyme atgagtcgatccgagaaactcaccggggagcaccttgcacccgagccggccgaaatggcg M S R S E K L T G E H L A P E P A E M A cgcttggtggcgggtacacatcacaacccgcacggcatcctgggcgcccacgaatacgac R L V A G T H H N P H G I L G A H E Y D gaccataccgtcatccgagcgttccgtccgcatgccgtcgaggtcgtcgcgctcgttggt D H T V I R A F R P H A V E V V A L V G aaggaccggttctcgttgcagcacctcgattctggcctgtttgccgtcgcattgccgttc K D R F S L Q H L D S G L F A V A L P F gtcgacctcatcgactaccgcctgcaggtgacctatgaaggttgcgagccacacaccgtg V D L I D Y R L Q V T Y E G C E P H T V gccgatgcgtaccgattcctgcccaccctgggcgaggtcgacctgcacctgttcgccgag A D A Y R F L P T L G E V D L H L F A E ggccgccacgaacggctttgggaagtcctgggtgcccacccccgctcgtttaccacggcc G R H E R L W E V L G A H P R S F T T A gacggtgtggtgagtggcgtgtcgttcgccgtgtgggcgcccaacgccaagggcgtcagc D G V V S G V S F A V W A P N A K G V S ttgatcggcgagttcaacggttggaatggccacgaagcccccatgcgggtgctcggccca L I G E F N G W N G H E A P M R V L G P tcaggggtatgggaattgttctggcccgacttcccttgcgacggtctgtacaagttccgc S G V W E L F W P D F P C D G L Y K F R gtgcacggcgccgacggcgtggttaccgatcgggccgacccgttcgcgttcggcaccgag V H G A D G V V T D R A D P F A F G T E gtgccgccgcagaccgcatcgcgggtgacgtcgagtgactacacctggggtgacgacgac V P P Q T A S R V T S S D Y T W G D D D tggatggctgggcgtgcgctgcgcaacccggtgaacgaggcgatgagcacctacgaagtc W M A G R A L R N P V N E A M S T Y E V catctcggttcgtggcggcctggactcagctaccgccagcttgctcgtgagttgacggat H L G S W R P G L S Y R Q L A R E L T D tacattgtggatcaagggtttacccatgtggagctgttgcccgtcgccgagcatccattc Y I V D Q G F T H V E L L P V A E H P F gccggatcatgggggtatcaggtcacgtcctactatgcgccgacatcacgattcggcaca A G S W G Y Q V T S Y Y A P T S R F G T cccgacgacttccgggcgctggtcgacgccctgcaccaggccggcatcggcgtcatcgtg P D D F R A L V D A L H Q A G I G V I V gattgggtcccagcgcacttcccgaaggacgcgtgggccctgggacggttcgacggcact D W V P A H F P K D A W A L G R F D G T ccgctctacgaacattccgatcccaaacgcggcgagcaactggattggggcacatacgtg P L Y E H S D P K R G E Q L D W G T Y V ttcgacttcggccgcccggaagtgcgcaactttctggtagccaatgcgttgtactggcta F D F G R P E V R N F L V A N A L Y W L caggagttccacatcgacggcctgcgggtggacgcggtggcctcaatgctctatctagac Q E F H I D G L R V D A V A S M L Y L D tactcgcgacccgagggcggctggacccccaacgtccacggcggccgggagaacctggaa Y S R P E G G W T P N V H G G R E N L E gcagtgcagttcctgcaggagatgaacgccacggcgcacaaggtcgcgccgggaatcgtc A V Q F L Q E M N A T A H K V A P G I V accatcgccgaggagtccacgccgtggtctggggtgacccgcccgaccaacattggcggc T I A E E S T P W S G V T R P T N I G G ctgggcttttcgatgaagtggaacatgggctggatgcacgacacgctcgactacgtcagc L G F S M K W N M G W M H D T L D Y V S cgagatccggtgtaccgcagctaccaccaccacgagatgacgttctcgatgctgtatgcg R D P V Y R S Y H H H E M T F S M L Y A ttcagcgaaaattacgtgttgccgctcagtcatgacgaggtggtgcacggcaaaggcacg F S E N Y V L P L S H D E V V H G K G T ctgtgggggcggatgccgggcaacaatcacgtcaaggccgccggcctgcgtagcctgctt L W G R M P G N N H V K A A G L R S L L gcctaccaatgggcacaccccggcaagcaattgctgttcatgggtcaggaattcggccaa A Y Q W A H P G K Q L L F M G Q E F G Q cgcgccgaatggtccgagcagcgcggcctggactggttccaactcgacgaaaacggcttc R A E W S E Q R G L D W F Q L D E N G F tccaacgggattcagcggctggtgcgcgacatcaacgacatctaccgatgccacccggcg S N G I Q R L V R D I N D I Y R C H P A ctgtggagcttagacaccacccccgaaggctattcttggatcgacgccaacgactccgcc L W S L D T T P E G Y S W I D A N D S A aacaatgtgttgagctttatgcgctacggcagcgacggctcggtgctggcctgcgtgttc N N V L S F M R Y G S D G S V L A C V F aatttcgcaggtgccgaacaccgtgactatcgactcgggctgccgcgcgcgggccgctgg N F A G A E H R D Y R L G L P R A G R W cgcgaggtgctcaataccgacgcgacgatctaccacggctcagggatcggcaacctcggc R E V L N T D A T I Y H G S G I G N L G ggcgtggacgccaccgacgacccctggcatggccgcccggcgtccgcggtgctggtgctg G V D A T D D P W H G R P A S A V L V L ccgcccacttcggcgctgtggctgacgcccgcctag P P T S A L W L T P A - APENDIX B Reciprocal exchange mutants of Urocortin1 and used in the competitive assay Tyr-Ucn1-NH2(26-41)Q27L YSLRERAEQNRIIFDSV- NH2 Tyr-Ucn1-NH2(26-41)R31Q YSQREQAEQNRIIFDSV- NH2 Tyr-Ucn1-NH2(26-41)F38M YSQRERAEQNRIIMDSV- NH2 Tyr-Ucn1-NH2(26-41)D39A YSQRERAEQNRIIFASV- NH2 Tyr-Ucn1-NH2(26-41) Q27L R30Q F38M D39A YSLREQAEQNRIIMASV- NH2 Tyr-Ucn1-NH2(26-41) Q27L R30Q Q33A F38M D39A YSLREQAEANRIIMASV- NH2 Tyr-Ucn1-NH2(26-41) Q27L R30Q Q33A R35A F38M D39A YSLREQAEANAIIMASV- NH2 Tyr-Ucn1-NH2(26-41) Q27L R30Q Q33A R35A I37L F38M D39A YSLREQAEANAILMASV- NH2 Tyr-Ucn1-NH2(26-41) F38M D39A YSQRERAEQNRIIMASV- NH2 Tyr-Ucn1-NH2(26-41)R35AQ33A YSQRERAEANAIIFDSV- NH2 Tyr-Ucn1-NH2(26-41)R35AQ33AF38M YSQRERAEANAIIMDSV- NH2 Tyr-Ucn1-NH2(26-41)R35A YSQRERAEQNAIIFDSV- NH2 Tyr-Ucn1-NH2(26-41)Q33A YSQRERAEANRIIFDSV- NH2 Tyr-Ucn3-NH2(26-41) A35R YNLRAQAAANRHLMAQI - NH2 Tyr-Ucn3-NH2(26-41) A33Q YNQRAQAAQNAHLMAQI - NH2 Tyr-Ucn3-NH2(26-41) A35RA33Q YNQRAQAAQNRHLMAQI - NH2 Tyr-Ucn3-NH2(26-41) A35RA33QM38F YNQRAQAAQNRHLFAQI - NH2 Tyr-Ucn3-NH2(26-41) L27Q YNQRAQAAANAHLMAQI - NH2 Tyr-Ucn3-NH2(26-41)Q31R YNLRARAAANAHLMAQI - NH2 Tyr-Ucn3-NH2(26-41)M38F YNLRAQAAANAHLFAQI - NH2 Tyr-Ucn3-NH2(26-41)A39D YNLRAQAAANAHLMDQI - NH2 Tyr-Ucn3-NH2(26-41) L27Q Q30R M38F A39D YNQRARAAANAHLFDQI - NH2 Tyr-Ucn3-NH2(26-41) L27Q Q30R A33Q M38F A39D YNQRARAAQNAHLFDQI - NH2 Tyr-Ucn3-NH2(26-41) L27Q Q30R A33Q A35R M38F A39D YNQRARAAQNRHLFDQI - NH2 Tyr-Ucn3-NH2(26-41) L27Q Q30R A33Q A35R L37I M38F A39D YNQRARAAQNRHIFDQI - NH2 APPENDIX C Alanine mutants of Urocortin used in Ala Scan Experiments Tyr-Ucn1-NH2(26-41)V41A YSQRERAEQNRIIFDSA- NH2 Tyr-Ucn1-NH2(26-41)F38A YSQRERAEQNRIIADSV- NH2 Tyr-Ucn1-NH2(26-41) I37A YSQRERAEQNRIAFDSV- NH2 Tyr-Ucn1-NH2(26-41) I36A YSQRERAEQNRAIFDSV- NH2 Tyr-Ucn1-NH2(26-41)N34A YSQRERAEQARIIFDSV- NH2 Tyr-Ucn1-NH2(26-41)R30A YSQREAAEQNRIIFDSV- NH2 Tyr-Ucn1-NH2(26-41)R35A YSQRERAEQNAIIFDSV- NH2 Tyr-Ucn1-NH2(26-41)Q27A YSARERAEQNRIIFDSV- NH2 Tyr-Ucn1-NH2(26-41)-OH YSQRERAEQNRIIFDSV- OH APPENDIX D Structural alignment (based upon Cα atoms) of CRFR2α-Ucn3 (blue and green) structure with CRFR1-CRF (magenta and yellow) with r.m.s.d. value of 0.586 Å. Conserved disulfide bonds has been shown in yellow colour. APPENDIX E Structural alignment (based upon Cα atoms) between CRFR2α-Ucn1(orange), CRFR2αUcn2 (cyan), CRFR2α-Ucn3 (green),with r.m.s.d. values of 0.205 Å and 0.305 Å ,respectively. [...]... with reciprocal residual exchange mutants of Ucn1 and Ucn3 100 Figure 7.9 Comparison of the ligand-free and ligand-bound states of CRFR1 and CRFR2α 103 Figure 7.10 Binding of Ucn1/3 native and mutated peptides to the CRFR1 and CRFR2α ECDs 105 Figure 7.11 Comparison of the CRFR2α ECD-Ucn3 and CRFR1 ECD-CRF complexes 108 VII LIST OF TABLES Page Table1 Details of commonly used computer programs in protein... the glycogen branching enzyme structure of Mycobacterium tuberculosis involved in glycogen and glucan biosynthesis The second structure I solved is the extracellular domain from human corticotrophin release factor receptor 2α, which plays a role in class B GPCR based signaling pathway The open reading frame Rv1326c of Mycobacterium tuberculosis (Mtb) H37Rv encodes for an α-1,4-glucan branching enzyme. .. negatively charged Glu104 The structures XI explain the mechanisms of ligand recognition and discrimination and provide a molecular template for the rational design of therapeutic agents selectively targeting these receptors XII Chapter 1 X-ray crystallography CHAPTER 1 X-RAY CRYSTALLOGRAPHY 1.1 STRUCTURAL STUDIES OF MACROMOLECULES Structural studies of macromolecules are relevant to understand their physical... eukaryotic transcription (Kelleher et al., 1990) with structural elucidation of the enzymatic mechanism underlying the synthesis of adenosine triphosphate (ATP) and the discovery of an iontransporting enzyme by Boyer and Walker (Abrahams et al., 1994) become milestones in the structural biology research The other techniques used in the field of protein structural biology are Nuclear Magnetic Resonance... crystal structure of GlgB 48 Table3 Data collection and refinement details of the three crystal structures of MBP-hCRFR2α in complex with Ucn1,2 and3 86 Table4 Average B-factor analysis of each domain of MBP-hCRFR2α in the asymmetric unit 109 VIII LIST OF PUBLICATION Pal, K., Kumar, S., Sharma, S., Garg, S.K., Alam, M.S., Xu, E.H., Agrawal, P Swaminathan, K (2010) Crystal structure of full length Mycobacterium... extracellular domains 84 Figure 7.3 Structure of the hCRFR2α-ECD in the absence of ligand and secondary structural alignment with other solved structures of CRFR-ECD 89 Figure 7.4 Structure of the Urocortin1 (26-41)-NH2 bound CRFR1 ECD at 2.75 Å resolution 93 Figure 7.5 Structure of hCRFR2α ECD, in complex with Urocortin2 (2641)-NH2 at 2.72 Å resolution 95 Figure 7.6 Structure of CRFR1 ECD:Urocortin3 (26-41)-NH2-complex... variation in the total diffracting volume of the crystal sample arising when part of the crystal moves in or out of the incident beam, are corrected Also, data are to be corrected for the thermal motion of atoms (which causes the fall-off of intensity with increased scattering angle) and radiation damage which contributes to reduction in the intensity as a function of resolution (Ravelli and Garman, 2006)... 2007) are: Likelihood: On the basis of probability, ‘likelihood’ measures the agreement of the model with data In molecular replacement, the "model" being tested includes not only the structure of the template, but also the orientation and/or position of that template in the unit-cell of the target, as well as parameters describing the sizes of different sources of error In other applications (such... tuberculosis glycogen branching enzyme : insights of N terminal β-sandwich in substrate specificity and enzymatic activity J Biol Chem 285, 20897-20903 Pal, K., Swaminathan, K., Xu, E.H and Pioszak, A (2010) Structural basis for hormone recognition by the human CRFR2α G protein-coupled receptor J Biol Chem 285, 4035140361 IX SUMMARY X-ray crystallography is a well renowned process for the elucidation of protein... affect the reproduction of an image from diffraction data (Cowtan and Main, 1996) The completeness of low resolution data is important in the placement of missing parts of a structure, while refinement may benefit from the inclusion of high resolution data even if the merging R is up to 40% (Dodson et al., 1996) Depending on the structure determination method, the Bijvoet pairs of a reflection can either . STRUCTURAL STUDIES OF GLYCOGEN BRANCHING ENZYME (GLGB) AND CRFR2α:UROCORTIN COMPLEXES KUNTAL PAL A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY. PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2010 STRUCTURAL STUDIES OF GLYCOGEN BRANCHING ENZYME (GLGB) AND CRFR2α:UROCORTIN COMPLEXES KUNTAL PAL. 1.1 STRUCTURAL STUDIES OF MACROMOLECULES Structural studies of macromolecules are relevant to understand their physical and chemical properties. This chapter will give an overview of the