USE OF DUNALIELLA FOR CARBON DIOXIDE CAPTURE AND GLYCEROL PRODUCTION

USE OF DUNALIELLA FOR CARBON DIOXIDE CAPTURE AND GLYCEROL PRODUCTION NG HUI PING DAPHNE (B.Sc. (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF MICROBIOLOGY NATIONAL UNIVERSITY OF SINGAPORE 2014 Declaration i For the small things, Without whom, Nothing in the world as we know it, Including this thesis Would exist I beseech you to take interest in these sacred domains so expressively called laboratories. Ask that there be more and that they be adorned for these are the temples of the future, wealth and well-being. It is here that humanity will grow, strengthen and improve. Louis Pasteur ii Acknowledgements It has been said that it takes a village to raise a child. Similarly, it takes a n entire laboratory of people and more to raise a PhD student. So I would like to show my heartfelt appreciation to the following individuals, all of whom had a hand in guiding me through this fulfilling (but arduous) journey. Firstly, I would like to express my utmost gratitude to my supervisor, A/P Lee Yuan Kun. By extension, I would also like to acknowledge the Department of Microbiology for supporting this project. Prof Lee, thank you for giving me the opportunity to work with a microorganism which most would consider unusual. In fact, the only knowledge I had about microalgae when I first started working with them was that they were the green stuff that grew in ponds and drains. I would have been lost in the microbial wilderness if not for your guidance and encouragement. Despite your busy schedule, you will always put away what you were doing at the moment and entertain my visits to your office for discussion. You have indeed been instrumental in my development from a clueless PhD student to a published microbiologist. My life in the laboratory would not have been possible without the technical assistance of a very capable lab officer, Mr Low Chin Seng. Like an important gear in a piece of machinery, you keep the laboratory well-oiled and running as it should. Over the years, I have learnt many little tips and tricks from you, including the removal of a pouring ring from a Schott bottle. I am certain that these tips will continue to be useful in my future career. Thirdly, I would like to thank my research collaborator, Dr Yvonne Chow for the interesting scientific discussions each time I visit Jurong Island. From our collaboration, I have definitely acquired a new perspective on biological systems (I hope you have learnt something from me too!). Thank you for showing me that biology can be modeled and quantified. Thank you also for the constructive comments during manuscript editing and assistance with equation formulation. Now, I think I have a better appreciation of biotechnology (and engineers). I couldn’t have asked for a better collaborator and I hope that as I begin my scientific career, we will have more opportunities to work together. I am also grateful to the two post-doctoral research fellows, Dr Shen Hui and Dr Ng Yi Kai for sharing their expertise and advice on how to survive a PhD. You have been in the trenches and the advice that you give to naive PhD students is a morale booster when we have been tested at all fronts. To my laboratory mates who are also post-graduate students, Zhao Ran, Kelvin Koh, Kenneth Tan, Radiah Safie, Yao Lina, Lin Huixin, thank you for iii the times of fun and laughter that we had (some of which provided material for my Bitstrip cartoons). We all know that this can be a lonely journey and that these moments keep us sane when the going gets tough. As much as all of you have supported me, I hope that I have been a source of (technical and emotional) support for you too. To my research partner, Zhao Ran, a special thank you for entertaining my harebrained ideas with regards to our project and for the wonderful company on evenings when there were only the two of us. As we both take our first steps into the scientific community, I wish you all the best. Lastly, all this would not have been possible without the unwavering support of my family, friends and those who have the privilege (or misfortune) to know me on a personal basis. You have never doubted that I would survive (and live to tell the tale through this thesis) even during the times when I doubted myself. I am deeply indebted to my family, especially my parents and siblings for supporting me all this while, even though they don’t fully understand my research obsessions. An even bigger thank you for allowing me to store microalgal samples in the freezer at home. On days when I didn’t feel like Daphne, the PhD student, my friends have always reminded me that I can just be Daphne, which is something I am grateful for. To my Secondary School Biology teacher, Dr Tan Aik Ling, thank you for igniting that spark of microbiology all those years ago. It has not stopped burning since and I’m pretty sure that after enduring the trials and tribulations which constitute a PhD, I want to continue to understand the small things. To those who I have inadvertently left out, a last thank you for being a part of my amazing PhD experience. iv TABLE OF CONTENTS Declaration . i Acknowledgements .iii Summary . x List of Tables .xii List of Figures . xiii Chapter Lite rature review 1.1 Effects of rising atmospheric carbon dioxide levels 1.2 Carbon dioxide capture by bacteria 1.3 Oxygenic photosynthesis 1.4 Microalgae for carbon dioxide sequestration by oxygenic photosynthesis 1.5 Introduction to Dunaliella 14 1.6 Osmoregulation in Dunaliella 15 1.7 Glycerol as a carbon sink . 18 1.8 Dunaliella for carbon dioxide sequestration 19 1.9 Project objectives and hypotheses 20 Chapter Characterization of growth and glycerol production in three species of Dunaliella 22 2.1 Introduction 22 2.2 Materials and Methods . 24 2.2.1 Dunaliella cultures 24 2.2.2 Glycerol measurement . 25 2.2.3 Cell volume measurement and osmotic pressure estimation 26 2.2.4 Statistical analysis . 27 2.3 Results 27 2.3.1Growth kinetics of D. bardawil, D. primolecta and D. tertiolecta 27 2.3.2 Glycerol production of D. bardawil, D. primolecta and D. tertiolecta . 33 2.4 Discussion 40 v 2.4.1 Biotechnological applications of D. bardawil, D. primolecta and D. tertiolecta 40 2.4.2 Characterization of D. bardawil, D. primolecta and D. tertiolecta . 40 2.4.3 Extracellular glycerol production in Dunaliella 43 2.4.4 Selection of D. tertiolecta for further investigation . 45 2.5 Conclusion 46 Chapter Production of glyce rol from carbon dioxide by D. tertiolecta. 48 3.1 Introduction 48 3.2 Materials and Methods . 54 3.2.1 Dunaliella tertiolecta culture for glycerol and growth kinetics investigation at different growth phases . 54 3.2.2 Carbon partitioning determination of D. tertiolecta at different growth phases . 55 3.2.3 Computational analysis . 56 3.2.4 Dunaliella tertiolecta culture for investigation of the physiology of glycerol synthesis during hyperosmotic stress 56 3.2.5 Hyperosmotic treatments . 56 3.2.6 Glycerol measurement . 57 3.2.7Starch measurement . 58 3.2.8 Cell volume measurement . 58 3.2.9 TOC measurement . 58 3.2.10 Chlorophyll measurement . 58 3.2.11Photosynthetic rate measurement . 60 3.2.12 Carbon partitioning determination of D. tertiolecta cells adapted to various salinities . 60 3.2.13 Extraction of total RNA 61 3.2.14 Cloning of cDNA sequences of PFK, GPDH and G6PDH by Rapid Amplification of cDNA Ends (RACE) . 61 3.2.15Sequence analysis . 63 3.2.16 Quantitative real-time PCR analysis . 64 3.2.17 Statistical analysis . 65 3.3 Results 65 3.3.1 Carbon partitioning of a D. tertiolecta culture at different phases of growth . 65 vi 3.3.2 Physiological response of D. tertiolecta during a hyperosmotic shock 72 3.3.3 Carbon partitioning of D. tertiolecta adapted to various salinities ………………………………………………………… .72 3.3.4 Glycerol productivity of D. tertiolecta at various salinities .74 3.3.5 Sequence analysis of DtPFK, DtGPDH and DtG6PDH…… 81 3.3.6 Expression of DtPFK, DtGPDH and DtG6PDH during hyperosmotic stress 82 3.4 Discussion 86 3.4.1 Carbon partitioning of D. tertiolecta at different growth phases 86 3.4.2 Physiological responses of D. tertiolecta during hyperosmotic stress . 87 3.4.3 Carbon partitioning of D. tertiolecta adapted to various salinities 89 3.4.4 Expression of DtPFK, DtGPDH and DtG6PDH during hyperosmotic stress 90 3.5 Conclusion 92 Chapter Intracellular glycerol accumulation in light limited Dunaliella tertiolecta culture is determined by partitioning of glycerol across the cell me mbrane 94 4.1 Introduction 94 4.2 Materials and Methods . 95 4.2.1 Chemostat culture of D. tertiolecta .95 4.2.2 Glycerol measurement . 96 4.2.3 Extraction of total RNA and qPCR 96 4.2.4 Cell volume measurement . 96 4.2.5 Statistical analysis .96 4.3 Results 97 4.3.1 Steady state cell concentrations and glycerol production of Nlimited cultures . 97 4.3.2 Steady state cell concentrations and glycerol production of light- limited cultures 98 4.3.3 Cell volumes and intracellular osmotic pressures of N and lightlimited cultures . 99 vii 4.3.4 Expression of DtPFK, DtGPDH and DtG6PDH of N and lightlimited cultures . 99 4.4 Discussion 109 4.4.1 Steady state cell concentrations and glycerol production of N and light- limited D. tertiolecta cultures . 109 4.4.2 Cell volumes and intracellular osmotic pressures of N and lightlimited cultures . 110 4.5 Conclusion 111 Chapter Cloning, characterization and over-expression of a SBPase cDNA from D. tertiolecta 113 5.1 Introduction 113 5.2 Materials and Methods . 114 5.2.1 Dunaliella tertiolecta culture 114 5.2.2 Extraction of total RNA 115 5.2.3 Cloning of cDNA sequence of SBPase by Rapid Amplification of cDNA Ends (RACE) 116 5.2.4 Sequence analysis 117 5.2.5 Tertiary structure modeling . 118 5.2.6 Phylogenetic analysis 118 5.2.7 Hyperosmotic treatments . 118 5.2.8 Quantitative real-time PCR analysis . 118 5.2.9 Plasmid construction for over-expression of DtSBP . 119 5.2.10 Transformation of D. tertiolecta . 120 5.2.11Genomic DNA extraction . 120 5.2.12 Genotyping PCR . 121 5.2.13 Screening of transformants with increased expression of DtSBP by qPCR . 121 5.2.14 Photosynthetic activity measurement of transformants 122 5.2.15 . Growth kinetics and glycerol production of transformants.122 5.2.16 Glycerol measurement . 123 5.2.17 Statistical analysis . 123 5.3 Results 123 5.3.1 Sequence analysis of DtSBP cDNA 123 5.3.2 Phylogenetic analysis 125 5.3.3 DtSBP expression during hyperosmotic conditions 125 viii 5.3.4 Characterization of DtSBP transformants 125 5.4 Discussion 126 5.4.1 Sequence analysis 126 5.4.2 Predicted tertiary structure and regulation of DtSBP 127 5.4.3 Phylogenetic analysis 129 5.4.4 Expression of DtSBP at hyperosmotic conditions 129 5.4.5 Characterization of DtSBP transformants . 133 5.4.6 Other factors which may limit carbon dioxide fixation in D. tertiolecta . 140 5.5 Conclusion 142 Chapter Conclusion and future directions 144 References 147 Appendix 158 Composition of ATCC1174DA culture medium . 158 FeCl3 solution . 158 Glycerol assay standard curve 158 Primers used in this project 159 List of publications/submitted manuscripts 163 ix BOROWITZKA, M. A. & BOROWITZKA, L. J. 1988. Dunaliella. In: BOROWITZKA, L. J. (ed.) Micro-algal Biotechnology. Cambridge: Cambridge University Press. BREAZEALE, V., BUCHANAN, B. & WOLOSIUK, R. 1978. Chloroplast sedoheptulose 1,7-bisphosphatase: Evidence for regulation by the ferredoxin/thioredoxin system. Z. Naturforsch, 33c, 521-528. BROWN, A. D. 1978. Compatible solutes and extreme water stress in eukaryotic micro-organisms. Adv. Microbiol., 17, 181-242. BROWN, F. F., SUSSMAN, I., AVRON, M. & DEGANI, H. 1982. NMR studies of glycerol permeability in lipid vesicles, erythrocytes and the alga Dunaliella. BBA-Biomembranes, 690, 165-173. CADET, F. & MEUNIER, J. C. 1988. Spinach (Spinacia oleracea) chloroplast sedoheptulose-1,7-bisphosphatase. Activation and deactivation, and immunological relationship to fructose-1,6-bisphosphatase. Biochem. J., 253, 243-248. CANNON, G. C., HEINHORST, S. & KERFELD C.A. 2010. Carboxysomal carbonic anhydrases: Structure and role in microbial CO2 fixation. Biochim Biophys Acta, 1804, 382-392. CHANG, T., OHTA, S., IKEGAMI, N., MIYATA, H., KASHIMOTO, T. & KONDO, M. 1993. Antibiotic substances produced by a marine green alga, Dunaliella primolecta. Bioresour Technol, 44, 149-153. CHAO, D. Y., LUO, Y. H., SHI, M., LUO, D. & LIN, H. X. 2005. Saltresponsive genes in rice revealed by cDNA microarray analysis. Cell Res, 15, 796-810. CHEN, B. J. & CHI, C. H. 1981. Process-development and evaluation for algal glycerol production. Biotechnol Bioeng, 23, 1267-1287. CHEN, H. & JIANG, J. G. 2009. Osmotic responses of Dunaliella to the changes of salinity. J Cell Physiol, 219, 251-258. CHEN, H., LAO, Y.-M. & JIANG, J.-G. 2011. Effects of salinities on the gene expression of a (NAD+)-dependent glycerol-3-phosphate dehydrogenase in Dunaliella salina. Sci Total Environ, 409, 12911297. CHEN, M., TANG, H., MA, H., HOLLAND, T. C., NG, K. Y. S. & SALLEY, S. O. 2011. Effect of nutrients on growth and lipid accumulation in the green algae Dunaliella tertiolecta. Bioresour Technol, 102, 1649-1655. CHISTI, Y. 2007. Biodiesel from microalgae. Biotechnol Adv, 25, 294-306. CHITLARU, E. & PICK, U. 1989. Selection and characterization of Dunaliella salina mutants defective in haloadaptation. Plant Physiol, 91, 788-794. CHIU, S.-Y., KAO, C.-Y., CHEN, C.-H., KUAN, T.-C., ONG, S.-C. & LIN, C.-S. 2008. Reduction of CO by a high-density culture of Chlorella sp. in a semicontinuous photobioreactor. Bioresour Technol, 99, 33893396. CHIU, S.-Y., TSAI, M.-T., KAO, C.-Y., ONG, S.-C. & LIN, C.-S. 2009. The air- lift photobioreactors with flow patterning for high-density cultures of microalgae and carbon dioxide removal. Eng Life Sci, 9, 254-260. CHOW, Y. Y. S., GOH, S. J. M., SU, Z., NG, D. H. P., LIM, C. Y., LIM, N. Y. N., LIN, H., FANG, L. & LEE, Y. K. 2013. Continual production of glycerol from carbon dioxide by Dunaliella tertiolecta. Bioresour Technol, 136, 550-555. 148 COLE, J. J., LIKENS, G. E. & STRAYER, D. L. 1982. Photosynthetically produced dissolved organic carbon an important carbon source for planktonic bacteria. Limnol Oceanogr, 27, 1080-1090. COLEMAN, J. 2000. Carbonic Anhydrase and Its Role in Photosynthesis. In: LEEGOOD, R., SHARKEY, T. & VON CAEMMERER, S. (eds.) Photosynthesis. Springer Netherlands. COOPER, T. G., FILMER, D., WISHNICK, M. & LANE, M. D. 1969. The active species of "CO " utilized by ribulose diphosphate carboxylase. J Biol Chem, 244, 1081-1083. CUI, L. Q., CHAI, Y. R., LI, J., LIU, H. T., ZHANG, L. & XUE, L. X. 2010a. Identification of a glucose-6-phosphate isomerase involved in adaptation to salt stress of Dunaliella salina. J Appl Phycol, 22, 563568. CUI, L. Q., XUE, L. X., LI, J., ZHANG, L. & YAN, H. X. 2010b. Characterization of the glucose-6-phosphate isomerase (GPI) gene from the halotolerant alga Dunaliella salina. Mol Biol Rep, 37, 911916. DE MORAIS, M. G. & COSTA, J. A. V. 2007a. Isolation and selection of microalgae from coal fired thermoelectric power plant for biofixation of carbon dioxide . Energ Convers Manage, 48, 2169-73. DE MORAIS, M. G. & COSTA, J. A. V. 2007b. Carbon dioxide fixation by Chlorella kessleri, C. vulgaris, Scenedesmus obliquus and Spirulina sp. cultivated in flasks and vertical tubular photobioreactors. Biotechnol Lett, 29, 1349-1352. DE MORAIS, M. G. & COSTA, J. A. V. 2007c. Biofixation of carbon dioxide by Spirulina sp. and Scenedesmus obliquus cultivated in a three-stage serial tubular photobioreactor. J Biotechnol, 129, 439-445. DOWNING, J., BRACCO, E., GREEN, F., A., K., LUNDQUIST, T., ZUBIETA, I. & OSWALD, W. 2002. Low cost reclamation using the advanced integrated wastewater pond systems technology and reverse osmosis. Water Sci Technol, 45, 117-125. DROCOURT, D., CALMELS, T., REYNES, J. P., BARON, M. & G., T. 1990. Cassettes of the Streptoalloteichus hindustanus ble gene for transformation of lower and higher eukaryotes to phleomycin resistance. Nucleic Acids Res, 18, 4009. DUNFORD, R., DURRANT, M., CATLEY, M. & DYER, T. 1998. Location of the redox-active cysteines in chloroplast sedoheptulose-1,7bisphosphatase indicates that its allosteric regulation is similar but not identical to that of fructose-1,6-bisphosphatase. Photosynth. Res., 58, 221-230. EL-KASSAS, H. Y. 2013. Growth and fatty acid profile of the marine microalga Picochlorum sp. grown under nutrient stress conditions. Egypt J Aquat Res, 39, 233-239. ENHUBER, G. & GIMMLER, H. 1980. The glycerol permeability of the plasmalemma of the halotolerant green alga Dunaliella parva (Volvocales). J Phycol, 16, 524-532. FAN, L.-H., ZHANG, Y.-T., ZHANG, L. & CHEN, H.-L. 2008. Evaluation of a membrane-sparged helical tubular photobioreactor for carbon dioxide biofixation by Chlorella vulgaris. J Membrane Sci, 325, 336-345. 149 FANG, L., LIN, H. X., LOW, C. S., WU, M. H., CHOW, Y. & LEE, Y. K. 2012. Expression of the Chlamydomonas reinhardtii sedoheptulose1,7-bisphosphatase in Dunaliella bardawil leads to enhanced photosynthesis and increased glycerol production. Plant Biotechnol J, 10, 1129-1135. FARRELLY, D., BRENNAN, L., EVERARD, C. & MCDONNELL, K. 2014. Carbon dioxide utilisation of Dunaliella tertiolecta for carbon biomitigation in a semicontinuous photobioreactor. Appl Microbiol Biot, 98, 3157-3164. FERNÁNDEZ, J. F. S., GONZÁLEZ-LÓPEZ, C. V., FERNÁNDEZ, F. G. A., SEVILLA, J. M. F. & GRIMA, E. M. 2012. Utilization of Anabaena sp. in CO  removal processes. Appl Microbiol Biot, 94, 613-624. FUJII, S. & HELLEBUST, J. A. 1992. Release of intracellular glycerol and pore formation in Dunaliella tertiolecta exposed to hypotonic stress. Can J Bot, 70, 1313-1318. GARCÍA, H., FREILE-PELEGRÍN & ROBLEDO D. 2007. Physiological characterization of Dunaliella sp. (Chlorophyta, Volvocales) from Yucatan, Mexico. Bioresour Technol, 98, 1359-1365. GHOSHAL, D., MACH, D., AGARWAL, M. & GOYAL, A. 2002. Osmoregulatory isoform of dihydroxyacetone phosphate reductase from Dunaliella tertiolecta: Purification and characterization. Protein Expres Purif, 24, 404-411. GIMMLER, H. & MOLLER, E. M. 1981. Salinity-dependent regulation of starch and glycerol metabolism in Dunaliella parva. . Plant Cell Environ, 4, 367-375. GIMMLER, H., SCHIRLING, R. & TOBLER, U. 1977. Cation permeability of the plasmalemma of the halotolerant alga Dunaliella parva. I. Cation induced osmotic volume changes. Z Pflanzenphysiol, 83, 145158. GIORDANO, M., BEARDALL, J. & RAVEN, J. A. 2005. CO2 concentrating mechanisms in algae: mechanisms, environmental modulation and evolution. Ann Rev Plant Biol, 56, 99-131. GOYAL, A. 2007. Osmoregulation in Dunaliella, Part II: photosynthesis and starch contribute carbon for glycerol synthesis during a salt stress in Dunaliella tertiolecta. . Plant Physiol Biochem, 45, 705-710. GREEN, B. R. & DURNFORD, D. G. 1996. The chlorophyll- carotenoid proteins of oxygenic photosynthesis. Annu Rev Plant Phys, 47, 685714. GRIZEAU, D. & NAVARRO, J. M. 1986. Glycerol production by Dunaliella tertiolecta immobilized within Ca-alginate beads. Biotechnol Lett, 8, 261-264. HAAKE, V., ZRENNER, R., SONNEWALD, U. & STITT, M. 1998. A moderate decrease of plastid aldolase activity inhibits photosynthesis, alters the levels of sugars and starch, and inhibits growth of potato plants. Plant J, 14, 147-57. HALL, B. G. 2011. Phylogenetic Trees Made Easy: A How-To Manual, Sunderland, MA, Sinauer Associates, Inc. HANAGATA, N., TAKEUCHI, T., FUKUJU, Y., BARNES, D. J., & KARUBE, I. 1992. Tolerance of microalgae to high CO and high temperature. Phytochemistry, 31(10), 3345-3348. 150 HANSEN, J., SATO, M., KHARECHA, P., BEERLING, D., BERNER, R., MASSON-DELMOTTE, V., PAGANI, M., RAYMO, M., ROYER, D. L. & ZACHOS, J. C. 2008. Target atmospheric CO : Where should humanity aim. Open Atmos Sci J, 2, 217-231. HARD, B. C. & GILMOUR, D. J. 1991. A mutant of Dunaliella parva CCAP 19/9 leaking large amounts of glycerol into the medium. J Appl Phycol, 3, 367-372. HARRISON, E. P., WILLINGHAM, N. M., LLOYD, J. C. & RAINES, C. A. 1998. Reduced sedoheptulose-1,7-bisphosphatase levels in transgenic tobacco lead to decreased photosynthetic capacity and altered carbohydrate accumulation. Planta, 204, 27-36. HE, Q. H., QIAO, D. R., BAI, L. H., ZHANG, Q. L., YANG, W. G., LI, Q. & CAO, Y. 2007. Cloning and characterization of a plastidic glycerol 3phosphate dehydrogenase cDNA from Dunaliella salina. J Plant Physiol, 164, 214-220. HE, Y. X., MENG, X. Z., FAN, Q. L., SUN, X. L., XU, Z. K. & SONG, R. 2009. Cloning and characterization of two novel chloroplastic glycerol-3-phosphate dehydrogenases from Dunaliella viridis. Plant Mol Biol, 71, 193-205. HELLEBUST, J. A. 1965. Excretion of some organic compounds by marine phytoplankton. Limnol Oceanogr, 10, 192-206. HELLENS, R., EDWARDS, E. A., LEYLAND, N., BEAN, S. & MULLINEAUX, P. 2000. pGreen: a versatile and flexible binary Ti vector for Agrobacterium- mediated plant transformation. Plant Mol Biol, 42, 819-832. HILLEBRAND, H., DÜRSELEN, C.-D., KIRSCHTEL, D., POLLINGHER, U. & ZOHARY, T. 1999. Biovolume calculation for pelagic and benthic microalgae. J Phycol, 35, 403-424. HO, S. H., CHEN, C. Y., LEE, D. J. & CHANG, J. S. 2011. Perspectives on microalgal CO 2-emission mitigation systems - A review. Biotechnol Adv, 29, 189-198. HO, S. H., CHEN, W. M. & CHANG, J. S. 2010. Scenedesmus obliquus CNW-N as a potential candidate for CO(2) mitigation and biodiesel production. Bioresour Technol, 8725-8730. HOUGHTON, R. A. 2003. Revised estimates of the annual net flux of carbon to the atmosphere from changes in land use and land management 1850–2000. Tellus B, 55, 378-390. HUDSON, G. S., EVANS, J. R., VON CAEMMERER, S., ARVIDSSON, Y. B. & ANDREWS, T. J. 1992. Reduction of ribulose-1,5-bisphosphate carboxylase/oxygenase content by antisense RNA reduces photosynthesis in transgenic tobacco plants. Plant Physiol, 98, 294-302. HUNTSMAN, S. A. 1972. Organic excretion by Dunaliella tertiolecta. J Phycol, 8, 59-63. HU, Q. 2004. Industrial production of microalgal cell mass and secondary products – major industrial species: Arthrospira (Spirulina) platensis. In: Richmond A. (ed.) Handbook of Microalgal Culture: Biotechnology and Applied Phycology. Oxford: Blackwell Sc ience Ltd. 151 INTERGOVERMENTAL PANEL ON CLIMATE CHANGE 2007. Climate Change 2007: The Physical Science Basis.Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change In: S., S., D., Q., M., M., Z., C., M., M., K.B., A., M., T. & H.L., M. (eds.). Cambridge, United Kingdom and New York, NY, USA. INTERGOVERMENTAL PANEL ON CLIMATE CHANGE 2013. Climate Change 2013: The Physical Science Basis. Contribution of Working Group I to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change. In: S., S., D., Q., M., M., Z., C., M., M., K.B., A., M., T. & H.L., M. (eds.). Cambridge, United Kingdom and New York, NY, USA. IVERSON, T. M. 2006. Evolution and unique bioenergetic mechanisms in oxygenic photosynthesis. Curr Opin Chem Biol, 10, 91-100. JACOB-LOPES, E., REVAH, S., HERNÁNDEZ, S., SHIRAI, K. & FRANCO, T. T. 2009. Development of operational strategies to remove carbon dioxide in photobioreactors. Chem Eng J, 153, 120-126. JEFFREY, S. & HUMPHREY, G. 1975. New spectrophotometric equations for determining chlorophylls a, b, c1 and c2 in higher plants, algae and natural phytoplankton. Biochem Physiol Pfl, 167, 191-194. JIMÉNEZ, C. & NIELL, F. X. 1991a. Growth of Dunaliella viridis Teodoresco: effect of salinity, temperature and nitrogen concentration J Appl Phycol, 3, 319-327. JIMÉNEZ, C. & NIELL, F. X. 1991b. Influence of temperature and salinity on carbon and nitrogen content in Dunaliella viridis Teodoresco under nitrogen sufficiency. Bioresour Technol, 38, 91-94. JIN, E., POLLE, J. E. W. & MELIS, A. 2001. Involvement of zeaxanthin and of the Cbr protein in the repair of photosystem II from photoinhibition in the green alga Dunaliella salina. BBA-Bioenergetics, 1506, 244-259. JIN, H. F., LIM, B. R. & LEE, K. 2006. Influence of nitrate feeding on carbon dioxide fixation by microalgae J Environ Sci Health A Tox Hazard Subst Environ Eng, 41, 2813-2814. JONES, A. K. & CANNON, R. C. 1986. The release of micro-algal photosynthate and associated bacterial uptake and heterotrophic growth. Brit Phycol J, 21, 341-358. JONES, T. W. & GALLOWAY, R. A. 1979. Effect of light quality and intensity on glycerol content in Dunaliella tertiolecta (Chlorophyceae) and the relationship to cell growth/osmoregulation. J Phycol, 15, 101106. KAMAL, W. A. 1997. Improving energy efficiency--The cost-effective way to mitigate global warming. Energ Convers Manage, 38, 39-59. KHALIFAH, R. G. 1971. The carbon dioxide hydration activity of carbonic anhydrase: I. Stop- flow kinetic studies on the native human isoenzymes B and C. J Biol Chem, 246, 2561-2573. KISHIMOTO, M., OKAKURA, T., NAGASHIMA, H., MINOWA, T., YOKOYAMA, S.-Y. & YAMABERI, K. 1994. CO fixation and oil production using micro-algae. J Ferment Bioeng, 78, 479-482. 152 KOßMANN, J., SONNEWALD, U. & WILLMITZER, L. 1994. Reduction of the chloroplastic fructose-1,6-bisphosphatase in transgenic potato plants impairs photosynthesis and plant growth. The Plant J, 6, 637650. KRAPP, A., CHAVES, M. M., DAVID, M. M., RODRIQUES, M. L., PEREIRA, J. S. & STITT, M. 1994. Decreased ribulose-1,5bisphosphate carboxylase/oxygenase in transgenic tobacco transformed with ‘antisense’rbcS.VIII. Impact on photosynthesis and growth in tobacco growing under extreme high irradiance and high temperature. Plant Cell Environ, 17, 945-953. KUMAR, A., ERGAS, S., YUAN, X., SAHU, A., ZHANG, Q., DEWULF, J., MALCATA, F. X. & VAN LANGENHOVE, H. 2010. Enhanced CO fixation and biofuel production via microalgae: recent developments and future directions. Trends Biotechnol, 28, 371-380. KURANO, N., IKEMOTO, H., MIYASHITA, H., HASEGAWA, T., HATA, H. & MIYACHI, S. 1995. Fixation and utilization of carbon dioxide by microalgal photosynthesis. Energ Convers Manage, 36, 689-692. KWON, H. S, LEE, J. H., KIM, J. J., JEON P., LEE C. H. & AHN I. K. 2015. Biofixation of a high-concentration of carbon dioxide using a deepsea bacterium: Sulfurovum lithotrophicum 42BKT. RSC Adv, 5, 71517159. LATORELLA, A. H. & VADAS, R. L. 1973. Salinity adaptation by Dunaliella tertiolecta. I. Increases in carbonic anhydrase activity and evidence for a light-dependent Na+/H+ exchange. J Phycol, 9, 273-277. LEE, Y. K. 2001. Microalgal mass culture systems and methods: their limitation and potential. J Appl Phycol 13, 307-315. LEE, Y. K. 2013. Bioprocess Technology. In: LEE, Y. K. (ed.) Microbial Biotechnology: Principles and Applications. 3rd ed. Singapore: World Scientific Publishing Co. Pte. Ltd. LEE, Y. K., CHEN, W., SHEN, H., HAN, D. X., LI, Y. T., JONES, H. D. T., TIMLIN, J. A. & HU, Q. 2013. Basic Culturing and Analytical Measurement Techniques. In: RICHMOND, A. & HU, Q. (eds.) Handbook of Microalgal Culture: Applied Phycology and Biotechnology. 2nd ed. Ames, Iowa: Wiley-Blackwell. LEÓN-BAÑARES, R., GONZÁLEZ-BALLESTER, D., GALVÁN, A. & FERNÁNDEZ, E. 2004. Transgenic microalgae as green cell- factories. Trends Biotechnol, 22 (1), 45-51. LEWIS, N. S. & NOCERA, D. G. 2006. Powering the planet: chemical challenges in solar energy utilization. Proc Natl Acad Sci 103 (43), 15729-15735. LI, Y., HORSMAN, M., WU, N., LAN, C. Q. & DUBOIS-CALERO, N. 2008. Biofuels from microalgae. Biotechnol Progr, 24, 815-820. LIANG, J. Y., YIPING, Z., HUANG, S. & LIPSCOMB, W. N. 1993. Allosteric transition of fructose 1,6-bisphosphatase. Proc. Natl. Acad. Sci., 90, 2132-2136. LIN, H., FANG, L., LOW, C. S., CHOW, Y. & LEE, Y. K. 2013. Occurrence of glycerol uptake in Dunaliella tertiolecta under hyperosmotic stress. FEBS J, 280, 1064-1072. LISKA, A. J., SHEVCHENKO, A., PICK, U. & KATZ, A. 2004. Enhanced photosynthesis and redox energy production contribute to salinity 153 tolerance in Dunaliella as revealed by homology-based proteomics. Plant Physiol, 136, 2806-2817. LIVAK, K. J. & SCHIMITTGEN, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the -CT method. Method, 25, 402-408. LORENZEN, C. 1967. Determination of chlorophyll and pheo-pigments: spectrophotometric equations. Limnol Oceanogr, 12, 343-346. LUMBRERAS, V., STEVENS, D. R. & PURTON, S. 1998. Efficient foreign gene expression in Chlamydomonas reinhardtii mediated by an endogenous intron. The Plant J, 14, 441-447. MADIGAN, M. T., & JUNG, D. O. 2009. An Overview of Purple Bacteria: Systematics, Physiology, and Habitats. In: HUNTER, C. N., DALDAL, F., THURNAUER, M. C. & BEATTY, J. T. (eds): The Purple Phototrophic Bacteria. Netherlands: Springer. MEFFERT, M. E. & OVERBECK, J. 1979. Regulation of bacterial growth by algal release products. Arch. Hydrobiol., 87, 118-121. MELIS, A. 2009. Solar energy conversion efficiencies in photosynthesis: Minimizing the chlorophyll antennae to maximize efficiency. Plant Sci, 177, 272-280. MIYASAKA, H., KANABOSHI, H. & IKEDA, K. 2000. Isolation of several anti-stress genes from the halotolerant green alga Chlamydomonas by simple functional expression screening with Escherichia coli. World J. Microbiol Biotechnol, 16, 23-29. MORONEY, J. V., BARTLETT, S. G. & SAMUELSSON, G. 2001. Carbonic anhydrases in plants and algae. Plant, Cell & Environ, 24, 141-153. MURAKAMI, M. & IKENOUCHI, M. 1997. The biological CO fixation and utilization project by rite (2) — Screening and breeding of microalgae with high capability in fixing CO —. Energ Convers Manage, 38, Supplement, S493-S497. NAGASE, H., EGUCHI, K., YOSHIHARA, K., HIRATA, K. & MIYAMOTO, K. 1998. Improvement of microalgal NOx removal in bubble column and airlift reactors. J Ferment Bioeng, 86(4), 421-423. NATIONAL RESEARCH COUNCIL 2010. Advancing the Science of Climate Change, Washington, DC, The National Academies Press. NEGORO, M., SHIOJI, N., MIYAMOTO, K. & MICIRA, Y. 1991. Growth of microalgae in high CO gas and effects of SO X and NO X. Appl Biochem Biotech, 28-29, 877-886. NELSON, N. & BEN-SHEM, A. 2004. The complex architecture of oxygenic photosynthesis. Nature Reviews Molecular Cell Biology, 5, 971-982. NISSENBAUM, A. 1975. The microbiology and biogeochemistry of the Dead Sea. Microbial Ecol, 2, 139-161. ONO, E. & CUELLO, J. L. 2007. Carbon dioxide mitigation using thermophilic cyanobacteria. Biosyst Eng, 96, 129-134. OREN, A. & SHILO, M. 1985. Factors determining the development of algal and bacterial blooms in the Dead Sea: a study of simulation experiments in outdoor ponds. FEMS Microbiol Lett, 31, 229-237. OREN, A. 2005. A hundred years of Dunaliella research: 1905-2005. Saline Systems, 1(2), doi:10-1186/1746-1448-1-2. 154 OREN-SHAMIR, M., PICK, U. & AVRON, M. 1990. Plasma membrane potential of the alga Dunaliella, and its relation to osmoregulation. Plant Physiol, 93, 403-408. PAGLIARO, M., CIRIMINNA, R., KIMURA, H., ROSSI, M. & DELLA PINA, C. 2007. From glycerol to value-added products. Angew Chem Int Ed, 46, 4434-4440. PIRT, S. J. 1975. Principles of Microbe and Cell cultivation, Oxford, Blackwell Scientific Publications. PRICE, G. D., EVANS, J. R., VON CAEMMERER, S., YU, J. W. & BADGER, M. R. 1995. Specific reduction of chloroplast glyceraldehyde-3-phosphate dehydrogenase activity by antisense RNA reduces CO assimilation via a reduction in ribulose bisphosphate regeneration in transgenic tobacco plants. Planta, 195, 369-78. QUICK, W. P., SCHURR, U., SCHEIBE, R., SCHULZE, E. D., RODERMEL, S. R., BOGORAD, L. & STITT, M. 1991. Decreased rib ulose-1,5bisphosphate carboxylase-oxygenase in transgenic tobacco transformed with “antisense” rbcS. Planta, 183, 542-554. RAINES, C. 2003. The Calvin cycle revisited. Photosynth Res, 75, 1-10. RAINES, C. A., HARRISON, E. P., ÖLÇER, H. & LLOYD, J. C. 2000. Investigating the role of the thiol- regulated enzyme sedoheptulose-1,7bisphosphatase in the control of photosynthesis. Physiol Plant, 110, 303-308. RAINES, C. A., LLOYD, J. C. & DYER, T. A. 1999. New insights into the structure and function of sedoheptulose-1,7-bisphosphatase; an important but neglected Calvin cycle enzyme J Exp Bot, 50, 881-881. REINFELDER, J. R. 2011. Carbon Concentrating Mechanisms in Eukaryotic Marine Phytoplankton. In: CARLSON, C. A. & GIOVANNONI, S. J. (eds.) Annual Review of Marine Science, Vol 3. RIEBESELL, U., WOLF-GLADROW, D. A. & SMETACEK, V. 1993. Carbon dioxide limitation of marine phytoplankton growth rates. Nature, 361, 249-251. SAKAI, N., SAKAMOTO, Y., KISHIMOTO, N., CHIHARA, M. & KARUBE, I. 1995. Chlorella strains from hot springs tolerant to high temperature and high CO . Energ Convers Manage, 36, 693-696. SANTÍN-MONTANYÁ, I., SANDÍN-ESPAÑA, P., GARCÍA BAUDÍN, J. M. & COLL-MORALES, J. 2007. Optimal growth of Dunaliella primolecta in axenic conditions to assay herbicides. Chemosphere, 66, 1315-1322. SCRAGG, A. H., ILLMAN, A. M., CARDEN, A. & SHALES, S. W. 2002. Growth of microalgae with increased calorific values in a tubular bioreactor. Biomass Bioenerg, 23, 67-73. SEKI, M., ISHIDA, J., NARUSAKA, M., FUJITA, M., NANJO, T., UMEZAWA, T., KAMIYA, A., NAKAJIMA, M., ENJU, A., SAKURAI, T., SATOU, M., AKIYAMA, K., YAMAGUCHISHINOZAKI, K., CARNINCI, P., KAWAI, J., HAYASHIZAKI, Y. & SHINOZAKI, K. 2002. Monitoring the expression pattern of around 7,000 Arabidopsis genes under ABA treatments using a full- length cDNA microarray. Func Integr Genomics, 2, 282-291. 155 SPOLAORE, P., JOANNIS-CASSAN, C., DURAN, E. & ISAMBERT, A. S. 2006. Commercial applications of microalgae. J Bio Bioeng, 101(2), 87-96. SRIVASTAVA, S., BHARTI, R. K. & THAKUR, I. S. 2015. Characterization of bacteria isolated from paleoproterozoic metasediments for sequestration of carbon dioxide and formation of calcium carbonate. Environ Sci Pollut Res, 22, 1499-1511. SKJÅNES, K., LINDBLAD, P. & MULLER, J. 2007. BioCO -a multidisciplinary, biological approach using solar energy to capture CO2 while producing H2 and high value products. Biomol Eng, 24, 405-413. STEWART, C. & HESSAMI, M.-A. 2005. A study of methods of carbon dioxide capture and sequestration--the sustainability of a photosynthetic bioreactor approach. Energ Convers Manage, 46, 403420. STITT, M. & SCHULZE, D. 1994. Does Rubisco control the rate of photosynthesis and plant growth? An exercise in molecular ecophysiology. Plant Cell Environ, 17, 465-487. STITT, M., QUICK W.P., SCHURR U., SCHULZE, D., RODERMEL S.R. & BOGORAD L. 1991. Decreased ribulose-1,5-bisphosphate carboxylase-oxygenase in transgenic tobacco transformed with ‘antisense’ rbcS. Planta, 183, 555-556. SUNG, K. D., LEE, J. S., SHIN, C. S. & PARK, S. C. 1999. Isolation of a new highly CO tolerant fresh water microalga Chlorella sp. KR-1. Renew Energ, 16, 1019-1022. SYDNEY, E. B., STURM, W., DE CARVALHO, J. C., THOMAZ-SOCCOL, V., LARROCHE, C., PANDEY, A. & SOCCOL, C. R. 2010. Potential carbon dioxide fixation by industrially important microalgae. Bioresour Technol, 101, 5892-5896. TAMOI, M., KANABOSHI, H., MIYASAKA, H. & SHIGEOKA, S. 2001. Molecular mechanisms of the resistance to hydrogen peroxide of enzymes involved in the Calvin Cycle from halotolerant Chlamydomonas sp. W80. Arch. Biochem. Biophys., 390, 176-185. TANG, H., CHEN, M., NG, S. K. Y. & SALLEY, S. O. 2012. Continuous microalgae cultivation in a photobioreactor. Biotechnol Bioeng, 109, 2468-2474. UNITED NATIONS DEVELOPMENT PROGRAM 2003. World Energy Assessment Report: Energy and the Challenge of Sustainab ility (United Nations, New York.) VAN DER WERF, G. R., RANDERSON, J. T., COLLATZ, G. J., GIGLIO, L., KASIBHATLA, P. S., ARELLANO, A. F., OLSEN, S. C. & KASISCHKE, E. S. 2004. Continental-scale partitioning of fire emissions during the 1997 to 2001 El Niño/La Niña period. Science, 303, 73-76. WANG, B., LI, Y., WU, N. & LAN, C. 2008. CO bio-mitigation using microalgae. Appl Microbiol Biot, 79, 707-718. WEGMANN, K. 1971. Osmotic regulation of photosynthetic glycerol production in Dunaliella. Biochim Biophys Acta, 234, 317-&. 156 WEGMANN, K., BEN-AMOTZ, A. & AVRON, M. 1980. Effect of temperature on glycerol retention in the halotolerant algae Dunaliella and Asteromonas. Plant Physiol, 66, 1196-1197. YANG, W. G., CAO, Y., SUN, X. F., HUANG, F., HE, Q. H., QIAO, D. R. & BAI, L. H. 2007. Isolation of a FAD-GPDH gene encoding a mitochondrial FAD-dependent glycerol-3-phosphate dehydrogenase from Dunaliella salina. J Basic Microbiol, 47, 266-274. YOO, C., JUN, S.-Y., LEE, J.-Y., AHN, C.-Y. & OH, H.-M. 2010. Selection of microalgae for lipid production under high levels carbon dioxide. Bioresour Technol, 101, S71-S74. ZEILER, K. G., HEACOX, D. A., TOON, S. T., KADAM, K. L. & BROWN, L. M. 1995. The use of microalgae for assimilation and utilization of carbon-dioxide from fossil fuel- fired power-plant flue-gas. Energ Convers Manage, 36, 707-712. ZELAZNY, A. M., SHAISH, A. & PICK, U. 1995. Plasma membrane sterols are essential for sensing osmotic changes in the halotolerant alga Dunaliella. Plant Physiol, 109, 1395-1403. ZHANG, Y., LIANG, J.-Y., HUANG, S. & LIPSCOMB, W. N. 1994. Toward a mechanism for the allosteric transition of pig kidney fructose-1,6bisphosphatase. J. Mol. Biol., 244, 609-624. ZIDAN, M. A., HIPKINS, M. F. & BONEY, A. D. 1987. Loss of intracellular glycerol from Dunaliella tertiolecta after decreasing the external salinity. J Plant Physiol, 127, 461-469. 157 Appendix Composition of ATCC1174DA culture medium Component NaCl Tris-HCl (pH 7.5) NaHCO KNO MgSO .7H2 CaCl2 KH2 PO FeCl3 solution H3 BO MnCl2 .4H2 ZnCl2 CoCl2 .6H2 CuCl2 .2H2 Distilled water Concentration 2.0 M 50 mM 20 mM mM mM 300 µM 100 µM 50.0 ml 97 µM 500 nM 102 nM 20 nM 199 pM To 1L FeCl3 solution Component FeCl3 EDTA Distilled water Concentration 1.18 µM 15.7 µM 50.0 ml Glycerol assay standard curve 0.6 y = 0.8133x R² = 0.9939 0.5 Table of primers used A540  0.4RACE 0.3 0.2 0.1 0.1 0.2 0.3 0.4 Glycerol concentration (mg 158 0.5 ml-1) 0.6 0.7 Primers used in this project Primer Sequence (5’-3’) Usage UPM Long: CTAATACGACTCACTATAGGGCAAGCAGTGGTAT CAACGCAGAGT 3’ and 5’ RACE Short: CTAATACGACTCACTATAGGGC NUP AAGCAGTGGTATCAACGCAGAGT Nested 3’ and 5’ RACE DtPFKF1 CTCCATGGCATCAGGTGTTGTG 3’ RACE of DtPFK DtPFKF2 ATGTGTGCCTCATCCCTGAGATT Nested 3’ RACE of DtPFK DtPFKR1 CAATATCTGCCAGGATGGGGTT 5’ RACE of DtPFK DtPFKR2 CCCTTTGAAGCACCCTTCACAA Nested 5’ RACE of DtPFK DtGPDHF1 AGTTCATCTCCCCCTCAGTGCGCGA 3’ RACE of DtGPDH DtGPDHF2 AGGCCTGGGCCCAGAAGAGGATCG Nested 3’ RACE of DtGPDH DtGPDHR1 GTTGATGGTGGTGAACAAG 5’ RACE of DtGPDH 159 Primer Sequence (5’-3’) Usage DtGPDHR2 TGTACTCGATCAGGTTGC Nested 5’ RACE of DtGPDH DtGPDHR3 GAAGGCATCTGCTCCATC Nested 5’ RACE of DtGPDH DtG6PDHF1 TGTGGAGAAGCCCTTTGGCAGGGACAGC 3’ RACE of DtG6PDH DtG6PDHF2 CTGATTGAGAACCTGACAGTGCTGCGCTT Nested 3’ RACE of DtG6PDH DtG6PDHR1 CTGAATGCGGATCACAAGCTCGTTGGTGG 5’ RACE of DtG6PDH DtG6PDHR2 AGCGCCTTGCCAGCCTTGAGCAG Nested 5’ RACE of DtG6PDH DtGPDHF3 GATGCTTCTCCAGAAAGG Cloning of DtGPDH DtGPDHR4 CAAGAATTGGACGGAATAG Cloning of DtGPDH DtG6PDHF3 TCAACCCTTAGCTCGTGC Cloning of DtG6PDH DtG6PDHR3 CTGATGTAACCATTGAACAC Cloning of DtG6PDH DtTUBRTF CAGATGTGGGATGCCAAGAACAT qPCR of DtTUB DtTUBRTR GTTCAGCATCTGCTCATCCACCT qPCR of DtTUB 160 Primer Sequence (5’-3’) Usage DtPFKRTF CTCCATGGCATCAGGTGTTGTG qPCR of DtPFK DtPFKRTR CAATATCTGCCAGGATGGGGTT qPCR of DtPFK DtGPDHRTF CTGAAGAACATCGTGGCTGT qPCR of DtGPDH DtGPDHRTR ATGGAGGCTTTACTGTTGGG qPCR of DtGPDH DtG6PDHRTF GCCATCCGTAATGAGAAGGT qPCR of DtG6PDH DtG6PDHRTR TATTGGCCCAGTGTGACATC qPCR of DtG6PDH DtSBPF1 TGACCCAGGCCAAGATCGGCGACAGC 3’ RACE of DtSBP DtSBPF2 AAGCTGCTGTTCGAGGCCCTGAAGTACT Nested 3’ RACE of DtSBP DtSBPR1 CAGCTTCTCGTATTGAGGGTTGTCTGAGG 5’ RACE of DtSBP DtSBPF3 TGTTCTTGAGGCCACACC Cloning of DtSBP DtSBPR2 GGTGCAATTTCAACTCCAC Cloning of DtSBP DtSBPRTF GTGTTCACCAACGTCACCTC qPCR of DtSBP 161 Primer Sequence (5’-3’) Usage DtSBPRTR TTGATAGGCACATCCAGAGC qPCR of DtSBP DtSBPFHindIII TCTAAGCTTATGGCAACAATGATGGCACAG Primer to amplify and introduce HindIII restriction site into the 5’ end of the coding region of DtSBP DtSBPRSacI AATGAGCTCTTACTTTGCCGCAGCAGCGC Primer to amplify and introduce SacI restriction site into the 3’ end of the coding region of DtSBP bleF TCGAGTTCTGGACCGACCGGCT Genotyping PCR of DtSBP transformants bleR TCCTGCTCCTCGGCCACGAAGT Genotyping PCR of DSBP transformants 162 List of publications/submitted manuscripts CHOW, Y. Y. S., GOH, S. J. M., SU, Z., NG, D. H. P., LIM, C. Y., LIM, N. Y. N., LIN, H., FANG, L. & LEE, Y. K. 2013. Continual production of glycerol from carbon dioxide by Dunaliella tertiolecta. Bioresour Technol, 136, 550-555. NG, D. H. P., LOW, C. S., CHOW, Y. Y. S. & LEE Y. K. 2014. Intracellular glycerol accumulation in light limited Dunaliella tertiolecta culture is determined by partitioning of glycerol across the cell membrane. FEMS Microbiol Lett DOI: 10.1111/1574-6968.12514. NG, D. H. P., ZHAO, R., CHOW, Y. Y. S. & LEE, Y. K. 2013. Cloning of a sedoheptulose-1,7-bisphosphatase cDNA up-regulated by salt from Dunaliella tertiolecta and its expression at hyperosmotic conditions. Submitted to Mol Biol Rep. NG, D. H. P., NG, Y. K., SHEN, H. & LEE, Y. K. 2014. Microalgal biotechnology: the way forward. In KIM, S. (ed.), Handbook of Marine Microalgae: Biotechnology Advances. Elsevier B.V. 163 [...]... project, the growth kinetics and glycerol production of D bardawil, D primolecta and D tertiolecta were characterized Of the three species investigated, D tertiolecta was selected as a candidate for carbon dioxide sequestration and its potential for carbon dioxide capture was evaluated through carbon partitioning studies of glycerol synthesis It was demonstrated that extracellular glycerol produced by D... suitable candidates for photosynthetic carbon dioxide sequestration due to their high growth rate and carbon dioxide fixation capabilities as well as their ability to produce valuable co-products via the bioconversion of carbon dioxide Dunaliella, a halotolerant unicellular green microalga, is a potential microalgal candidate for carbon dioxide capture with extracellular glycerol posing as a novel carbon. .. 2013) Carbon dioxide is the major component of anthropoge nic GHG and accounts for 68% of total GHG emissions (Ho et al., 2011) The burning of fossil fuels is the major cause of elevated atmospheric carbon dioxide levels with power plant flue gas accounting for more than a third of global carbon dioxide emissions (Stewart and Hessami, 2005) Other sources include emissions from deforestation and biomass...Summary High concentrations of atmospheric carbon dioxide from an accumulation of greenhouse gases contribute to global warming Hence, there is an urgent need to reduce atmospheric carbon dioxide levels As compared to other physical and abiotic methods of carbon dioxide mitigation, biological carbon dioxide sequestration by photosynthesis is a sustainable approach for carbon dioxide capture in the long term... as an extended and effective carbon sink The carbon partitioning studies revealed that carbon channeling from a constant rate of carbon fixation is the predominant mechanism for glycerol synthesis in D tertiolecta instead of an increase in carbon dioxide fixation as observed in another Dunaliella species, D salina The investigation of glycerol synthesis of D tertiolecta at nitrogen and light- limited... as one of the strategies for atmospheric carbon dioxide capture (Sydney et al., 2010, Ho et al., 2011) Microalgae can fix carbon dioxide from various sources, including 8 gaseous carbon dioxide from the atmosphere, from industrial flue gases and in the form of soluble carbonates (Kumar et al., 2010, Sydney et al., 2010) Furthermore, some microalgae strains can tolerate high carbon dioxide, NO and SO... Spirulina which are used in health and nutritional supplements, have been widely studied for carbon dioxide conversion into biomass (Spolaore et al., 2006) It has been shown that in addition to having a high rate of carbon dioxide fixation, Chlorella sp can tolerate high concentrations of carbon dioxide (20%) and temperature (35°C) (Hanagata, 1992) A study of reduction of carbon dioxide by a high-density... malate or pyruvate in carbon dioxide fixation In the absence of light, these organic compounds are also utilized as electron donors and carbon sources Some species of purple non-sulphur bacteria are also capable of dark chemolithotrophic growth by using H2 and S2 O3 as electron donors (Madigan and Jung, 2009) Mineralising bacteria can also convert and store carbon dioxide in the form of carbonates such as... suitable candidates to be used in a bio-refinery based carbon dioxide mitigation strategy in the carbon source and nutrients for microalgal cultivation for the production of high value co-products is supplied by power plant flue gas and waste-water respectively (National Research Council, 2010) (Fig ‎ 3) As such, there has been a recent interest in the use of microalgae in 1 biological carbon dioxide. .. as calcite, magnesite and dolomite which are accumulated intracellularly (Cannon et al., 2010) Heterotrophic calcium carbonate precipitating bacteria which use bicarbonate as carbon source and the formation of calcite crystals have been isolated from marble rock of palaeoproterozoic metasediments As carbonates are stable long term storage 3 for carbon dioxide and can also be used as building material, . USE OF DUNALIELLA FOR CARBON DIOXIDE CAPTURE AND GLYCEROL PRODUCTION NG HUI PING DAPHNE (B.Sc. (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY. in Dunaliella 15 1.7 Glycerol as a carbon sink 18 1.8 Dunaliella for carbon dioxide sequestration 19 1.9 Project objectives and hypotheses 20 Chapter 2 Characterization of growth and glycerol. bioconversion of carbon dioxide. Dunaliella, a halotolerant unicellular green microalga, is a potential microalgal candidate for carbon dioxide capture with extracellular glycerol posing as a novel carbon