báo cáo khoa học: "Development of new genomic microsatellite markers from robusta coffee (Coffea canephora Pierre ex A. Froehner) showing broad cross-species transferability and utility in genetic studies" ppt

BioMed Central Page 1 of 19 (page number not for citation purposes) BMC Plant Biology Open Access Research article Development of new genomic microsatellite markers from robusta coffee (Coffea canephora Pierre ex A. Froehner) showing broad cross-species transferability and utility in genetic studies Prasad Suresh Hendre, Regur Phanindranath, V Annapurna, Albert Lalremruata and Ramesh K Aggarwal* Address: Centre for Cellular and Molecular Biology (CCMB), Uppal Road, Tarnaka, Hyderabad- 500 007, Andhra Pradesh, India Email: Prasad Suresh Hendre - prasadhendre@gmail.com; Regur Phanindranath - phanindra@ccmb.res.in; V Annapurna - purnavneni@yahoo.com; Albert Lalremruata - albert.ccmb@gmail.com; Ramesh K Aggarwal* - rameshka@ccmb.res.in * Corresponding author Abstract Background: Species-specific microsatellite markers are desirable for genetic studies and to harness the potential of MAS-based breeding for genetic improvement. Limited availability of such markers for coffee, one of the most important beverage tree crops, warrants newer efforts to develop additional microsatellite markers that can be effectively deployed in genetic analysis and coffee improvement programs. The present study aimed to develop new coffee-specific SSR markers and validate their utility in analysis of genetic diversity, individualization, linkage mapping, and transferability for use in other related taxa. Results: A small-insert partial genomic library of Coffea canephora, was probed for various SSR motifs following conventional approach of Southern hybridisation. Characterization of repeat positive clones revealed a very high abundance of DNRs (1/15 Kb) over TNRs (1/406 kb). The relative frequencies of different DNRs were found as AT >> AG > AC, whereas among TNRs, AGC was the most abundant repeat. The SSR positive sequences were used to design 58 primer pairs of which 44 pairs could be validated as single locus markers using a panel of arabica and robusta genotypes. The analysis revealed an average of 3.3 and 3.78 alleles and 0.49 and 0.62 PIC per marker for the tested arabicas and robustas, respectively. It also revealed a high cumulative PI over all the markers using both sib-based (10 -6 and 10 -12 for arabicas and robustas respectively) and unbiased corrected estimates (10 -20 and 10 -43 for arabicas and robustas respectively). The markers were tested for Hardy-Weinberg equilibrium, linkage dis-equilibrium, and were successfully used to ascertain generic diversity/affinities in the tested germplasm (cultivated as well as species). Nine markers could be mapped on robusta linkage map. Importantly, the markers showed ~92% transferability across related species/genera of coffee. Conclusion: The conventional approach of genomic library was successfully employed although with low efficiency to develop a set of 44 new genomic microsatellite markers of coffee. The characterization/validation of new markers demonstrated them to be highly informative, and useful for genetic studies namely, genetic diversity in coffee germplasm, individualization/bar-coding for germplasm protection, linkage mapping, taxonomic studies, and use as conserved orthologous sets across secondary genepool of coffee. Further, the relative frequency and distribution of different SSR motifs in coffee genome indicated coffee genome to be relatively poor in microsatellites compared to other plant species. Published: 30 April 2008 BMC Plant Biology 2008, 8:51 doi:10.1186/1471-2229-8-51 Received: 27 September 2007 Accepted: 30 April 2008 This article is available from: http://www.biomedcentral.com/1471-2229/8/51 © 2008 Hendre et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. BMC Plant Biology 2008, 8:51 http://www.biomedcentral.com/1471-2229/8/51 Page 2 of 19 (page number not for citation purposes) Background Coffee tree, a member of the family Rubiaceae, belongs to the genus Coffea that comprises > 100 species. Of these two species, the tetraploid Coffea arabica L. (i.e. arabica coffee; 2n = 4x = 44) and the diploid C. canephora Pierre ex A. Froehner (i.e. robusta coffee; 2n = 2x = 22), are cul- tivated commercially. Coffee, one of the most popular non-alcoholic beverages, is consumed regularly by 40% of the world population mostly in the developed world [1], and thus occupies a strategic position in the world socio- economy. Efforts undertaken globally to improve coffee, though suc- cessful, have proven to be too slow and severely con- strained owing to various factors. The latter includes: genetic and physiological makeup (low genetic diversity and ploidy barrier in arabicas, and self incompatibility/ easy cross-species fertilization in robustas), long genera- tion cycle, requirement of huge land resources, and equally the dearth of easily accessible and assayable genetic tools/techniques for screening/selection. The situ- ation warrants recourse to newer, easy, practical technolo- gies that can provide acceleration, reliability and directionality to the breeding efforts, and allow character- ization of cultivated/secondary genepool for proper utili- zation of the available germplasm in genetic improvement programs. In this context, development of DNA marker tools and availability of markers-based molecular linkage maps becomes imperative for MAS- based accelerated breeding of improved coffee genotypes. Among the different types of DNA markers, the Short Sequence Repeats (SSR) based microsatellite markers promise to be the most ideal ones due to their multi- allelic nature, high polymorphism content, locus specifi- city, reproducibility, inter-lab transferability and ease for automation [2]. Microsatellite markers have been devel- oped for a large number of plant species and are increas- ingly being used for ascertaining germplasm diversity, linkage analysis and molecular breeding [3]. Despite these advantages, only ~180 microsatellite markers have been reported till to date for coffee [4-12], signifying the need for expanding the repertoire of these genetically highly informative markers for efficient management and improvement of coffee germplasm resources. Here we report, a set of 44 novel microsatellite markers developed by radioactive screening of a small-insert partial genomic library of C. canephora (robusta coffee). Interestingly, all these markers exhibit broad cross-species transferability. We also demonstrate their utility as genetic markers for ascertaining the germplasm diversity, genotype individu- alization, linkage mapping and taxonomic affinities. Results The present study aimed to isolate new coffee-specific informative SSRs useful as genetic markers for characteriz- ing coffee genome and linkage mapping studies. For the purpose, a partial small-insert genomic library was con- structed from a commercially cultivated robusta variety 'Sln-274'. The library was screened using radioactive SSR oligo probes to isolate SSR-containing DNA fragments, which were sequenced and used for designing primer pairs from the flanking regions and subsequent conver- sion to PCR-based SSR markers. The designed primer pairs were standardized for PCR amplification, and then vali- dated for utility as genetic markers using panels of elite coffee genotypes, a mapping population for linkage stud- ies, and related taxa of coffee for cross-species transferabil- ity. In addition, sequence data of the screened and putative SSR-positive selected clones were used to assess the relative abundance of different SSR motifs in robusta coffee genome. In total 44 new highly informative SSR markers are developed. Screening/Identification of SSR positive genomic sequences from the small insert partial genomic library of Sln-274 The small-insert partial genomic library constructed from robusta variety Sln-274 comprised 15,744 clones. Radio- active screening of the arrayed and blotted clones indi- cated 446 putative positives of which good quality sequence data could be obtained for 199 clones. The aver- age insert size of the sequenced clones was 773.5 bp. Con- sidering the latter, and that the sequenced clones represented a random sample of the genomic library with respect to the size, the total size of the cloned genome amounted to 12.2 Mb which equaled to ca. 1.5 % of the robusta coffee genome [13] (Table 1). SSR search of the clone sequences using the MISA search module, detected 76 genuine SSR-positive clones (0.48% of the total library) containing both targeted and non-targeted SSR motifs. Overall, these clones contained 92 SSRs compris- ing DNRs (48.3%), TNRs (25.9%), and HO-NRs (4.8%), and 24 SSRs comprising only MNRs (20.7%) (Table 1, 2). Among the targeted repeat motifs (screened SSR-oligo nucleotides), AG was the most abundant repeat (26.7%), followed by AC (12.9%) and AGC (7.8%), whereas CCG (0.9%) was the least abundant and ACT was not detected at all (Table 2). Similarly, among the non-targeted SSR motifs other than MNRs, AT was the most abundant repeat (8.6%, Table 2). Frequency and distribution of SSRs in coffee genome A total of 76 targeted SSRs (DNRs and TNRs) and 10 non- targeted DNRs were assessed for their lengths, distribution in the present library, and their relative abundance in the robusta genome (Table 2). Average length (in terms of repeat units) for the DNRs and TNRs was 9.6 and 5.9, BMC Plant Biology 2008, 8:51 http://www.biomedcentral.com/1471-2229/8/51 Page 3 of 19 (page number not for citation purposes) respectively. Among DNRs, AT and AG were comparable and longer than AC, whereas ACG and AGC were the longest of the TNRs (Table 2). The size of cloned/screened genomic library and the observed data for identified SSRs were considered along with the earlier predicted size of the robusta genome [13] to derive relative estimates for frequency/distribution of different SSR motifs in the robusta genome. The analysis revealed coffee genome to be enriched in AT type DNRs (AT-DNR), which were esti- mated to be many fold more than any other SSR motifs (targeted and/or non-targeted). The results indicated one AT-DNR per 16 Kb (1/16 Kb) of robusta genome; this was almost 20-fold higher than the next most abundant DNR i.e. AG (ca. 1/393 Kb). The DNRs as a single class were estimated to be 1/15 Kb genome when AT (comprising 94% of the total DNRs) was included, and 1/265 Kb cof- fee genome for the remaining ones. In comparison, the overall frequency of TNRs was calculated to be 1/406 Kb with AGC being the most predominant (ca. 1/1300 Kb) and CCG the least (ca. 1/12200 Kb). In addition, a few other higher order SSRs (mainly the AT-rich) were also detected but these were not used for estimate calculations, as their numbers were very low. Thus, the present study indicated an abundance of one SSR (either DNR or TNR) per 15 Kb of robusta coffee genome, wherein the DNRs were ~27 times more abundant than the TNRs. Development of microsatellite markers All the identified SSR-positive sequences were tried to design primer pairs for conversion to microsat markers using 'SSR motif length' (of ≥ 7 and 5 repeats for DNRs and higher order SSRs, respectively) as one major crite- rion. As a result, only 56 of the total 92 identified SSRs (all except MNRs) were found suitable for primer design indi- cating 60.9% primer suitability. These comprised 42.2% DNRs, 40.7% compound SSRs, 6.8% TNRs, 5.1% TtNRs and 1.7% HNRs. In addition, primers were also designed for 2 of the randomly chosen 14 MNRs to test their poten- tial for conversion to SSR markers. Among the SSRs found unsuitable for primer design, 70.6% had shorter motif length and 29.4% had flanking regions unsuitable for primer modeling. Of the 58 potential primer pairs designed, 52 could be successfully amplified and 44 of these could further be validated (Table 3, 4) as useful markers indicating ~76% primer to marker conversion ratio. Validation of microsatellite markers for use in genetic studies Germplasm characterization Allelic diversity, heterozygosity status and extent of polymorphism For ascertaining the useful attributes of genetic markers, all the new 44 microsatellite markers were tested on a panel of 16 elite robusta and arabica genotypes. Good Table 1: Summary statistics of screening of the small-insert partial genomic library of robusta coffee for putative SSR positive clones/ sequences and SSRs. Summary of Screening/sequencing Total Number of clones screened (X) 15,744 Number of clones selected and sequenced after screening 446 (2.83% of X) Number of good quality sequences obtained 199 (1.27% of X) Total number of SSR containing clones (Y) 76 (0.48% of X) Number of sequences containing more than 1 SSR core 26 (34.21% of Y) Number of sequences containing compound SSRs 15 (12.93% of Y) Number of SSR+ sequences used for primer design/synthesis 58 (0.37% of X) Number of working primer pairs 53 (0.34% of X) Average size of the cloned/sequenced insert 773.5 bp Haploid genome size of C. canephora [13] 809 Mb Estimated genome screened (number of library clones x. average insert size) 12.2 Mb (1.5 % genome equivalent) C. canephora genome sequenced (good quality sequences × average insert size) 0.15 Mb (0.01 % of robusta genome) Summary of SSRs identified in the library Number of non-targeted MNRs of minimum 12-mer length (a) 24 (0.15% of X) Number of targeted DNRs having a minimum of 6 repeats (b) 46 (0.29% of X) Number of non-targeted DNRs having a minimum of 6 repeats (c) 10 (0.06% of X) Total number of DNRs (b+c) 56 (0.36% of X) Number of targeted TNRs having a minimum of 5 repeats (d) 30 (0.19% of X) Total number of DNRs and TNRs (b+c+d) 86 (0.55% of X) Total Number of non-targeted HO-NRs having a minimum of 5 repeats (e) 6 (0.04% of X) Total Number of DNRs, TNRs and HO-NRs (b+c+d+e) 92 (0.58% of X) Total Number of SSRs (a+b+c+d+e) 116 (0.73% of X) BMC Plant Biology 2008, 8:51 http://www.biomedcentral.com/1471-2229/8/51 Page 4 of 19 (page number not for citation purposes) allelic amplification was obtained for all the markers across the tested genotypes, except for CaM54 that did not give any amplification for the arabicas. In general, the new markers revealed low to medium allelic diversity, and notably 13 of them (CaM02, 06, 15, 18, 21, 31, 34, 35, 39, 43, 55, 57, 58) resulted in double alleles in case of all the tested arabicas. Overall, a maximum of six and seven alle- les (N A ) with an average of 2.7 and 3.8 alleles/marker were obtained for the tested markers of which 83.7% and 90.9% were polymorphic/informative forarabica and robusta genotypes respectively (Table 4). Seven markers (CaM08, 09, 11, 12, 22, 23, 53) in the case of arabicas and four (CaM11, 13, 15, 23) for robustas were found to be monomorphic. The distribution of number of alleles amplified by each polymorphic marker (Pm) was highly skewed for arabica genotypes (Kurtosis: 1.19 and Skew Table 2: Summary statistics of distribution and abundance of detected SSRs in the tested genomic library and SSR frequency estimates for robusta coffee genome SSR motif SSRs detected in the library (% of total SSRs) Mean no. of repeats/SSR (Range of repeat iterations in the SSR core) Estimated number/distance of SSRs in the robusta coffee genome Total SSRs/genome (X = n.a/b)* SSRs/Mb genome (Y = X/a) SSR spacing in the genome @ (Z = 1000/ Y) Targeted SSRs (DNRs T + TNRs T ) AG 31(26.7) 10.0 (6 to 29) 2057 2.5 393 AC 15 (12.9) 8.4 (6 to 14) 995 1.2 812 DNRs T 46 (39.7) 9.6 (6 to 29) 3053 3.8 265 AGC 9 (7.8) 6.8 (5 to 10) 597 0.7 1354 ATC 4 (3.5) 5.0 (5) 265 0.3 3048 ACG 3 (2.6) 6.7 (5 to 9) 199 0.3 4063 ACC 3 (2.6) 5.7 (5 to 7) 199 0.3 4063 AAT 3 (2.6) 5.3 (5 to 6) 199 0.3 4063 AAC 3 (2.6) 5.0 (5) 199 0.3 4063 AGG 2 (1.7) 6.0 (5 to 7) 133 0.7 6095 AAG 2 (1.7) 5.5 (5 to 6) 133 0.7 6095 CCG 1 (0.9) 6.0 (6) 66 0.1 12190 ACT 0 TNRs T 30 (25.9) 5.9 (5 to 10) 1991 2.5 406 SSRs T 76 (65.5) 8.3 (5 to 29) 5044 6.2 160 Non-targeted DNRs (DNRs NT ) AT/AT 10 (8.6) 10.3 (6 to 23) 50563 # 62.50 16 Miscellaneous non-targted SSRs A/T 21 (18.1) nc C/G 3 (2.6) Note: Three of these MNRs were detected as part of the compound SSR motifs AAAT 2 (1.7) Nc AAGTGG 2 (1.7) AATT 1 (0.7) AAAAAT 1 (0.7) DNRs T+NT 56 (48.3) 11.5 (6 to 29) 53616 66.3 15 DNRs T+NT & TNRs T 86 (74.1) 9.5 (5 to 29) 55607 68.7 15 nc: Not calculated *: X = estimated number of SSRs in genome; n = No. of detected SSRs in the library; a = 809 Mb -size of the haploid robusta genome [13]; b = 12.19 Mb- size of the screened robusta genome (see table 1) # : b = 0.16 Mb -size of genome sequenced @ : Distance (in Kb) between two consecutive SSRs T : Targeted SSRs; NT : Non-targeted SSRs BMC Plant Biology 2008, 8:51 http://www.biomedcentral.com/1471-2229/8/51 Page 5 of 19 (page number not for citation purposes) Table 3: Details of the newly developed SSR primers Sl. No. Primer Id Primer sequence (F: Forward; R: reverse) Repeat unit Ta (°C) Amplicon (bp) GenBank accession No. Linkage group 1 CaM02 F: CGCCAGCCACAGCCACTTGC (AGG)7 50 224 EU526557 R: GCGGGGGTAAGAAAGAGGCGAG 2 CaM03 F: CGCGCTTGCTCCCTCTGTCTCT (AC)11 57 173 EU526558 CLG03 R: TGGGGGAGGGGCGGTGTT 3 CaM06 F: ACCCGATATTCAACCGACATGC (CT)7 50 278 EU526559 R: CATGACTTGAGCGCTAATATTTGAT 4 CaM08 F: CAGCTGAAGTGGTGAAAAACAAGAG (TC)8 50 202 EU526560 R: CGCTTTCTTGTTTTCTCCATTTCAG 5 CaM09 F: CAGGAAGAGAAGAAAGTGAAATTGAC (TC)8 50 137 EU526560 R: CGCTTTCTTGTTTTCTCCATTTC 6 CaM11 F: GTCCCCGCTTAAATAATATACACACA (AC)8–15 bp-AC(6)(AT)6 50 285 EU526561 R: ATAGGACGGAGGGAGTAATAGAATAAA 7 CaM12 F: TTCGGGCTCACCTGGCAG (CAG)10 50 155 EU526562 R: CGCGGAAGCAGGACATGGATT 8 CaM13 F: CCTCGCCCTCAATCACCTCCTAG (AAAT)5 50 287 EU526563 R: GGCTCCCCAAGAATCCTCAACTC 9 CaM15 F: AGCCCTAGACGAGATGGATTCC (CAG)5 50 170 EU526564 R: CGGCTCCTTCTGCACTCCCATTT 10 CaM16 F: AAGGCAGCTGAAGCGGGACAAA (TC)11 50 199 EU526565 CLG11 R: TGGGGAGAGCTGCAGTTGGAGG 11 CaM17 F: CGGGCGTTTCTTCTTTTGAGTTGC (GTC)6 50 212 EU526566 R: TCACGGTTTCTCAAGTCGGGGATTTA 12 CaM18 F: CCGACTTGGACTGATGCGAAATTGA (TC)9 57 181 EU526567 R: AAAGCAAAAAACCAGAAAACACGAAGA 13 CaM20 F: GAAACCGCTGAAATTCGGTA (TATGGG)3 57 217 EU526568 CLG16 R: CCCTCTGATTTCTCCTTTCATC 14 CaM21 F: GGGCTTACCGACCGCTCACAG (TC)8 57 161 EU526569 R: CCGCTATTGTTGCTGCTATGGAGTTG 15 CaM22 F: CCCCTCCTCCTCCTACTAGATGGTGGT (AT)15 57 113 EU526570 CLG02 R: GGTCCAGGGTCCATCCATTCTTGA 16 CaM23 F: TGCTTGTAAGGGAATTTCTGGTCAG (AATT)5 50 154 EU526571 R: GTGCGAATGTGGAACCTTTTAAGTCA 17 CaM24 F: GGATTCGACAAGGTTGGCAGAGC (CCT)5–87 bp-(CTG)6 57 193 EU526572 R: TGCCGAAGAAGAGGGAGATAGTGATG 18 CaM25 F: TCCATCTTCCTTCATTTCTGCTGCTAA (GA)9 57 186 EU526573 R: CCTTCACCCCCTTTGCACTTCCTTA 19 CaM26 F: CGTTGCCATTTCTTCCCTTCTTTCTTC (TG)7–21 bp-(GA)9 57 236 EU526574 R: ACACCTTACCCCCTTATCGTTTAGAA 20 CaM27 F: AAGAGTGTTTGGGATTGCATTTTTAT (TA)7(GT)14 55 178 EU526575 R: CCGCGTAGGCTTTGTTTGG 21 CaM30 F: TTGCCTTCCGGATTTTTGATTCA (CA)6(TA)5 50 222 EU526576 R: AGTTCTAAGGCTGAGGCGGCTAAAG 22 CaM31 F: ATCCACTGCTGTCACCTTTTGTTA (TAA)5 55 261 EU526577 R: AGCAGTGTGTGTGTTAAAGAGGAGTT 23 CaM32 F: CAGACAGACCAGAGAGAGACACCTAAC (TA)12 50 204 EU526577 CLG12 R: CCCCCTCCAAAATAATTCAGAAAA 24 CaM33 F: GCGCATTAGGCGTGGGAGAA (A)13–5 bp-(AG)18 55 240 EU526578 R: CAGAGGTTGTCGGTCAGGTGGAGAA 25 CaM34 F: CTCCAAATTATTAAGCACAACAAACAA (GA)10 55 202 EU526579 R: ATCCGCCTCCAGGTCTTATCC 26 CaM35 F: CGAGCTAGAATGGATGACTTGGTTGG (TGGAAG)5 55 203 EU526580 CLG04 R: GTTGCTCGCACCCGCTTCC 27 CaM36 F: TGGTTTTAGTTTGTTTATTTTGATGTGAT (TTA)7 55 185 EU526581 R: CGAGCCCTCCCCTTGCA 28 CaM38 F: GAAGCTGAAGCGGGAGGGTAGTAATT (G)13(GA)7 55 228 EU526582 R: CCCATCCACCCAACCTTCATTTC 29 CaM39 F: GAGCAGAGGGAGACGGTGTGGT (GA)12 50 196 EU526583 R: CGCGCAACTCTTCGAACTCTAACC 30 CaM40 F: TTGACACGAAACAGGAAATAAATATAG (CGA)8 55 238 EU526584 R: CCCTTCCCCTCATAGCCCTTT 31 CaM41 F: CATCGTCTCCATCGTTGCTCTATC (TAAA)5 55 242 EU526585 R: CCCTCCCCCTCTTTCCTATCTAAT 32 CaM42 F: TGGGTCAAGGATCCGTGTAAGAAAGA (CT)8 55 191 EU526586 CLG01 R: CCCTCACCAGTTCCCGATGTCAG 33 CaM43 F: CCTGACCGTGAACCTGACCGTGAC (CT)8 55 202 EU526587 R: TCGGGACTTGTTTTGGTTTTTGGGT BMC Plant Biology 2008, 8:51 http://www.biomedcentral.com/1471-2229/8/51 Page 6 of 19 (page number not for citation purposes) ness: 1.22) in comparison with robustas (Kurtosis: -1.08 and Skewness: -0.57) as seen in Figure 1a. The PIC values varied considerably for the new markers across the tested genotypes. The mean PIC value for arabi- cas was 0.49 (range 0.12 – 0.81), which was significantly less than 0.62 (0.23 – 0.83) observed for robusta (Table 4, Figure 1b). Further, the student's t test revealed highly sig- nificant differences in the total number of amplified alle- les (N A ) and PIC value estimates for arabica and robusta genotypes (N A : t = 3.18, P = 0.00, and PIC: t = 3.46, P = 0.00) for the amplified and comparable markers. The above SSR allelic data, when used to calculate the het- erozygosity estimates, revealed highly significant differ- ences between the observed and expected heterozygosity both for arabicas (mean H o : 0.29 and mean H e = 0.50; paired t value = 3.64; P = 0.00) as well as for robustas (mean H o : 0.52 mean H e : 0.63; paired t value = -2.54; P = 0.01). The results, thus, suggested significant heterozygote deficiency in both the germplasm sets. Further, only 15 of the 23 Pms (62.5%) were found to be in HW equilibrium in the case of arabicas, while the remaining eight showed significant heterozygote deficiency (Table 4) corroborat- ing the heterozygosity data. Similarly, in robustas, 28 (65.2%) of the 41 Pms were found to be in HW equilib- rium and of the remaining 14 Pms, eight markers showed significant heterozygote deficiency while six markers showed heterozygote excess. The LD test performed for all the Pms, showed 29.8% (82 of 275) and 25.0% (202 of 780) pair-wise comparisons in significant dis-equilibrium (P < 0.05) for arabicas and robustas respectively. On an average each Pm was found to be in dis-equilibrium with 3.4 (SD: ± 2.4, SE: ± 0.51) other Pms in case of arabicas and 4.9 (SD: ± 4.0, SE: ± 0.63) for robustas. The maximum LD was observed for the marker CaM24 (with six other markers) in arabicas and CaM26 (with eight other markers) in robustas. Discriminatory power (individualization capacity) of novel SSR markers The discriminatory power of all the new informative SSR markers for possible genotype individualization were inferred by calculating two types of the 'probability of identity' (PI) estimates i.e. sib-based and unbiased consid- ering the tested germplasm as related or unrelated, respec- tively. PI estimates obtained (Table 5), show that the sib- based PI values for individual markers were around 10 -1 for both the arabicas and robustas, whereas the unbiased PI estimates ranged from 10 -1 – 10 -4 for arabicas and 10 -1 – 10 -3 for robustas. In comparison, the cumulative PIs indicating discriminatory power of the new markers were found to be manifold higher for the tested robusta genepool compared to arabicas. The sib-based cumulative PIs calculated over 10, 20 and total number of most informative markers (23 in the case of arabicas and 40 in the case of robustas) were: 4.28 × 10 -4 , 8.39 × 10 -6 , 5.29 × 10 -6 for arabicas, and 5.1 × 10 -5 , 1.81 × 10 -8 , 1.22 × 10 -12 for robustas. Similarly, comparable unbiased cumulative PI estimates were: 2.14 × 10 -15 , 4.59 × 10 -20 , 1.09 × 10 -20 for arabicas, and 2.68 × 10 -20 , 4.54 × 10 -32 , 2.05 × 10 -43 for robustas. 34 CaM44 F: TGCTCTTGCCCTCTTTCATCC 55 222 EU526588 CLG09 R: TCCCGAAAAAGAAAATAAGATAAAGAG (CT)9 35 CaM45 F: CGCGGCCAGTGAATTCGAGCTC (GT)8(GA)5 50 218 EU526589 R: TCGCCATTTGGAGCTGCTGATTCA 36 CaM46 F: TGGTGCGGTGTTTTTCAGTTTGGAGA (AT)9 (AC)12 55 222 EU526590 CLG11 R: AACCACCCACGCCCACCAATTAAAT 37 CaM49 F: CCGGTTAATACATTGGTCTTT (A)33 55 200 EU526591 R: ATGACATTGTTGACTTTGCTATAA 38 CaM52 F: TGCCACTCGGAGCTCACTTCA (CCG)6 55 160 EU526592 R: GGCTGCCGAGGTTCCAATT 39 CaM53 F: TTAGGTGTGAGGAGGGATGGGACTG (GGC)9 50 172 EU526593 R: CCACAGACTCCTCGTTCGGCAATC 40 CaM54 F: ACGGGTGAGTCGAAGGGGGAGCAGT (GGCAGA)4–22 bp- (GCA)9 50 185 EU526593 R: CACGCCGGCCCACATCTCGAAA 41 CaM55 F: ATGGGGGGTGTCGGTCTATGTGA (GA)4(G)4 (A)27 50 183 EU526594 R: CGCAATTCGCTGTCACCTCCG 42 CaM57 F: CGAACTCGAACTCAAGCTCAGA (TA)23 50 190 EU526595 R: AAGGATATATACGGTAATTTTA 43 CaM58 F: ACCCCCTCTCCCTCTCCATTTTTAC CAGA(CA)7 55 192 EU526596 R: GCACGAGGATGGAGCAGAGCACT 44 CaM59 F: AAGTGAGTGGTTGTGGCATTAAAT GATA(GA)8 50 229 EU526591 R: TTCTTACAAAATCTCATCCCCTCAT CaM: Canephora Microsatellite marker; ' ': Unmapped; these were not polymorphic among parents of the tested mapping population; CLG: Combined Linkage Group (as per [13]). The amplicon size is based on the original clone of Sln-274 genomic library from which the marker was designed. Table 3: Details of the newly developed SSR primers (Continued) BMC Plant Biology 2008, 8:51 http://www.biomedcentral.com/1471-2229/8/51 Page 7 of 19 (page number not for citation purposes) Table 4: Allelic diversity attributes of new SSR markers as revealed across elite genotypes of arabica and robusta, and related coffee taxa Primer Id C. arabica (n = 8) C. canephora (n = 8) Coffea spp. (n = 12) Psilanthus spp. (n = 2) N A PA $ Allele range H o H e PIC N A PA $ Allele range H o H e PIC N A PA $ Allele range N A PA $ Allele range CaM02 2 0 252–262 Duplicated loci 2 0 256–268 0.71 0.69 0.67 8 4 a,c,k,l 252–278 2 0 262–272 CaM03 6 1 6 164–184 0.38 0.74* 0.70 6 0 171–194 0.63 0.88 0.83 12 5 c,e,f,j,l 165–201 1 1 m 187 CaM06 3 0 285–327 Duplicated loci 2 0 275–277 1.00 0.53* 0.56 4 1 j 275–289 2 0 275–281 CaM08 1 0 210 Monomorphic 3 1 16 201–205 0.50 0.43 0.40 4 2 b,l 142–201 1 1 n 254 CaM09 1 0 135 Monomorphic 3 1 16 135–139 0.50 0.43 0.40 7 5 a,b,g,l 124–211 NA CaM11 1 0 286 Monomorphic 1 0 286 Monomorphic 4 2 c,h 278–295 NA CaM12 1 0 137 Monomorphic 4 1 10 122–137 1.00 0.65** 0.61 4 1 g 124–137 2 0 131–137 CaM13 2 1 5 281–286 0.00 0.23 0.23 1 0 286 Monomorphic 7 3 j,k 278–336 2 1 n 255–283 CaM15 2 0 167–170 Duplicated loci 1 0 167 Monomorphic 2 1 l 164–167 2 2 m,n 153–156 CaM16 3 0 187–198 0.63 0.51 0.49 4 1 11 181–198 0.75 0.74 0.72 9 2 c,l 177–198 2 0 191–193 CaM17 2 0 175–181 0.88 0.53 0.55 2 0 175–181 0.63 0.46 0.48 3 1 l 162–181 2 0 175–181 CaM18 5 0 180–189 Duplicated loci 5 0 178–186 0.38 0.79** 0.75 12 5 d,e,j,k 174–189 1 0 175 CaM20 2 0 184–192 0.13 0.46 0.48 3 0 192–200 0.13 0.42* 0.40 3 1 d 192–198 NA CaM21 2 0 158–164 Duplicated loci 4 1 10 158–162 0.25 0.64** 0.62 9 3 a,j,l 154–178 3 3 m,n 161–172 CaM22 1 0 103 Monomorphic 6 2 9,16 99–110 0.43 0.86** 0.80 8 2 c,l 82–122 1 0 88 CaM23 1 0 154 Monomorphic 1 0 154 Monomorphic 3 1 l 140 154 2 2 m,n 152–158 CaM24 2 0 191–197 0.00 0.50** 0.52 4 0 191–198 0.43 0.71 0.67 8 4 a,b,g,l 178–204 2 2 m,n 177–189 CaM25 4 0 182–185 0.13 0.53** 0.5 3 0 182–184 0.63 0.51 0.48 5 0 182–186 2 0 182–186 CaM26 3 0 252–259 0.00 0.43** 0.42 5 0 247–255 0.25 0.80** 0.76 11 3 g,h,k 241–262 1 0 254 CaM27 3 0 150–169 0.13 0.34 0.33 3 0 161–169 0.88 0.68 0.64 8 2 a,c 150–169 2 0 161–168 CaM30 2 0 216–229 0.13 0.13 0.12 2 0 216–218 0.63 0.46 0.48 7 2 f,j 212–229 4 3 m,n 210–225 CaM31 3 0 258–261 Duplicated loci 4 0 258–262 0.38 0.59 0.57 6 2 h,k 258–267 1 1 m 265 CaM32 4 0 127–145 0.88 0.69 0.68 5 1 14 145–158 0.75 0.72 0.68 10 2 a,e 127–164 3 1 m 133–145 CaM33 3 2 1,6 230–233 0.13 0.34 0.32 7 2 12,13 226–241 0.71 0.88 0.83 11 5 b,d,f,i,k 213–143 1 1 m 217 CaM34 2 0 194–199 Duplicated loci 2 0 198–200 0.00 0.23 0.23 5 2 e,l 194–209 2 2 m,n 166–171 CaM35 3 0 192–211 Duplicated loci 4 0 198–211 0.63 0.69 0.66 7 1 g 186–211 1 0 204 CaM36 5 3 3,7,8 228–253 0.00 0.85** 0.78 7 6 except 10,15 230–268 0.17 0.92** 0.86 10 8 a,c,e,f,h,i,h,l 181–262 1 1 n 190 CaM38 6 14 214–226 0.38 0.86** 0.81 5 2 9,10 , 12,15 227–235 0.17 0.80** 0.74 6 2 b,d 220–241 2 0 223–227 CaM39 2 0 174–186 Duplicated loci 3 0 180–194 1.00 0.59* 0.60 9 2 b,h 174–205 3 3 m,n 208–229 CaM40 5 15 230–240 0.40 0.82 0.75 7 1 16 226–242 0.50 0.91* 0b.86 8 2 d,e 232–246 3 0 233–239 CaM41 6 4 5,6,8 232–243 0.25 0.68** 0.65 5 1 9 234–242 0.25 0.81** 0.77 4 0 235–242 2 1 n 237–244 CaM42 2 0 192–196 0.75 0.50 0.52 2 0 190–192 0.00 0.53* 0.56 7 2 e,l 173–199 2 2 m,n 191–195 CaM43 3 0 196–211 Duplicated loci 4 2 11,15 198–203 0.63 0.64 0.64 10 4 b,c,e,f 188–224 2 1 n 192–196 CaM44 2 16 215–217 0.00 0.23 0.23 2 0 224–226 0.00 0.23 0.23 10 3 c,h,l 194–227 3 1 n 221–227 CaM45 3 0 151–182 0.50 0.43 0.42 5 2 10,13 151–235 0.75 0.6 0.57 8 3 d,i,k 147–214 3 1 m 145–193 CaM46 4 2 3,6 208–228 0.38 0.69 0.65 6 1 14 208–223 0.38 0.82** 0.78 7 1 e 208–234 2 1 n 208–212 CaM49 3 0 191–194 0.38 0.68** 0.66 4 0 190–194 0.71 0.76 0.72 8 3 g,j,k 186–194 NA CaM52 2 0 157–159 0.00 0.23 0.23 3 0 148–158 0.13 0.34 0.33 5 0 148–158 1 0 155 CaM53 1 0 172 Monomorphic 3 2 2 167–190 0.13 0.24 0.23 5 3 i,j,l 125–197 2 2 m,n 170–184 CaM54 No amplification 2 0 176–184 0.57 0.44 0.45 1 0 184 1 1 n 164 CaM55 2 0 144–151 Duplicated loci 6 2 15,16 159–178 0.75 0.84 0.79 9 0 144–178 1 0 160 CaM57 3 0 146–188 Duplicated loci 5 0 102–176 0.63 0.77 0.73 9 2 a,l 102–174 3 1 m 102–156 CaM58 2 0 189–191 Duplicated loci 2 0 183–191 0.75 0.5 0.52 8 2 b,l 181–224 2 0 192–193 CaM59 2 0 224–226 0.13 0.13 0.12 3 0 222 –225 0.88 0.69 0.67 4 0 222–228 3 0 222–228 Range 0–6 0–4 0–0.88 0.13–0.86 0.12–0.81 1–7 0–6 0–1.00 0.23–0.88 0.23–0.83 1–13 0–8 0–4 0–3 Mean 2.7 0.37 0.29 0.5 0.49 3.78 0.67 0.52 0.63 0.62 7.07 2.42 1.98 0.87 SD (±) 1.4 0.87 0.28 0.22 0.21 1.73 1.13 0.29 0.19 0.18 2.87 1.72 0.79 0.95 SE (±) 0.3 0.13 0.06 0.05 0.04 0.26 0.17 0.04 0.03 0.03 0.43 0.26 0.12 0.14 $ : Represents the genotype(s) as per Table 7, wherein the private allele is observed; *: Significant HW dis-equilibrium at P < 0.05; **: Highly significant HW dis-equilibrium at P < 0.01; Markers showing 100% H o values in arabicas, which are expected to be the result of duplicated loci were not considered for various estimates. BMC Plant Biology 2008, 8:51 http://www.biomedcentral.com/1471-2229/8/51 Page 8 of 19 (page number not for citation purposes) Mappability of novel SSR markers The new SSR markers were tested for their mappability on robusta linkage map. In total, 9 of the 44 new markers (20.5%) were found to be polymorphic for the parents of the robusta pseudo-testcross mapping population i.e. CXR and Kagganahalla. The nine markers (CaM03, 16, 20, 22, 32, 35, 42, 44 and 46) could be mapped on the robusta linkage map developed by us [12]. Notably, seven of the markers (except CaM16 and CaM46) were mapped on independent LGs, which indicated the new markers to be randomly distributed on the robusta genome (Figure 2, Table 3). Cross-species/-genera transferability and primer conservance Cross species transferability of the new robusta derived SSR-markers was tested for 13 related Coffea and two Psilanthus species. In general, the markers resulted in robust cross-species amplifications with alleles of compa- rable sizes in the tested taxa (Table 4). Overall, an average transferability of ~92% was observed (Table 6, 7), which was higher for Coffea spp. (> 93%) than for the related Psilanthus spp. (~82%). Moreover, within different Coffea taxa, across its different botanical subsections, the trans- ferability was comparable (> 91%). The data thus, indi- cated a very high marker conservance across the related coffee species, which was calculated to be ~91% over all the tested markers. Marker CaM54 exhibited lowest con- servance of 23% (for Coffea species) and 27% (over all taxa), whereas 24 markers were found to be 100% con- served. The data also revealed the presence of some private alleles (PAs), which possibly could be species-specific. In total, 104 such alleles were found in Coffea (with a mean number of 8.7 PAs/species) and 35 in Psilanthus species (17.5 PAs/species), over all the 44 markers. These accounted for ~34% of amplified alleles in Coffea spp. and 45% of those amplified in Psilanthus spp. Generic affinities within/between cultivated and wild coffee germplasm The diploid microsatellite data were examined for their potential in genetic diversity studies by studying the vari- ation and interrelationship between the cultivated as well as wild genepool. The average genetic distance values (cal- culated using the SSR allelic data) were found to be 0.26 (SD: ± 0.06; SE: ± 0.01), 0.43 (SD: ± 0.06; SE: ± 0.01) and 0.51 (SD: ± 0.17; SE: ± 0.02) for the tested arabicas, robus- tas and over both the sets, respectively. Similar estimates calculated for different Coffea and Psilanthus species were: 0.57 (SD: ± 0.12; SE: ± 0.04) for Erythrocoffea (diploid + tetraploid), 0.54 (SD: ± 0.07; SE: ± 0.05) for Erythrocoffea (diploids), 0.58 (SD: ± 0.05; SE: ± 0.02) for Mozambicof- fea, 0.63 (SD: ± 0.09; SE: ± 0.02) for Pachycoffea, 0.65 (only two species, thus no SD) for Paracoffea, and 0.72 (SD: ± 0.10; SE: ± 0.01) over all the compared species. The NJ phenetic tree generated using the genetic distance estimates for eight genotypes each from arabica and robusta clearly resolved the tested germplasm in two dis- tinct clusters, one representing all the tetraploid arabicas, while the other comprised all the diploid robustageno- types (Figure 3) with significant branch support. The selections from pure arabicas formed a single cluster within arabicas, whereas selections from hybrids formed different group. HdeT was found closest to S2790 and S2792, whereas Sln11 was found to be the most distant entry in arabicas. Similarly, a clustering analysis of 14 related species (12 Coffea and two Psilanthus spp.; Figure 4) along with two genotypes each from C. arabica and C. canephora formed coherent clusters of diploid Erythrocof- feas (C. canephora, C. congensis), tetraploid Erythrocoffea (C. arabica), Mozambicoffea (C. racemosa, C. eugenioides, C. salvatrix, C. kapakata), and Pachycoffea (C. liberica, C. dewevrei, C. abeokutae as one cluster and C. excelsa, C. arnoldiana, C. aruwemiensis as other cluster). A single entry for Melanocoffea represented by C. stenophylla was the most divergent among the Coffea species and showed Bar-graph showing comparative distribution of: (A) number of alleles (NA) amplified, and (B) PIC values of the new SSR markers in the tested sets of genotypes of arabica and robusta coffeeFigure 1 Bar-graph showing comparative distribution of: (A) number of alleles (NA) amplified, and (B) PIC values of the new SSR markers in the tested sets of geno- types of arabica and robusta coffee. Note: in case of PIC the plotted values represent normalized proportions of only the total polymorphic markers (which were 41 for robustas, 36 for arabicas, and only 23 in case of Arabica after removing the possible duplicate loci). 35 40 4 5 5 0 Arabicas Robustas 3 0 25 2 0 15 0 5 1 0 0. 0.801 to 0.20 0.21 t o 0.40 0.41 to 0.60 0.61 to 0.80 1 to 1.00 PIC Proportion of prim value ers B 0 2 4 6 8 10 12 14 16 18 1234567 Arabicas Robustas No. of primers No. of amplified alleles per primer A BMC Plant Biology 2008, 8:51 http://www.biomedcentral.com/1471-2229/8/51 Page 9 of 19 (page number not for citation purposes) Table 5: Individual and cumulative probability of identity (PI) estimates calculated for the new polymorphic SSR markers for the tested elite arabica and robusta genotypes C. arabica C. canephora Sib-based estimates for PI Unbiased estimates for PI Sib-based estimates for PI Unbiased estimates for PI Marker Individual Cumulative Marker Individual Cumulative Marker Individual Cumulative Marker Individual Cumulative CaM38 3.64 × 10 -1 3.64 × 10 -1 CaM03 9.67 × 10 -4 9.67 × 10 -4 CaM36 3.37 × 10 -1 3.37 × 10 -1 CaM40 2.47 × 10 -3 2.47 × 10 -3 CaM36 3.82 × 10 -1 1.39 × 10 -1 CaM41 5.80 × 10 -3 5.61 × 10 -6 CaM40 3.46 × 10 -1 1.17 × 10 -1 CaM36 3.12 × 10 -3 7.69 × 10 -6 CaM40 4.07 × 10 -1 5.66 × 10 -2 CaM38 1.36 × 10 -2 7.65 × 10 -8 CaM03 3.54 × 10 -1 4.13 × 10 -2 CaM33 3.15 × 10 -3 2.42 × 10 -8 CaM03 4.33 × 10 -1 2.45 × 10 -2 CaM36 1.36 × 10 -2 1.70 × 10 -9 CaM33 3.56 × 10 -1 1.47 × 10 -2 CaM03 9.15 × 10 -3 2.22 × 10 -10 CaM41 4.69 × 10 -1 1.15 × 10 -2 CaM40 1.36 × 10 -2 4.88 × 10 -11 CaM22 3.70 × 10 -1 5.44 × 10 -3 CaM22 1.58 × 10 -2 3.50 × 10 -12 CaM32 4.73 × 10 -1 5.44 × 10 -3 CaM25 1.14 × 10 -1 5.55 × 10 -12 CaM55 3.74 × 10 -1 2.04 × 10 -3 CaM55 1.64 × 10 -2 5.75 × 10 -14 CaM46 4.73 × 10 -1 2.57 × 10 -3 CaM32 1.20 × 10 -1 6.64 × 10 -13 CaM46 3.90 × 10 -1 7.94 × 10 -4 CaM46 2.25 × 10 -2 1.29 × 10 -15 CaM49 4.87 × 10 -1 1.25 × 10 -3 CaM46 1.20 × 10 -1 7.94 × 10 -14 CaM41 3.96 × 10 -1 3.13 × 10 -4 CaM38 2.38 × 10 -2 3.08 × 10 -17 CaM25 5.77 × 10 -1 7.23 × 10 -4 CaM49 1.56 × 10 -1 1.24 × 10 -14 CaM26 4.00 × 10 -1 1.26 × 10 -4 CaM26 2.86 × 10 -2 8.79 × 10 -19 CaM16 5.93 × 10 -1 4.28 × 10 -4 CaM16 1.73 × 10 -1 2.14 × 10 -15 CaM18 4.06 × 10 -1 5.10 × 10 -5 CaM57 3.05 × 10 -2 2.68 × 10 -20 CaM17 5.99 × 10 -1 2.56 × 10 -4 CaM26 2.14 × 10 -1 4.59 × 10 -16 CaM38 4.09 × 10 -1 2.09 × 10 -5 CaM18 3.74 × 10 -2 1.00 × 10 -21 CaM24 6.14 × 10 -1 1.57 × 10 -4 CaM45 2.49 × 10 -1 1.14 × 10 -16 CaM57 4.20 × 10 -1 8.77 × 10 -6 CaM41 3.95 × 10 -2 3.97 × 10 -23 CaM42 6.14 × 10 -1 9.65 × 10 -5 CaM27 3.13 × 10 -1 3.58 × 10 -17 CaM49 4.34 × 10 -1 3.18 × 10 -6 CaM32 4.21 × 10 -2 1.67 × 10 -24 CaM20 6.04 × 10 -1 6.17 × 10 -5 CaM33 3.13 × 10 -1 1.12 × 10 -17 CaM16 4.41 × 10 -1 1.68 × 10 -6 CaM24 6.02 × 10 -2 1.01 × 10 -25 CaM26 6.44 × 10 -1 3.97 × 10 -5 CaM20 3.49 × 10 -1 3.92 × 10 -18 CaM32 4.52 × 10 -1 7.57 × 10 -7 CaM45 6.92 × 10 -2 6.96 × 10 -27 CaM45 6.52 × 10 -1 2.59 × 10 -5 CaM24 3.57 × 10 -1 1.40 × 10 -18 CaM24 4.59 × 10 -1 3.47 × 10 -7 CaM49 8.67 × 10 -2 6.03 × 10 -28 CaM27 7.12 × 10 -1 1.85 × 10 -5 CaM42 3.57 × 10 -1 5.00 × 10 -19 CaM35 4.71 × 10 -1 1.64 × 10 -7 CaM35 8.74 × 10 -2 5.27 × 10 -29 CaM33 7.12 × 10 -1 1.31 × 10 -5 CaM17 3.67 × 10 -1 1.84 × 10 -19 CaM59 4.75 × 10 -1 7.77 × 10 -8 CaM16 9.19 × 10 -2 4.84 × 10 -30 CaM13 7.99 × 10 -1 1.05 × 10 -5 CaM13 5.00 × 10 -1 9.18 × 10 -20 CaM02 4.79 × 10 -1 3.72 × 10 -8 CaM31 9.46 × 10 -2 4.58 × 10 -31 CaM44 7.99 × 10 -1 8.39 × 10 -6 CaM44 5.00 × 10 -1 4.59 × 10 -20 CaM27 4.87 × 10 -1 1.81 × 10 -8 CaM21 9.90 × 10 -2 4.54 × 10 -32 CaM52 7.99 × 10 -1 6.71 × 10 -6 CaM52 5.00 × 10 -1 2.30 × 10 -20 CaM21 5.03 × 10 -1 9.10 × 10 -9 CaM59 1.41 × 10 -1 6.40 × 10 -33 CaM30 8.88 × 10 -1 5.95 × 10 -6 CaM30 6.89 × 10 -1 1.58 × 10 -20 CaM12 5.03 × 10 -1 4.58 × 10 -9 CaM02 1.48 × 10 -1 9.46 × 10 -34 CaM59 8.88 × 10 -1 5.29 × 10 -6 CaM59 6.89 × 10 -1 1.09 × 10 -20 CaM43 5.08 × 10 -1 2.33 × 10 -9 CaM27 1.56 × 10 -1 1.47 × 10 -34 CaM02 DL CaM45 5.26 × 10 -1 1.22 × 10 -9 CaM43 1.63 × 10 -1 2.40 × 10 -35 CaM06 DL CaM31 5.33 × 10 -1 6.53 × 10 -10 CaM12 1.68 × 10 -1 4.05 × 10 -36 CaM15 DL CaM39 5.47 × 10 -1 3.57 × 10 -10 CaM25 1.73 × 10 -1 7.02 × 10 -37 CaM18 DL CaM25 5.93 × 10 -1 2.12 × 10 -10 CaM08 2.49 × 10 -1 1.75 × 10 -37 CaM21 DL CaM06 5.94 × 10 -1 1.26 × 10 -10 CaM09 2.49 × 10 -1 4.36 × 10 -38 CaM31 DL CaM42 5.94 × 10 -1 7.46 × 10 -11 CaM20 2.49 × 10 -1 1.09 × 10 -38 CaM34 DL CaM58 6.14 × 10 -1 4.58 × 10 -11 CaM39 2.55 × 10 -1 2.78 × 10 -39 CaM35 DL CaM17 6.40 × 10 -1 2.93 × 10 -11 CaM52 3.13 × 10 -1 8.69 × 10 -40 CaM39 DL CaM30 6.40 × 10 -1 1.87 × 10 -11 CaM17 3.49 × 10 -1 3.04 × 10 -40 CaM43 DL CaM08 6.52 × 10 -1 1.22 × 10 -11 CaM30 3.49 × 10 -1 1.06 × 10 -40 CaM55 DL CaM09 6.52 × 10 -1 7.97 × 10 -12 CaM54 3.50 × 10 -1 3.71 × 10 -41 CaM57 DL CaM20 6.52 × 10 -1 5.20 × 10 -12 CaM58 3.57 × 10 -1 1.33 × 10 -41' CaM58 DL CaM54 6.54 × 10 -1 3.40 × 10 -12 CaM06 3.71 × 10 -1 4.92 × 10 -42 CaM08 MM CaM52 7.12 × 10 -1 2.42 × 10 -12 CaM42 3.71 × 10 -1 1.83 × 10 -42 CaM09 MM CaM53 7.89 × 10 -1 1.91 × 10 -12 CaM53 4.49 × 10 -1 8.21 × 10 -43 CaM11 MM CaM34 7.99 × 10 -1 1.53 × 10 -12 CaM34 5.00 × 10 -1 4.10 × 10 -43 CaM12 MM CaM44 7.99 × 10 -1 1.22 × 10 -12 CaM44 5.00 × 10 -1 2.05 × 10 -43 CaM22 MM CaM11 MM CaM23 MM CaM13 MM CaM53 MM CaM15 MM CaM54 MM CaM23 MM Mean 6.09 × 10 -1 2.67 × 10 -1 5.19 × 10 -1 1.68 × 10 -1 SD (+) 1.57 × 10 -1 2.10 × 10 -1 1.30 × 10 -1 1.52 × 10 -1 SE (+) 3.36 × 10 -2 4.47 × 10 -2 1.99 × 10 -2 2.32 × 10 -2 Note: The markers are arranged as per their individual PI in the decreasing order; Cumulative power of discrimination was calculated using products of PIs of successive informative markers arranged in decreasing order as described by Waits et al. [56]. The PI was not estimated for DL and MM markers, as they were uninformative. DL: Duplicated loci; MM: Monomorphic markers. BMC Plant Biology 2008, 8:51 http://www.biomedcentral.com/1471-2229/8/51 Page 10 of 19 (page number not for citation purposes) proximity with entries from Paracoffea section (Psilanthus spp.). Discussion Distribution and abundance of detected SSR motifs The coffee-specific SSR markers described in this study were developed using the conventional approach of con- struction/screening of a partial small-insert genomic library. The success rate of any microsatellite development effort is indicated by the proportion of SSR-containing clones in the library followed by number of detected SSRs, qualities of SSR motifs and also by the quality of flanking regions. In the present study, 76 good quality SSR-positive clones containing a total of 116 SSRs were obtained from which 44 SSR markers were developed (Table 1, 3). The results, thus, suggested a success rate of 0.48% in the iden- tification of potential target SSR-positive clones, and 0.28% in overall marker development. In a representative study to assess success of conventional library screening approach for microsat marker development in 16 differ- ent plant genera, it was found that the proportion of SSR- positive clones varied significantly (0.059% to 5.8% with an average of 2.5%) from species to species [14]. The observed SSR detection efficiency of the approach in this study was comparable with earlier reports in Acasia (0.32%, [15]) and peanut (0.43%, [16]), but was higher than rice (0.22%, [17]), potato, (0.06 to 0.15%, [18]) and wheat (0.11% [19]), and less than white spruce (0.62%, [20]). The estimates derived from this study revealed that the rel- ative distribution of different SSRs in robusta coffee genome is relatively poor in overall SSR abundance (1/ 160 Kb for targeted SSRs, and 1/15 kb including the non- targeted SSRs; Table 2) compared to various other plant species such as Arabidopsis, rice, barley (1 every 6–8 Kb) [21] and mulberry (our unpublished data). Nevertheless, the relative frequency, repeat lengths, and distribution pattern of different types of genomic SSRs in coffee genome (Table 2) were comparable to those reported in a number of plant species like apple [22], avacado [23], birch [24], peach [25], Acasia [15] and tomato [26]. In specific, AG was detected in higher proportion (almost 2 times) than AC; AG repeat cores were, in general, found to be longer than any other SSR type. Repeat cores of TNRs were, in general, smaller than DNRs, and AT (the non-tar- geted SSR) was found to be the most abundant in compar- ison to any other DNR or TNR. In comparison, the AT-rich TNRs in the coffee genome were found to be relatively less abundant than seen in most plant species [16,27,28], but comparable to some of the tree species like avacado (ACC > AGG > AAG, [23]) and peach (abundant in AGG, [25]). A species specific-pattern of TNR abundance has also been demonstrated in closely related species like rice and wheat that belong to the same family but differ significantly in their genomic TNR content [29-31]. Some of the variation seen in the SSR estimates (relative frequency, distribution and abundance) as discussed above across different stud- ies including the present one on coffee, can be ascribed to the differences in criteria used for SSR search viz., mini- mum length of repeat-core, the size of the genomic library screened, screening stringency, oligos used for screening and SSR mining tools, notwithstanding the innate differ- ences in genomic organization of SSRs in different species. A comparison of the relative abundance/distribution of genomic SSRs with that of genic-SSRs developed from cof- fee transcriptome earlier by us [11], revealed two striking differences viz., an apparent higher abundance of SSRs in the transcriptome (1/2.16 Kb) and a near reverse pattern of TNR abundance/relative distribution in two types of SSRs. Importantly, the two most abundant TNRs (AAG, ACT) in the genic-SSRs were least abundant or not- detected in the genomic SSRs. The observation would sug- gest interesting possibilities of differential distribution/ organization of TNRs as well as restriction sites for the enzymes used for library construction across gene-rich and gene-deficient regions of the coffee genome. How- ever, such possibilities can only be addressed by further detailed genomic studies in times to come. Relative position of the nine new SSR markers (20% of the total tested) mapped on a robusta coffee map [12]Figure 2 Relative position of the nine new SSR markers (20% of the total tested) mapped on a robusta coffee map [12]. The reference map was generated using pseudo-test- cross mapping population derived from a cross of 'CxR' (a commercial robusta hybrid) and Kagganahalla (a local selec- tion from India). Note that the new mapped markers are dis- tributed randomly across different linkage groups. The value at the base of each LG refers to its relative length in centi- Morgans (cM). Ca M 4 6 Ca M 1 6 59.4 89.3 9.5 &/* Ca M 22 126.2 50.7 &/* Ca M 0 3 0.0 100.5 &/* Ca M 3 5 0.0 80.2 &/* Ca M 4 4 0.0 81.4 &/* Ca M 3 2 24.8 36.8 &/* Ca M 4 256.7 116.8 &/* Ca M 2 0 11.1 &/* &/* Ca M 4 6 Ca M 1 6 4 9.5 59. 89.3 &/* Ca M 4 6 Ca M 1 6 59.4 3 9.5 89. &/* Ca M 22 50.7 126.2 &/* Ca M 22 50.7 126.2 &/* Ca M 0 3 0.0 100.5 &/* Ca M 0 3 0.0 100.5 &/* Ca M 3 5 0.0 80.2 &/* Ca M 3 5 0.0 80.2 &/* Ca M 4 4 0.0 81.4 &/* Ca M 4 4 0.0 81.4 &/* Ca M 3 2 24.8 36.8 &/* Ca M 3 2 24.8 36.8 &/* Ca M 4 256.7 116.8 Ca M 4 256.7 116.8 &/* Ca M 2 0 11.1 &/*&/* Ca M 2 0 11.1 [...]... Pachycoffea (SanMarino) Mozambicoffea (C Africa) Mozambicoffea (E Africa) Mozambicoffea (E Africa) Mozambicoffea (C Africa) Melanocoffea (W Africa) Paracoffea (India) Paracoffea (India) Development of new SSR markers In coffee, to the best of our knowledge till date only ca 180 genomic SSRs have been described in literature [4-11] warranting continuous efforts to develop additional new markers to expand... collections C canephora; Selection C canephora; Selection C canephora; Selection C canephora; Hybrid of C congenis × C canephora C canephora; Selection C canephora; Selection C canephora; Selection C canephora; Pure line II Parents and mapping population used for testing utility in mapping analysis Parents: CXR (12) and Kagganahalla (9); Mapping population: 175 segregating progenies III Species of Coffea and. .. few studies describing development of coffee- specific SSR markers [4-11]; however, only a few of these provide data for the utility of new SSRs in genetic studies [8,11] Therefore, one major aim of the present study was to test the potential of the new markers reported here for their use in studies related to genetic diversity in cultivated coffee germplasm, linkage mapping, constructing reference panels/bar... highly informative in exploring the taxonomic relationship of coffee species complex Conclusion In summary, the present study describes 44 new microsatellite markers developed using the conventional approach of construction/screening of partial small-insert genomic library The approach was found to be successful but difficult and experiment-intensive with low success rate of ~0.48% Analysis of the... Molecular analysis of the origin and genetic diversity of Coffea arabica L.: implications for coffee improvement In Proceedings of EUCARPIA meeting on tropical plants Montpellier, France; 1996:23-29 Aggarwal RK, Rajkumar R, Rajendrakumar P, Hendre PS, Baruah A, Phanindranath R, Annapurna V, Prakash NS, Santaram A, Sreenivasan CS, Singh L: Fingerprinting of Indian coffee selections and development of reference... SSR markers usable for linkage analysis In this regard, we tested the suitability of the new markers for linkage mapping using a pseudo-testcross mapping population of robusta coffee Significantly, 20.5% of the markers were found to be polymorphic for the parents of the mapping population, and all of these could be successfully mapped (Figure 2) The mapped markers were distributed on different linkage... despite Figure the new4 taxa based PsilanthusSSR markerson the between 14 Coffea and two NJ tree showing relationshipallelic diversity generated using NJ tree showing relationship between 14 Coffea and two Psilanthus taxa based on the allelic diversity generated using the new SSR markers these being informative, unless no other markers are available Utility of new SSRs as genetic markers Till date,... belonging to Coffea and Psilanthus genera (Table 7) The leaf samples for each of them were collected from germplasm bank maintained at Central Coffee Research Institute, Balehonnur, Karnataka, India and DNA was isolated following the method described by Aggarwal et al [50] Construction of genomic library and isolation of SSR containing sequences A partial small-insert genomic library was constructed using... using the robusta 3 new SSR markers the allelic between arabica and NJ tree showing relationship within and diversity generated NJ tree showing relationship within and between arabica and robusta germplasm based on the allelic diversity generated using the new SSR markers The proportion of designed primers successfully producing amplification products gives a primer-to-marker conversion ratio and indicates... Table 6: Conservation and transferability of the new SSR markers across related taxa of coffee BMC Plant Biology 2008, 8:51 http://www.biomedcentral.com/1471-2229/8/51 Table 7: Plant materials used for validation and testing inter-specific/inter-generic transferability of new SSR markers S.N Name of genotype Pedigree/source I Elite coffee genotypes used for genetic diversity in the cultivated genepool . ATCCACTGCTGTCACCTTTTGTTA (TAA)5 55 261 EU526577 R: AGCAGTGTGTGTGTTAAAGAGGAGTT 23 CaM32 F: CAGACAGACCAGAGAGAGACACCTAAC (TA)12 50 204 EU526577 CLG12 R: CCCCCTCCAAAATAATTCAGAAAA 24 CaM33 F: GCGCATTAGGCGTGGGAGAA (A) 13–5. TCACGGTTTCTCAAGTCGGGGATTTA 12 CaM18 F: CCGACTTGGACTGATGCGAAATTGA (TC)9 57 181 EU526567 R: AAAGCAAAAAACCAGAAAACACGAAGA 13 CaM20 F: GAAACCGCTGAAATTCGGTA (TATGGG)3 57 217 EU526568 CLG16 R: CCCTCTGATTTCTCCTTTCATC 14 CaM21. CAGGAAGAGAAGAAAGTGAAATTGAC (TC)8 50 137 EU526560 R: CGCTTTCTTGTTTTCTCCATTTC 6 CaM11 F: GTCCCCGCTTAAATAATATACACACA (AC)8–15 bp-AC(6)(AT)6 50 285 EU526561 R: ATAGGACGGAGGGAGTAATAGAATAAA 7 CaM12