Clinical Pancreatology for Practising Gastroenterologists and Surgeons - part 5 potx

accounts for approximately 70% of patients with chronic pancreatitis, with a mortality rate approaching 50% within 20–25 years due to malnutrition, severe infections, diabetes, alcohol- and nicotine-related diseases and, most commonly forgotten, fatal accidents. Bordalo and colleagues initially suggested that alcoholic chronic pancreatitis is caused by the direct toxic effects of ethanol and its metabolites and that these would interfere with intracellular lipid metabolism and lead to fatty degeneration of pancreatic acinar cells. The pathologic effects of alcohol on the pancreas are, however, difficult to study in humans. In experimental studies, ethanol and its metabolites appear to have complex short-term and long-term effects on acinar cell physiology. They can cause damage to cell membranes and affect cellular signaling pathways. Animal models, which have been frequently used to investigate the effect of ethanol in vivo, have demonstrated that the pancreatic injury induced by ethanol exposure is likely to be multifactorial. The mechanisms seem to include some degree of ductal hypertension, decreased pancreatic blood flow, oxidative stress, direct acinar cell toxicity, changes in protein synthesis, an enhanced inflammatory response, or the stimulation of fibrosis. Acute administration of alcohol in the rat results in increased injury during pancreatitis induced by a combination of pancreatic duct obstruction and hormonal hyperstimu- lation. Rats under chronic ethanol feeding have also more severe pancreatitis. While the generation of oxy- gen free radicals has been clearly demonstrated in the pancreas of rats under continuous ethanol feeding, ethanol alone, i.e., without an additional disease- inducing stimulus, does not cause pancreatitis. Genera- tion of free radicals has been shown to cause depletion of intracellular antioxidants, such as glutathione, and accounts for subsequent oxidative damage to lipids, proteins, and nucleic acids. Some of the toxic effects of ethanol may therefore be secondary to its effect on lipid metabolism and other metabolic pathways. There is a clear dose-related risk for the development of alcoholic pancreatitis but the disease process appears to be very extended, with an interval between the start of continuous alcohol consumption and the clinical manifestation of alcohol-induced chronic pancreatitis of as long as 15–20 years. Recurrent episodes of subclinical acute pancreatitis may lead, over time, to chronic inflammation and fibrosis. Other observations suggest that chronic pancreatitis may also arise inde- pendently of acute disease recurrences. Interestingly, the correlation between alcohol consumption and chronic pancreatitis is not strict and less than 5% of alcoholics develop pancreatitis as a consequence of excessive ethanol consumption. Why the pancreas of some individuals is more susceptible to alcohol than that of others and why the development of alcoholic pancreatitis appears to follow different patterns in indi- vidual alcoholics has prompted investigators to study genetic predisposition in patients with pancreatitis. Candidate genes that have been studied include alde- hyde dehydrogenase polymorphisms, CFTR, cationic trypsinogen, HLA antigens and others, but none of these were found to predispose to alcoholic pancreatitis. While the mechanisms involved in alcoholic pancreatitis are still being explored, much progress has been made in elucidating the role of gallstones in the pathophysiology of pancreatitis. Gallstone-induced pancreatitis About 150 years ago Claude Bernard discovered that bile can cause pancreatitis when it is injected into the pancreatic duct of laboratory animals. Since that time many studies have been performed to elucidate the underlying pathophysiologic mechanisms. Today it is firmly established that the passage of a gallstone from the gallbladder through the biliary tract can initiate pancreatitis, whereas gallstones that remain in the gallbladder do not cause pancreatitis. The various hy- PART II 202 Alcohol Idiopathic Metabolic Anatomic Genetic 0 20 40 60 80 Percent Figure 24.1 Causes of chronic pancreatitis: due to recent progress in the identification and diagnosis of genetic factors for chronic pancreatitis, the number of patients classified as having idiopathic chronic pancreatitis is decreasing. potheses that were proposed to explain this association are mostly contradictory. In 1901 Eugene Opie postu- lated that an impairment of the pancreatic outflow due to obstruction of the pancreatic duct causes pancreatitis. This initial “duct obstruction” hypothesis was somewhat forgotten when Opie published his second “common channel” hypothesis during the same year. This later hypothesis predicts that an impacted gallstone at the papilla of Vater creates a communication between the pancreatic and the bile duct (the said “common channel”) through which bile flows into the pancreatic duct and thus causes pancreatitis. From a mechanistic point of view, Opie’s common channel hypothesis seems rational and has become one of the most popular theories in the field; however, considerable experimental and clinical evidence is incompatible with its assumptions. Anatomic studies have shown that the communication between the pancreatic duct and the common bile duct is much too short (< 6 mm) to permit biliary reflux into the pancreatic duct. Therefore an impacted gallstone would most likely obstruct both the common bile duct and the pancreatic duct. Even in the event of an existing anatomic communication, pancreatic juice would be expected to flow into the bile duct rather than bile into the pancreatic duct due to the higher secretory pressure of pancreatic juice exceeding biliary pressure. Late in the course of pancreatitis when necrosis is firmly established, a biliopancreatic reflux due to a loss of barrier function in the damaged pancreatic duct may well explain the observation of a bile-stained necrotic pancreas at the time of surgery. However, this should not be regarded as evidence for the assumption that reflux of bile into the pancreas is a triggering event for disease onset. Based on these inconsistencies of the common channel hypothesis, it was proposed that the passage of a gallstone might damage the duodenal sphincter in such a way that sphincter insufficiency results. In turn, this could permit duodenal content, including bile and activated pancreatic juice, to flow through the incompetent sphincter into the pancreatic duct and induce pancreatitis. However, this hypothesis was shown not to be applicable to the human situation, in which sphincter stenosis rather than sphincter insufficiency results from the passage of a gallstone through the papilla, and flow of pancreatic juice into the bile duct, rather than flow of duodenal content into the pancreas, is the consequence. Finally, another argument against the common channel hypothesis is that perfusion of bile through the pancreatic duct is completely harmless. Only an influx of in- fected bile, which might occur after prolonged obstruction at the papilla when the pressure gradient between the pancreatic duct (higher) and the bile duct (lower) is reversed, may represent an aggravating factor for the course of pancreatitis. Taken together, the initial pathophysiologic events that occur during the course of gallstone-induced pancreatitis are believed to affect the acinar cell and are triggered, in accordance with Opie’s initial hypothesis, by obstruction or impairment of flow from the pancreatic duct. Bile reflux into the pancreatic duct, either through a common channel created by an impacted gallstone or through an incompetent spincter caused by the passage of a gallstone, is neither required nor likely to occur during the initial course of pancreatitis. Molecular aspects during pancreatic duct obstruction In an animal model based on pancreatic duct obstruction the cellular events involved in gallstone-induced pancreatitis were investigated in rodents. Intracellular calcium release in response to hormonal stimuli was investigated in addition to a morphologic and biochemical characterization. Under physiologic resting conditions most cell types, including the acinar cells of the exocrine pancreas, maintain a Ca 2+ gradient across the plasma membrane, with low intracellular Ca 2+ concentrations (nanomolar range) facing high extracellular Ca 2+ concentrations (millimolar range). Many of these cells use rapid Ca 2+ release from intracellular stores in response to external and internal stimuli as a signaling mechanism that regulates diverse biological events, such as growth, proliferation, locomotion, con- traction, or the regulated secretion of exportable proteins. An impaired capacity to maintain the Ca 2+ gradient across the plasma membrane represents a common pathophysiologic characteristic of vascular hypertension, malignant tumor growth, and cell damage in response to some toxins. Ligation of the pancreatic duct in rats and mice, a condition that mimics gallstone-induced pancreatitis in humans, induced leukocytosis, hyperamylasemia, pancreatic edema, and granulocyte immigration into the lungs, all of which were not observed in bile duct-ligated controls. It also led to significant intracellular activation of pancreatic proteases such as trypsin, an event we discuss in more CHAPTER 24 203 detail in the next paragraph. Whereas the resting [Ca 2+ ] i in isolated acini rose by 45% to 205 ± 7 nmol/L, the acetylcholine- and cholecystokinin-stimulated calcium peaks as well as amylase secretion declined. However, neither the [Ca 2+ ] i signaling pattern nor the amylase output in response to the Ca 2+ -ATPase inhibitor thapsigargin, nor secretin-stimulated amylase release, were impaired by pancreatic duct ligation. At the single-cell level, pancreatic duct ligation reduced the percentage of cells in which physiologic secretagogue stimulation was followed by a physiologic response (i.e., Ca 2+ oscillations) and increased the percentage of cells with a pathologic response (i.e., peak-plateau or absent Ca 2+ signal). Moreover, it reduced the frequency and amplitude of Ca 2+ oscillations as well as the capacitative Ca 2+ influx in response to secretagogue stimulation. To test whether these prominent changes in intra- acinar calcium signaling not only parallel pancreatic duct obstruction but are also directly involved in the initiation of pancreatitis, animals were systemically treated with the intracellular calcium chelator BAPTA- AM. As a consequence, both the parameters of pancreatitis as well as intrapancreatic trypsinogen activation induced by duct ligation were found to be significantly reduced. These experiments suggest that pancreatic duct obstruction, the critical event involved in gallstone-induced pancreatitis, rapidly changes the physiologic response of the exocrine pancreas to a pathologic Ca 2+ -signaling pattern. This pathologic Ca 2+ signaling is associated with premature digestive enzyme activation and the onset of pancreatitis, both of which can be prevented by administration of an intracellular calcium chelator. Autoactivation of pancreatic proteases The exocrine pancreas, which synthesizes more protein than any other exocrine organ, secretes digestive proenzymes called zymogens that require proteolytic cleavage of an activation peptide to become fully active. After entering the small intestine, the pancreatic zymogen trypsinogen is first activated to trypsin by an in- testinal protease called enterokinase (enteropeptidase). Activated trypsin is subsequently able to proteolyti- cally process other pancreatic enzymes to their active forms. Under physiologic conditions, pancreatic proteases thus remain inactive during synthesis, intracellular transport, secretion from acinar cells, and transit through the pancreatic duct. Activation only occurs when they reach the lumen and brush border of the small intestine. About a century ago, the pathologist Hans Chiari suggested that the pancreas of patients who had died during episodes of acute necrotizing pancreatitis “had succumbed to its own digestive properties,” and he created the term “autodigestion” to describe the underlying pathophysiologic disease mechanism. Many attempts have been made since then to prove or disprove the role of premature intracellular zymogen activation as an initial or initiating event in the course of pancreatitis. Only recent advances in biochemical and molecular techniques have allowed investigators to address some of these questions conclusively. There are several reasons why many of these studies have been performed on animal or isolated cell models and have not been gained directly from human pancreas or patients with pancreatitis. 1 Because of its anatomic localization, the pancreas is rather inaccessible and biopsies of human pancreas are difficult to obtain for ethical and medical reasons. 2 When patients present to hospital with the first symptoms of acute pancreatitis, the initial stages of the disease, where triggering events could be studied, have already passed. 3 Investigations that address initiating pathophysiologic events are disturbed by the autodigestive process. Mechanisms of premature protease activation have therefore mostly been studied in animal and cell models that can be experimentally controlled and which are highly reproducible. Pathophysiologic significance of digestive protease activation Early hypotheses concerning the question of where and how pancreatitis starts were based on autopsy studies of patients who had died during the course of pancreatitis. One of these early theories suggested that peri- pancreatic fat necrosis represents the initial event from which all later alterations arise. This hypothesis impli- cated pancreatic lipase, which is secreted from acinar cells in its active form, as the culprit for pancreatic necrosis. Another hypothesis suggested that periductal cells represented the site of initial damage and that ex- travasation of pancreatic juice from the ductal system is responsible for initiating the disease. However, con- PART II 204 trolled studies subsequently demonstrated that the acinar cell is the initial site of morphologic damage. It is important to note that pancreatitis begins in exocrine acinar cells, as opposed to the pancreatic ducts or some poorly defined extracellular space, because it represents a shift from earlier mechanistic and histopatho- logic interpretations of the disease onset. Trypsinogen and other pancreatic proteases are synthesized by acinar cells as inactive proenzyme precursors and stored in membrane-bound zymogen granules. After activation in the small intestine, trypsin converts other pancreatic zymogens, such as chy- motrypsinogen, proelastase, procarboxypeptidase, or prophospholipase A 2 , to their active forms. Although small amounts of trypsinogen are probably activated within the pancreatic acinar cell under physiologic conditions, two protective mechanisms normally prevent cell damage from proteolytic activity. 1 PSTI, the product of the gene for serine protease inhibitor Kazal type 1 (SPINK1), is cosecreted with pancreatic zymogens and may inhibit up to 20% of cellular trypsin activity in humans. Mutations in the SPINK1 gene have been found associated with certain forms of human pancreatitis, indicating that this protective mechanism may play a role in pancreatic pathophysiology. 2 Cell biological experiments using living rodent acini provided evidence that trypsin limits its own activity by autodegradation under conditions that mimic pancreatitis (see below). An important discovery was that the specific cationic trypsinogen mutations that have been found associated with human hereditary pancreatitis seem to stabilize trypsin against autolysis, suggesting that autodegradation might play a protective role against excess intrapancreatic trypsin activity. Although experimentally not demonstrated as yet, other pancreatic proteases might participate in a simi- lar protective mechanism, and a different trypsin isoform, mesotrypsin, has been labeled a candidate for this function in humans. This minor trypsin isoform constitutes less than 5% of total secreted trypsinogens and, due to a GlyÆArg substitution at position 198 (GlyÆArg at position 193 in chymotrypsin number- ing), is poorly inhibited by PSTI. However, mesotrypsin is grossly defective not only in inhibitor binding but also in cleaving protein substrates. A pathophysiologic role of mesotrypsin in intracellular protease degradation and a protective function in pancreatitis is therefore rather unlikely. Theoretically, premature activation of large amounts of trypsinogen could overwhelm these protective mechanisms, rupture the zymogen-confining membranes, and release activated proteases into the cytosol. Moreover, the release of large amounts of calcium from zymogen granules into the cytosol might activate calcium-dependent proteases such as calpains which, in turn, would contribute to cell injury. The apparent role of prematurely activated digestive enzymes in the pathogenesis of pancreatitis is sup- ported by the following observations: 1 the activity of both pancreatic trypsin and elastase increases early in the course of experimental pancreatitis; 2 the activation peptides of trypsinogen and car- boxypeptidase A 1 are cleaved early in the course of acute pancreatitis from the respective proenzyme and are released into either the pancreatic tissue or the serum; 3 pretreatment with a serine protease inhibitor (ga- bexate mesylate) reduces the incidence of endoscopic retrograde cholangiopancreatography (ERCP)- induced pancreatitis; 4 serine protease inhibitors reduce injury in experimental pancreatitis; 5 mutations in the cationic trypsinogen gene that have been found associated with hereditary pancreatitis render trypsinogen either more prone to premature activation or more resistant to degradation by other proteases; 6 mutations in the SPINK1 gene which might render PSTI a less effective protease inhibitor are associated with certain forms of chronic pancreatits. In clinical and experimental studies it was found that zymogen activation occurs very early in the disease course and one study reported a biphasic pattern of trypsin activity that reached an early peak after 1 hour and a later second peak after several hours. This observation is interesting because it suggests that more than one mechanism may be involved in the activation of pancreatic zymogens and the second peak may require the infiltration of inflammatory cells into the pancreas. In patients who underwent ERCP, an interventional medical procedure that requires cannulation of the pancreatic duct and is associated with a significant complication rate for pancreatitis, the prophylactic administration of a low-molecular-weight protease inhibitor reduced the incidence of pancreatitis. While protease inhibitors have not been found to be effective CHAPTER 24 205 when used therapeutically in patients with clinically established pancreatitis, the result of the prophylactic study supports the conclusion that activation of pancreatic proteases is an inherent feature of disease onset. Taken together these observations represent com- pelling evidence that premature intracellular zymogen activation plays a critical role in the early pathophysiologic events of pancreatitis. Subcellular site of initial protease activation Identification of the subcellular site where pancreatitis begins is critical for understanding the pathophysiologic mechanisms involved in premature intrapancreatic protease activation. By using a fluorogenic trypsin-specific substrate, trypsinogen activation after secretagogue stimulation could be clearly localized to the secretory compartment within acinar cells. When subcellular fractions containing different classes of secretory vesicles were subjected to density gradient centrifugation, it was found that trypsinogen activation does not initially arise in mature zymogen granules but in membrane-bound vesicles of lesser density that most likely correspond to immature condensing secretory vacuoles. These data indicate that mature zymogen granules in which digestive proteases are highly condensed are not necessarily the primary site of this activation. The first trypsin activity in acinar cells following a pathologic stimulus is clearly detectable in membrane-bound secretory vesicles in which trypsinogen, as well as lysosomal enzymes (see below), are both physiologically present. Cathepsin B Several lines of evidence have suggested a possible role for the lysosomal cysteine protease cathepsin B in the premature and intrapancreatic activation of digestive enzymes. Observations that would support such a role of cathepsin B include the following: (i) cathepsin B can activate trypsinogen in vitro; (ii) during experimental pancreatitis, cathepsin B is redistributed from its lysosomal compartment to a zymogen granule-enriched subcellular compartment; and (iii) lysosomal enzymes such as cathepsin D colocalize with digestive zymogens in membrane-bound organelles during the early course of experimental pancreatitis. Although the cathepsin hypothesis seems attractive from a cell biological point of view, it has received much criticism because some experimental observations that partly made use of lysosomal protease inhibitor appeared to be incompatible with its assumptions. In view of the limited specificity and bioavailability of the existing inhibitors for lysosomal hydrolases, the cathepsin hypothesis was addressed in cathepsin B-deficient animals. The most dramatic change during experimental pancreatitis in these animals was a more than 80% reduction in premature intrapancreatic trypsinogen activation over the course of 24 hours. This observation can be regarded as the first direct experimental evidence for a critical role of cathepsin B in intracellular premature protease activation during the onset of pancreatitis. Surprisingly, the decrease in trypsinogen activation is not paralleled by a dramatic prevention of pancreatic necrosis, and the systemic inflammatory response during pancreatitis is not affected at all. This observation, and the fact that cathepsin B can activate pancreatic digestive zymogens other than trypsinogen, raises two important questions: (i) is trypsin activation itself, which is clearly cathepsin B-dependent, directly involved in acinar cell damage, and (ii) does cathepsin B-induced activation of other digestive proteases ultimately cause pancreatic necrosis? Cathepsin B is clearly present in the subcellular secretory compartment of the healthy human pancreas and in the pancreatic juice of controls and pancreatitis patients. A redistribution of cathepsin B into the secretory compartment of the exocrine pancreas may therefore not be required for interaction between trypsinogen and cathepsin B because both classes of enzymes are already colocalized under physiologic conditions in the human pancreas. On the other hand, the capacity of cathepsin B to activate trypsinogen is not affected by the most common trypsinogen mutations found in association with hereditary pancreatitis. While the onset of human pancreatitis may well involve mechanisms that depend on cathepsin B-induced protease activation, the cause of hereditary pancreatitis cannot be easily reduced to an increased cathepsin-B induced activation of mutant trypsinogen. Role of trypsin in premature digestive protease activation In isolated pancreatic acini and lobules, experiments using a specific cell-permeant and reversible trypsin inhibitor established that complete inhibition of trypsin activity does not prevent, nor even reduce, the conver- PART II 206 sion of trypsinogen to trypsin. On the other hand, a cell- permeant cathepsin B inhibitor prevented trypsinogen activation completely. Inhibitor washout experiments determined that following hormone-induced trypsinogen activation, 80% of the active trypsin is immedi- ately and directly inactivated by trypsin itself. These experiments suggest that trypsin activity is neither required nor involved in trypsinogen activation and that its most prominent role is apparently its own autodegradation. This, in turn, suggests that intracellular trypsin activity might have a role in the defense against other, potentially more harmful digestive proteases. Consequently, structural alterations that impair the function of trypsin in hereditary pancreatitis would eliminate a protective mechanism rather than generate a triggering event for pancreatitis. Whether these experimental observations obtained from rodent pancreatic acini and lobules have any relevance to human hereditary pancreatitis is presently unknown because human cationic trypsinogen may have different activation and degradation characteristics in vivo. How structural changes in the cationic trypsinogen gene caused by germline mutations can lead to the onset of hereditary pancreatitis has also been a matter of de- bate. Trypsin is one of the oldest known digestive enzymes able to activate several other digestive proteases in the gut and in vitro. Because pancreatitis is regarded as a disease caused by proteolytic autodigestion of the pancreas, it seemed reasonable to assume that pancreatitis is caused by a trypsin-dependent protease cascade within the pancreas itself. Trypsinogen mutations found in association with hereditary pancreatitis should therefore confer a gain of enzymatic function in such a way that either mutant trypsinogen would be more readily activated inside acinar cells or, alterna- tively, that active trypsin would become less rapidly degraded. Both events would increase or extend enzymatic action of trypsin within the cellular environ- ment. From a statistical point of view, however, most hereditary disorders, including most autosomal domi- nant diseases, are associated with loss-of-function mutations that render a specific protein defective or impair its intracellular processing or targeting. Moreover, a total of 16 mutations in the cationic trypsinogen protein, scattered over various regions of the molecule, have been reported to be associated with pancreatitis or hereditary pancreatitis. It seems therefore unlikely that such a great number of mutations located in entirely different regions of the protease serine 1 (PRSS1) gene would all have the same effect on trypsinogen and result in a gain of enzymatic function. A loss of enzymatic function in vivo would, accordingly, be a much simpler and consistent explanation for the pathophysiologic role of hereditary pancreatitis mutations. On the other hand, several in vitro studies found that either facilitated trypsinogen autoactivation or extended trypsin activity can result under defined experimental conditions. Whether these in vitro conditions reflect the highly compartmentalized situation under which intracellular protease activation begins in vivo is presently unknown, but these findings would favor a gain of trypsin function as a consequence of several trypsinogen mutations. Some recently reported kindreds with hereditary pancreatitis that carry a novel R122C mutation are very interesting with respect to a loss-of-function con- cept. The single nucleotide exchange in these families is located within exactly the same codon as in the most common variety of hereditary pancreatitis (R122C vs. R122H). Biochemical studies revealed that enterokinase-induced activation, cathepsin B-induced activation, and autoactivation of Cys122 trypsinogen are significantly reduced by 60–70% compared with the wild-type proenzyme. Cys122 trypsinogen seems to form mismatched disulfide bridges under intracellular in vivo conditions, resulting in a dramatic loss of trypsin function that cannot be compensated for by increased autoactivation. Indeed, if this scenario reflects thein vivo conditions within the pancreas, it would represent the first direct evidence from a human study for a “loss-of-function”mutation and therefore for a potential protective role of trypsin activity in the pancreas. Whether the gain-of-function hypothesis or the loss-of- function hypothesis correctly explains the pathophysiology of hereditary pancreatitis presently cannot be completely resolved, short of direct access to living human acini from carriers of PRSS1 mutations or a transgenic animal model into which the human PRSS1 mutations have been introduced. Trypsinogen isoforms in human pancreatitis The human pancreas secretes three isoforms of trypsinogen, encoded by the PRSS genes 1, 2, and 3. On the basis of their relative electrophoretic mobility, the three trypsinogen species are commonly referred to as cationic trypsinogen, anionic trypsinogen, and mesotrypsinogen. Normally the cationic isoform CHAPTER 24 207 constitutes about two-thirds of the total trypsinogen content, while anionic trypsinogen makes up approximately one-third. A characteristic feature of human pancreatic diseases as well as chronic alcoholism is the relatively selective upregulation of anionic trypsinogen secretion. Even though the two major human isoforms of trypsinogen are about 90% identical in their primary structure, their properties with respect to autocatalytic activation and degradation differ significantly. Anionic trypsinogen (and trypsin) exhibits a markedly increased propensity for autocatalytic degradation in compari- son with cationic trypsinogen (and trypsin). Further- more, acidic pH stimulates autoactivation of cationic trypsinogen, whereas it inhibits autoactivation of anionic trypsinogen. The distinctly different behavior of the two trypsinogen isoforms suggests that changes in their ratio should have profound effects on the over- all stability of the pancreatic trypsinogen pool and its susceptibility to autoactivation. Biochemical analysis of mixtures of the two trypsinogens at different ratios and in pH and calcium conditions indicative of physiologic or pathologic situ- ations have provided evidence that upregulation of anionic trypsinogen in pancreatic disorders does not affect physiologic trypsinogen activation but significantly limits trypsin generation under potentially pathologic conditions. It seems that anionic trypsinogen plays a protective role in pancreatic physiology. As a defensive mechanism, acinar cells increase secretion of the anionic isoform in pancreatic diseases or under toxic conditions, thereby decreasing the risk for premature trypsinogen activation inside the pancreas while maintaining adequate trypsin function in the duo- denum. On the other hand, the decreased abil- ity of intrapancreatic trypsinogen to autoactivate can be regarded as a “loss of trypsin function” which, in this context, may play a disease-causing instead of a safeguarding role (see discussion on the possible role of loss of trypsin function in the onset of pancreatitis). While these interpretations assume that total trypsinogen levels remain constant and that only the ratio of the two isoforms changes, in reality this is rarely the case. In chronic pancreatitis, trypsinogen secretion is generally decreased whereas in chronic alcoholism total trypsinogen secretion can be significantly elevated. As a consequence of increased trypsinogen synthesis the pancreas could be more susceptible to inappropriate zymogen activation, and becomes so despite the protective effects of anionic trypsinogen. In this context, it is noteworthy that the rare pancreatitis- associated E79K mutation in human cationic trypsinogen results in a loss of function as far as autoactivation is concerned. However, the mutant enzyme activates anionic trypsinogen with twofold greater efficiency than wild-type cationic trypsin. The unusual mechanism of action of this mutant underscores the potential importance of an interaction between the two human trypsinogen isoforms in the pathogenesis of pancreatitis. Role of calcium in pancreatic protease activation Calcium is a critical intracellular second messenger in the regulated exocytosis of digestive enzymes from the apical pole of the acinar cell. On the other hand, calcium can also directly affect the activation and stability of trypsinogen and other proteases. These two aspects of calcium function are both involved in the onset of pancreatitis. In vitro, Ca 2+ is not required for trypsinogen activation by enterokinase or cathepsin B but stimulates autocatalytic activation of bovine cationic, rat anionic, or human anionic trypsinogen that usually requires high millimolar Ca 2+ concentrations (2–10 mmol/L). In contrast, autoactivation of human cationic trypsinogen is stimulated in the submillimolar concentration range, while concentrations above 1 mmol/L inhibit autoactivation. The trypsinogen activation peptide (TAP) contains a negatively charged tetra-aspartate motif (Asp19-Asp20-Asp21-Asp22), which together with Lys23 forms the enterokinase recognition site. The negative charges of the aspartate carboxylates are believed to inhibit trypsin-induced (auto)activation, and high Ca 2+ concentrations may shield these charges by binding to the tetra-aspartate sequence, which is also referred to as the low-affinity Ca 2+ -binding site of trypsinogen. In the case of human cationic trypsinogen, stimulation of autoactivation already at low Ca 2+ concentrations (EC 50 ~15mmol/L) appears to be a consequence of Ca 2+ binding to a different high-affinity binding site (see below). The mechanism whereby high- affinity Ca 2+ binding facilitates autoactivation of cationic trypsinogen is unclear at present. Ca 2+ is also essential for the structural integrity of trypsinogen and trypsin. This effect of Ca 2+ is mediated by the high-affinity Ca 2+ binding site (K D ~20mmol/L for human cationic trypsin, as judged by protection PART II 208 against autolysis), which is located between Glu75 and Glu85. Binding of Ca 2+ to this site is believed to induce conformational changes that reduce the proteolytic accessibility of surface-exposed Arg and Lys residues that are targets of trypsinolytic degradation. Differ- ences in surface exposure of conserved Lys and Arg side-chains may further contribute to a trypsin isoform’s specific sensitivity to autocatalytic degradation. In acinar cells, Ca 2+ is also a critical intracellular second messenger for the regulated exocytosis of digestive enzymes. Endocrine diseases associated with clinical hypercalcemia are known to predispose patients to develop pancreatitis, presumably by decreasing the threshold level for the onset of pancreatitis or by induc- tion of morphologic alterations equivalent to pancreatitis. An elevation of acinar cytosolic free Ca 2+ should be regarded as the most probable common denomina- tor for the onset of various clinical varieties of acute or chronic pancreatitis. While the requirement for calcium in protease activation is undisputed and high intracellular Ca 2+ concentrations are thought to represent a prerequisite for premature protease activation, Ca 2+ alone seems to be insufficient to trigger this process. Role of pH in pancreatic protease activation Changes in pH also have a profound impact on autoactivation and autodigestion of trypsinogen. It is assumed that the pH within the lysosomal compartment is held between 4.5 and 5.5, whereas it is maintained between 6 and 7 in the secretory compartment. Some cytoplas- mic vacuoles that arise during pancreatitis also appear to be acidic. Pancreatic zymogens, as opposed to cathepsins, are stable at very acidic pH (3.0 or 3.5) and neither autoactivation nor autodegradation occur to any significant degree. When pH is raised, autoactivation becomes more rapid up to a maximum at pH 5–6. At neutral or slightly alkaline pH and in the absence of Ca 2+ , the rate of autoactivation declines while autodegradation becomes prevalent. In the presence of Ca 2+ (see above), autoactivation is maximal at slightly alkaline pH with minimal autodegradation. Inside the acinar cell the pH is regulated in a much more narrowly controlled range than used in in vitro experiments. Maximal as well as supramaximal stimulation of pancreatic acinar cells leads to a slight increase (0.1–0.3) in intracellular pH but this process is again dependent on the presence of intracellular Ca 2+ . In studies in which the acidic pH inside the vesicular compartments of acinar cells was neutralized by exposure to weak cell- permable bases, premature protease activation was found to be blocked. On the other hand, when the same agents were used to neutralize the acinar cell compartments in vivo, experimental pancreatitis was still found to occur and neither its onset nor its course were affected. This indicates that the role of intracellular pH in premature zymogen activation is complex. A shift of intracellular pH to conditions less favorable for premature activation of procarboxypeptidase and trypsinogen by trypsin may optimize the conditions for premature activation by cathepsin B. In this context it is noteworthy that activation of human cationic trypsinogen by cathepsin B exhibits a very sharp pH dependence in the acidic range. Between pH 4.0 and 5.2 a 100-fold decrease in activity was observed, suggesting that minor changes in intravesicular pH can have profound effects on cathepsin B-mediated trypsinogen activation in acinar cells. Which of these mechanisms plays the critical role in the onset or subsequent course of acute clinical pancreatitis will require additional studies. Pancreatic secretory trypsin inhibitor gene (SPINK1) PSTI, a 56-amino acid SPINK1, is synthesized in acinar cells as a 79-amino acid single-chain polypeptide pre- cursor that is subsequently processed to the mature peptide, stored in zymogen granules, and secreted into pancreatic ducts. It is regarded as a first-line defense system that is capable of inhibiting up to 20% of total trypsin activity which may result from accidental premature activation of trypsinogen to trypsin within acinar cells. First studies on the role of PSTI mutations in chronic pancreatitis patients reported that some of these patients had a point mutation in exon 3 of the PSTI gene that leads to the substitution of an as- paragine by serine at position 34 (N34S). Analysis of intronic sequences showed that the N34S mutation is in complete linkage disequilibrium with four additional sequence variants: IVS1–37TC, IVS2+268AG, IVS3–604GA, and IVS4–69insTTTT. Whether the N34S amino acid exchange or its association with these intronic mutations, which may confer splicing abnor- malities, are causative in the context of PSTI pathophysiology is not clear at the moment. In a number of studies further mutations and polymorphisms have been detected in PSTI, including a methionine to threo- CHAPTER 24 209 nine exchange that destroys the start codon of PSTI (1MT), a leucine to proline exchange in codon 14 (L14P), an aspartate to glutamine exchange in codon 50 (D50E), and a proline to serine exchange in codon 55 (P55S). Few studies have reported the frequencies of these mutations and they seem to be fairly low in com- parison to the N34S mutation. N34S is present at a low level (0.4–2.5%) in the normal healthy population, but appears to be accumulated in selected groups of chronic pancreatitis patients. As a result of inconsistent selec- tion criteria, different groups have reported N34S mutations in 6%, 19%, 26%, or even 86% of alcoholic, hereditary, or familial idiopathic pancreatitis patient groups. The considerable differences in these study results may be related not only to the absence of a generally accepted terminology for “familial” or “hereditary” and “idiopathic” pancreatitis, but could also be explained by the fact that determination of frequencies in some cases may involve several family members whereas other studies counted unrelated patients only. Independent of different reports about the strength of this association with chronic pancreatitis, the prevalence of N34S mutations appears to be increased in pancreatitis but does not follow a clear-cut recessive or complex inheritance trait. In hereditary pancreatitis associated with mutations in the cationic trypsinogen gene, studies have demonstrated that the additional presence of SPINK1 mutations affects neither penetrance nor disease severity nor the onset of secondary diabetes mellitus. While this does not rule out that SPINK1 is a “weak” risk factor for the onset of pancreatitis in general, it makes a modifier role in the onset of hereditary pancreatitis associated with “strong” PRSS1mutations very unlikely. In studies that analyzed the association of PSTI with tropical pancreatitis, an endemic variety of pancreatitis in Africa and Asia, several groups have reported a strong association of N34S in populations in India and Bangladesh. Tropical pancreatitis is a type of idiopathic chronic pancreatitis of unknown etiology that can be categorized by its clinical manifestations into either tropical calcific pancreatitis or fibrocalculous pancreatic diabetes. While frequencies of the N34S mutation in the normal control population are comparable to previous reports from Europe and North America (1.3%), the mutation was found in 55% and 29% of patients with fibrocalculous pancreatic diabetes and in 20% and 36% of those with tropical calcific pancreatitis in Bangladesh and South India respectively. Mutations in the PSTI gene may define a genetic predisposition for pancreatitis and apparently lowers the threshold for pancreatitis caused by other factors. However, a biochemical analysis of the protease- inhibiting activity of PSTI by Kuwata et al. reported unchanged trypsin-inhibiting function of N34S-PSTI under both alkaline and acidic conditions. At pH values between 5 and 9 recombinant N34S protein had the same inhibitory activity for trypsin as wild-type PSTI and also a variation of calcium concentrations revealed no differences of N34S function. The pathophysiology of N34S mutations may therefore follow mechanisms other than decreased protease inhibitory activity due to a conformational change. Instead the predisposition to pancreatitis in N34S patients may be caused by differences in PSTI expression levels possibly due to splicing defects. An analysis of PSTI protein expression levels in N34S patients will have to clarify this issue. Cystic fibrosis transmembrane conductance regulator In the general population a large number of different, relatively severe mutations are commonly found within the CFTR gene. Some of these mutations involve a single allele, whereas others are combinations of severe and mild mutations and additional 5T alleles in intron 8, that further reduce the amount of functional CFTR. The gene encodes a cyclic adenosine monophosphate- sensitive chloride channel essential for normal bicar- bonate secretion and which is expressed in epithelial cells, such as those in the lung, biliary tract, pancreas, and vas deferens. Typical cystic fibrosis (CF) is an autosomal recessive inherited disease that results from severe mutations (e.g., D508) in both alleles of the CFTR gene. Besides chronic pulmonary disorders, CF shows multiorgan involvement and is the most common inherited disease of the pancreas. Children with CFTR mutations are often born with a severely damaged fibrotic pancreas and pancreatic insufficiency. Observa- tions in chronic pancreatitis patients of abnormally increased sweat electrolyte levels and pancreatic ductal plugging comparable to findings in CF further suggested that CFTR may play a role in chronic pancreatitis as well. Several studies on patients with idiopathic chronic pancreatitis subsequently confirmed an increased CFTR mutation rate, which was elevated PART II 210 above the expected 5% carrier frequency normally observed in Caucasian populations. Genotypes that reduce CFTR protein function to 1% of its normal value cause typical CF, characterized by pulmonary disorders, pancreatic insufficiency, congenital bilateral absence of vas deferens, and sweat test alteration. Genotype–phenotype studies indicate that mutations that cause severe loss of CFTR function (< 2% residual function) are linked to pancreatic insufficiency, whereas mutations that cause a milder loss of CFTR function (~ 5% residual function) are classified as pancreatic- sufficient, even though they still cause CF. Disease manifestation appears to depend on the amount of preserved CFTR function and also on a presumably (pancreatic) tissue-specific threshold level. To date, while more than 1000 CFTR mutations are known, commercial tests generally detect only a few severe mutations known to cause classical CF. Comprehensive CFTR gene testing in patients with idiopathic chronic pancreatitis will have to clarify whether the combination of specific severe/mild or of mild/mild CFTR mutations in a compound heterozygous state (and eventually also in combination with T5 alleles) represents a genetic predisposition to chronic pancreatitis. Autoimmune chronic pancreatitis Autoimmune pancreatitis represents a distinct form of chronic pancreatitis. The distinction of autoimmune pancreatitis from other forms is important because these patients respond very well to steroid therapy. Autoimmune pancreatitis may be occasionally observed in association with Sjögren’s syndrome, primary biliary cirrhosis, primary sclerosing cholangitis, Crohn’s disease, ulcerative colitis, or other immune- mediated disorders. Histologic features consist of destruction of the duct and fibrotic atrophy of the acinar tissue without calcifications. Ectors and colleagues noted a unique pattern of inflammation that particular- ly involved the ducts and resulted in duct obstruction and sometimes duct destruction. Histopathologically, an infiltration with lymphocytes, plasma cells, and fibrosis can be found. Multiple autoantibodies have been detected in autoimmune pancreatitis, including those against nuclear structures, lactoferrin, carbonic anhydrase II, smooth muscle cells, and rheumatoid factor. The numbers of CD8 + and CD4 + cells are increased in the peripheral blood, suggesting a Th1-type immune response. Inflammatory cells in chronic pancreatitis Chronic inflammation is one of the characteristics of chronic pancreatitis. Mediators involved in the recruit- ment of inflammatory cells to the site of tissue injury are known as chemotactic factors and are produced in large quantities at the inflammatory site. These mediators, such as tumor necrosis factor-a, cytokines, and proinflammatory and antiinflammatory interleukins, regulate pancreatic tissue infiltration of mast cells, neu- trophils, lymphocytes, and monocytes and initiate and control the subsequent healing process. This inflammatory response, which in some cases may lead to incom- plete recovery from episodes of acute pancreatitis, presumably represents the key in a disease mechanism that controls the course of pancreatitis progression from the acute to the chronic state. In 1999, the so-called sentinel acute pancreatitis event (SAPE) hypothesis was introduced by David Whitcomb. This hypothesis is based on an initial “sentinel“ event that indicates an episode of acute pancreatitis apparently due to any triggering event. Subsequent progression to a chronic disease state may then depend on the persis- tent presence of antiinflammatory cells (macrophages and activated stellate cells) that remain in the pancreatic tissue for a substantial period of time and which normally are important in limiting the inflammatory reaction and starting the healing process. Continued challenge of acinar cells by alcohol or other stresses during this period will provoke acinar cells to release cytokines and other mediators that are then able to induce, in still resident antiinflammatory cells, the pro- duction and deposition of collagen and extracellular matrix proteins characteristic of the fibrotic processes. As a consequence, the severity of recurrent episodes of acute pancreatitis may be tempered by the antiinflammatory response, yet the process of fibrosis is started, as seen in hereditary pancreatitis. While acute or chronic cellular stresses generally influence acinar cells to produce cytokines, it is the presence of macrophages and activated stellate cells, which may persist in pancreatic tissue only after a first “sentinel” event, that determines disease progression according to the SAPE hypothesis. CHAPTER 24 211 [...]... TTTTGATGTGTGTGTGTGTGTGTGTGTTTTTTTAACAG (TG)13–T5: TTTTGATGTGTGTGTGTGTGTGTGTGTGTGTGTTTTTAACAG TTTTGATGTGTGTGTGTGTGTGTGTGTGTGTTTTTAACAG (TG)12–T5: TTTTGATGTGTGTGTGTGTGTGTGTGTGTTTTTAACAG (TG)11–T5: Figure 25. 2 TGm/Tn haplotype sequences at the end of intron 8 of the CFTR gene Tn (TG)m (TG)m–Tn 9 9 9-9 1 0-9 1 1-9 1 0-7 1 1-7 1 2-7 1 1 -5 1 2 -5 1 3 -5 10 7 11 12 13 5 Figure 25. 3 Effect of particular alleles on the amount of functional CFTR For different... the G542X, G 551 D, R 553 X, W1282X, and N1303K mutations Finally, for a given ethnic population, ethnic-specific mutations that reach frequencies of about 1–2% might exist For most populations, all these common mutations cover about 85 95% of all mutant CFTR genes The remaining group of mutant CFTR genes in a particular population comprises rare mutations, some of them only found in a single family CF-causing... pancreatitis Gut 1984; 25: 756 – 759 Seidensticker F, Otto J, Lankisch PG Recovery of the pancreas after acute pancreatitis is not necessarily complete Int J Pancreatol 19 95; 17:2 25 229 2 35 28 Role of imaging methods in diagnosing, staging, and detecting complications of chronic pancreatitis in clinical practice: should MRCP and MRI replace ERCP and CT? Carmen Villalba-Martín and J Enrique Domínguez-Muñoz Introduction... Diagnosis of abdominal pain How to distinguish between pancreatic and extrapancreatic causes Acta Chir Scand 1990; 156 :273–278 Lankisch PG, Andrén-Sandberg Å Standards for the diagnosis of chronic pancreatitis and for the evaluation of treatment Int J Pancreatol 1993;14:2 05 212 CHAPTER 27 Lankisch PG, Banks PA Pancreatitis Berlin: Springer-Verlag, 1998 Lankisch PG, Creutzfeldt W Erythema ab igne (Livedo... do not mature When T5 is found in compound heterozygosity with a severe CFTR mutation, or even T5, pathology such as CBAVD might be observed However, not all male individuals who are compound heterozygous for a severe CFTR mutation and T5 develop CBAVD, such as some fathers of CF children The T5 polymorphism was therefore classified as a disease mutation with partial penetrance The partial penetrance... number of TG repeats that are found (Fig 25. 2) The higher the number of TG repeats, the less efficient exon 9 splicing will be (Fig 25. 3) The T5 polymorphism can be found in combination with a TG11, TG12, or TG13 allele (11, 12, or 13 TG repeats respectively) In CBAVD patients, the milder TG11-T5 allele is hardly found, while the TG12-T5 is most frequently found TG13-T5 is rarer but also found in CBAVD patients... conserved and fail to produce chloride channels Nat Genet 1993;4:426–431 Dumur V, Gervais R, Rigot J-M et al Abnormal distribution of CF F508del allele in azoospermic men with congenital aplasia of epididymis and vas deferens Lancet 1990;336: 51 2 Egan M, Flotte T, Afione S et al Defective regulation of outwardly rectifying Cl- channels by protein kinase A corrected by insertion of CFTR Nature 1992; 358 :58 1 58 4... insufficiency and calcifications develop more slowly Furthermore, other difficulties arise because two subgroups of chronic pancreatitis have been reported, a juvenile and a senile form, and the courses for these differ from alcohol-induced chronic pancreatitis At the onset of symptoms, the juvenile form is characterized by a mean age of about 25 years with equal sex distribution It has a painful clinical. .. autoantibodies and a Th1/Th2-type cellular immune response Gastroenterology 2000;118 :57 3 58 1 Pfutzer RH, Barmada MM, Brunskill AP et al SPINK1/PSTI polymorphisms act as disease modifiers in familial and idiopathic chronic pancreatitis Gastroenterology 2000;119: 6 15 623 Sahin-Toth M The pathobiochemistry of hereditary pancreatitis: studies on recombinant human cationic trypsinogen Pancreatology 2001;1:461–4 65 Sahin-Toth... with chronic pancreatitis Am J Gastroenterol 2001;96:2 657 –2661 Truninger K, Kock J, Wirth HP et al Trypsinogen gene mutations in patients with chronic or recurrent acute pancreatitis Pancreas 2001;22:18–23 Whitcomb DC Hereditary pancreatitis: a model for understanding the genetic basis of acute and chronic pancreatitis Pancreatology 2001;1 :56 5 57 0 Whitcomb DC, Gorry MC, Preston RA et al Hereditary . CFTR gene. T n 9 7 5 (TG) m 9 11 10 12 13 (TG) m –T n 9-9 1 0-9 1 1-9 1 0-7 1 1-7 1 2-7 1 1 -5 1 2 -5 1 3 -5 Figure 25. 3 Effect of particular alleles on the amount of functional CFTR. For different polymorphic. most populations, each reaching frequencies of about 1–2%. Ex- amples include the G542X, G 551 D, R 553 X, W1282X, and N1303K mutations. Finally, for a given ethnic population, ethnic-specific. represent the first direct evidence from a human study for a “loss-of-function”mutation and therefore for a potential protective role of trypsin activity in the pancreas. Whether the gain-of-function

Định dạng
Số trang	56
Dung lượng	1,23 MB