Báo cáo y học: " Postconditioning inhibits myocardial apoptosis during prolonged reperfusion via a JAK2-STAT3Bcl-2 pathway" ppsx

RESEARC H Open Access Postconditioning inhibits myocardial apoptosis during prolonged reperfusion via a JAK2-STAT3- Bcl-2 pathway Yikui Tian 1† , Wenjuan Zhang 2† , Dachuan Xia 1 , Paul Modi 3 , Degang Liang 1 and Minxin Wei 1* Abstract Background: Postconditioning (PostC) inhibits myocardial apoptosis after ischemia-reperfusion (I/R) injury. The JAK2-STAT3 pathway has anti-apoptotic effects and plays an essential role in the late protection of preconditioning. Our aim was to investigate the anti-apoptotic effect of PostC after prolonged reperfusion and the role of the JAK2- STAT3 pathway in the anti-apoptotic effect of PostC. Methods: Wistar rats were subjected to 30 minutes ischemia and 2 or 24 hours (h) reperfusion, with or without PostC (three cycles of 10 seconds reperfusion and 10 seconds reocclusion at the onset of reperfusion). Separate groups of rats were treated with a JAK2 inhibitor (AG490) or a PI3K inhibitor (wortmannin) 5 minutes before PostC. Immunohistochemistry was used to analyze Bcl-2 protein levels after reperfusion. mRNA levels of Bcl-2 were detected by qRT-PCR. TTC staining was used to detect myocardial infarction size. Myocardial apoptosis was evaluated by TUNEL staining. Western-blot was used to detec t p-STAT3 and p-Akt levels after reperfusion. Results: There was more myocardial apoptosis at 24 h vs 2 h after reperfusion in all groups. PostC significantly reduced myocardial apoptosis and elevated Bcl-2 levels at both 2 and 24 hours after reperfusion. PostC increased p-STAT3 and p-Akt levels after reperfusion. Administration of AG490 reduced p-STAT3 and p-Akt levels and attenuated the anti-apoptotic effect of PostC. Wortmannin also reduced p-Akt levels and attenuated the anti- apoptotic effect of PostC but had no effect on p-STAT3 levels. AG490 abrogated the up-regulation of Bcl-2 by PostC. Conclusion: PostC may reduce myocardial apoptosis during prolonged reperfusion via a JAK2-STAT3-Bcl-2 pathway. As a downstream target of JAK2 signaling, activation of PI3K/Akt pathway may be necessary in the protection of PostC. Keywords: Ischemia/reperfusion injury, apoptosis, postconditioning, JAK2-STAT3 pathway, Bcl-2 Background Postconditioning (PostC), defined as transient periods of ischemia and reperfusion at the onset of reperfusion, has been shown to be protective against myocardial ischemia- reperfusion (I/R) injury in multiple species [1]. Recent studies reported that the cardioprotective effects of PostC persisted after prolonged reperfusion [2,3]. Cardiomyocyte apoptosis is one of the major mechanisms underlying I/R injury. The progressive loss of cardiomyocytes due to apoptosis plays a critical role in cardiac dysfunction after acute myocardial infarction. Previous studies have reported that PostC inhibits apoptosis in both in vivo and in vitro models [4,5]. However, the anti-apoptotic effect of PostC after prolonged reperfusion has not yet been well defined. The Janus kinase (JAK)-signal transducers and activators of transcription (STAT) pathway is an evolutionary con- served signaling network i nvolved in a wide range of dis- tinct cellular processes, including inflammation, apoptosis, cell-cycle control and development. As a part of SAFE (Survivor Act ivati ng Factor En hanceme nt) pat hway , the * Correspondence: minxinw@yahoo.com † Contributed equally 1 Department of Cardiovascular Surgery, Tianjin Medical University General Hospital, Tianjin, P. R. China Full list of author information is available at the end of the article Tian et al. Journal of Biomedical Science 2011, 18:53 http://www.jbiomedsci.com/content/18/1/53 © 2011 Tian et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http: //creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the origina l work is properly cited. JAK2-STAT3 pathway has anti-apoptotic effects and plays essential roles in postconditioning and the late protection of preconditioning [6-8]. However, the role of the JAK2- STAT3 pathway in the anti-apoptotic effects of PostC is not yet fully understood. The present study was designed to investigate the anti-apoptotic effect of PostC after pro- longed reperfusion and to define the role of the JAK2- STAT3 pathway in this. Methods All animals were obtained from the Chinese People’s Lib- eration Army Academy of Military Medical Sciences. The experimental protocol was approved by the Tianjin Med- ical University Animal Care and Use Committee. Male Wistar rats weighing 240 to 280 g were anesthetized with sodium pentobarbital (40-50 mg/kg, intraperitoneal) and ventilated with oxygen-e nric hed room air using a rode nt ventilator. The left carotid artery was cannulated for monitoring arterial pressure and electrocardiogram (ECG) leads were placed to record heart rat e. The chest was opened b y a left tho racotomy in the fift h intercostal space. After pericardiotomy, a 6-0 prolene ligature was placed under the left coronary artery (LCA) where it emerges from beneath the left atrial appendage and the ends were threaded through a small plastic tube to form a snare for reversible LCA occlusion. Comple te LCA occlusion was confirmed by observing cyanosis of the myocardium as well as ST-segment deviation. Experimental protocol Rats were randomized into five groups, as shown in Fig- ure 1: (1) sham group - the ligature was placed under the LCA without occlusion; (2) I/R group - no interventions were applied either before or after LCA occlusion; (3) PostC group - three cycles of 10 s of reperfusion and 10 s of reocclusion immediately at the onset of reperfusion; (4) PostC+Ag490 group - the JAK2 inhibitor AG 490 (Sigma-Aldrich, St. Louis, MO, dissolved in 0.1% DMSO solution, 3 mg/Kg, iv) was administered 5 min before PostC; (5) PostC+wortmannin group - the PI3K inhibit or wortmannin (Sigma-Aldrich, St. Louis, MO, dis- solved in 0.1% DMSO solution, 1.5 mg/Kg, i p) was administered 5 min before PostC. Other two control groups, treating rats with Ag490 or wortmannin alone without PostC, were designed to eval- uate the effects of Ag490 and wortmannin alone in I/R group. The doses of AG490 (3 mg/Kg,iv) and wortman- nin (1.5 mg/Kg, ip) were according to previous study [9]. Additional rats from the sham and PostC groups were treated with 0.1% DMSO to detect any indepen- dent effects of the DMSO vehicle. Myocardial biopsies from the sham group were obtained at 20 min, 2.5 h or 24 h after thoracotomy (n = 4 at each time point). The other groups were subjected to 30 min of LCA occlu- sion followed by 10 min (n = 8, for signaling pathway detections), 2 h (n = 8, for TUNEL and Bcl-2 detec- tions) or 24 h (n = 8, for TUNEL and Bcl-2 detections) of reperfusion. Myocardial biopsies were taken at the end of the experiment. The PostC protocol was per- formed with three cycles of 10 s of reperfusion and 10 s of reocclusion immediately at the onset of reperfusion as reported previously [4]. Myocardial infarction size analysis After reperfusion, the LCA was re-ligated at its original site. 2 ml of 2% evans blue was injected into the inferior vena cava to define the area at risk (AAR). The ventri- cles of the hearts were sliced transversely into 2-mm thick slices. The slices were incubated in 1% triphenylte- trazolium chloride (TTC, sigma) at 37°C for 15 min to identify the infarction size (IS). AAR and IS were deter- mined by computerized planimetry using ImageJ soft- ware. AAR was expressed as a percentage of the left ventricle and IS was expressed as a percentage of the AAR. TUNEL (Terminal Doxynucleotidyl Transferase-mediated dUTP-X Nick End Labeling) staining The histochemical detection of apoptotic cells was per- formed as previously reported [4]. The tissue blocks were fixed in 4% paraformaldehyde and incubated with proteinase K. Fragments of DNA in the tissue sections were analyzed using a TUNEL detection kit (Promega Figure 1 Ex perime ntal groups and their protocols.Ratswere randomly divided into five groups as showed in the figure. Tian et al. Journal of Biomedical Science 2011, 18:53 http://www.jbiomedsci.com/content/18/1/53 Page 2 of 8 Corporation, Madison, WI). For each slide, the color images of 10 separate fields were captured randomly and digitized. The cells with clear nuclear labeling were defined as TUNEL-positive cells. The apoptotic index was calculated as the number of TUNEL-positive cells/ total number of myocytes × 100. Immunohistochemistry Transmural LV samples were embedded in paraffin and cut into 5μm sections. Detection of Bcl-2 expression was performed as described previously [10]. Tissue sec- tions were exposed overnight to rabbit polyclonal anti- bcl-2 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) at 4°C, washed in PBS and then incubated with bio- tinylatedgoatantirabbitIgGfor60minat37°C.After two washing steps, sections were exposed to s treptavi- din-horseradish-peroxidase complex for 30 min at 37°C, and then visualized with 3,3’ -diaminobenzidine, embedded in glycerol gelatin and coverslips applied. Images were captured digitally and analyzed using Image-Pro Plus version 6.0 (Media Cybernetics, Inc, Bethesda, MD). The result was expressed as the ratio of positive to negative staining area. Western-blot analysis Transmural LV samples were obtained after 10 min of reperfusion. Western blotting was performed as described previously (5). In brief, freshly frozen myo- cardial tissue samples were homogenized in RIPA buf- fer. Total protein was separated by 10% SDS-PAGE and transferred to nitrocellulose membranes. Mem- branes were exposed to p-Akt, Akt, p-STAT3(Tyr705) or STAT3 antibody(Cell Signaling T echnology, Beverly MA), and subsequently incubated with a chemilumi- nescence substrate and exposed to radiographic film. The images were captured digitally and the density at specific molecular weights was measured using Gel-Pro analyzer version 3.0 (Media Cybernetics, Inc, Bethesda, MD). Quantitative reverse transcriptase-polymerase chain reaction Bcl-2 mRNA levels were determined by quantitative reverse transcriptase-polymerase chain reaction (qRT- PCR). For extraction of total RNA the RNeasy Mini Kit (QIAGEN China Co., Ltd, Shanghai) was used according to the manufacturer’s instructions. cDNAs were synthe- sized using RevertAid™ First Strand cDNA Synthesis Kit(Fermentas China Co., Ltd. Shenzhen). qPCR was performed with Maxima ® SYBR Green qPCR Master Mix, ROX Solution provided(Fermentas China Co., Ltd. Shenzhen). Fluorescent signals were normalized to an internal reference, and the threshold cycle (Ct) was set within the exponential phase of the PCR. The relative gene expression was calculated by comparing cycle times for each target PCR. The target PCR Ct values were normalized by subtracting the GAPDH Ct value, which provided the ΔCt value. mRNA levels were quan- tified with the 2 (-ΔΔct) relative quantification method. Thefollowingprimerswereusedfordetection:Bcl-2 Table 1 Hemodynamic Data Measurements Baseline Ischemia 2 h after reperfusion 24 h after reperfusion Groups HR (Beat/min) MABP (mmHg) HR (Beat/min) MABP (mmHg) HR (Beat/min) MABP (mmHg) HR (Beat/min) MABP (mmHg) Sham-10 m 381 ± 5 98 ± 3 382 ± 4 97 ± 3 - - - Sham-2 h 373 ± 5 98 ± 4 380 ± 5 96 ± 3 379 ± 4 96 ± 2 - - Sham-24 h 373 ± 3 97 ± 4 373 ± 3 96 ± 4 371 ± 3 97 ± 3 368 ± 4 95 ± 3 Control-10 m 376 ± 4 97 ± 4 382 ± 4 81 ± 2* - - - - Control-2 h 373 ± 5 96 ± 3 379 ± 5 82 ± 3* 371 ± 5 96 ± 3 - - Control-24 h 374 ± 5 99 ± 2 379 ± 5 81 ± 2* 378 ± 3 98 ± 3 373 ± 2 96 ± 3 Post-10 m 374 ± 4 96 ± 4 383 ± 4 82 ± 3* - - - - Post-2 h 379 ± 4 95 ± 5 389 ± 4 81 ± 3* 381 ± 4 96 ± 4 - - Post-24 h 375 ± 4 96 ± 4 383 ± 4 82 ± 2* 374 ± 4 96 ± 4 375 ± 3 94 ± 3 Post+Ag490-10 m 374 ± 5 97 ± 3 381 ± 4 81 ± 3* - - - - Post+Ag490-2 h 381 ± 5 98 ± 2 383 ± 6 80 ± 2* 377 ± 5 96 ± 2 - - Post+Ag490-24 h 379 ± 4 98 ± 2 382 ± 4 86 ± 3* 376 ± 5 93 ± 2 376 ± 4 95 ± 3 Post+wort-10 m 376 ± 6 97 ± 3 380 ± 6 79 ± 3* - - - - Post+wort-2 h 377 ± 5 97 ± 3 386 ± 4 80 ± 3* 375 ± 4 96 ± 3 - - Post+wort-24 h 373 ± 6 97 ± 2 380 ± 6 86 ± 2* 368 ± 5 97 ± 3 369 ± 3 95 ± 3 *p < 0.05 compared with baseline. HR = heart rate, MABP = mean artery blood pressure. Tian et al. Journal of Biomedical Science 2011, 18:53 http://www.jbiomedsci.com/content/18/1/53 Page 3 of 8 FW: CCGGGAGATCGTGATGAAGT, RV: ATCC- CAGCCTCCGTTATCCT. GAPDH FW: ACTTTGT- CAAGCTCATTTCCTG, RV: CTCTCTTCCT CTTG TGCTCTTG. Statistical analysis All data are expressed as mean ± SEM and analyzed using SPSS 15.0 (Chicago, IL). Independent samples t- test and one-way ANOVA were used to compare data with post hoc analysis using the Student-Newman-Keuls correction. A p-value <0.05 was considered significant. Results Hemodynamic data (Table 1) There were no baseline differences . After 30 min ische- mia, mean arterial blood pressure decreased significantly between the sham and intervention groups. No statisti- cal differences were observed among all groups at both 2 and 24 hours after reperfusion. Myocardial infarction after prolonged reperfusion No myocardial infarction was found in sham group. Area of risk was similar among all treatment groups. Myocardial infarction area was increased between 2 and 24 hours after reperfusion in all intervention groups. PostC significantly reduced myocardial infarction size after reperfusion (Figure 2). Treatment with AG490 and wortmannin alone had no effect on myocardial infarc- tion after reperfusion in I/R group. Myocardial apoptosis after prolonged reperfusion There were no TUNEL-positive cells in the sham group. There was more apoptosis at 24 h compared to 2 h reperfusion in all intervention groups (Figure 3). PostC significantly reduced myocardial apoptosis at 2 and 24 h after reperfusion. Treating rats with AG490 or wort- mannin significantly attenuated anti-apoptosis effects of PostC. However, AG490 or wortmannin alone had no effect on apoptosis index after reperfusion in I/R group. Myocardial Bcl-2 levels Both protein and mRNA lev els of Bcl-2 were similar at 2 and 24 h in the control group. PostC elevated levels of Bcl-2 after reperfusion, which increased between 2 and 24 h after reperfusion. The JAK2 inhibitor AG490 decreased Bcl-2 levels after reperfusion. The PI3K inhi- bitor wortmannin had no effects on Bcl-2 levels (Figure 4, 5). Correlation between JAK2-STAT3 and PI3K/Akt signaling pathways in PostC PostC significant increased the expression of p-STAT3 and p-Akt. Administration of AG490 before PostC reduced p-STAT3 and p-Akt levels and attenuated the cardioprotection effect of PostC. Wortmannin also reduced p-Akt levels and attenuated the car dioprotec- tion effect of PostC but had no effect on p-STAT3 levels (Figures 6 and 7). Discussion The present study demonstrated that apoptosis follow- ing I/R injury increases after prolonged reperfusion. The prolonged anti-apoptotic effect of PostC may be related to elevation of Bcl-2 24 h after reperfusion which is regulated by the JAK2-STAT3 pathway. PI3K/Akt path- way, regulated by JAK2 signaling, may be necessary in the protection of PostC. Previous studies have shown that oxidative stress, Ca 2+ overload, pH paradox and inflammation during early reperfusion are the major mediators of lethal injury which indicates that this period is important in the pathogenesis of reperfusion injury [11]. Zhao et al. recently found that infarction size increases significant ly between 6 h and 24 h after reperfusion in a canine model. In agreement with this, the present study also Figure 2 Myocardial infarction size at 2 and 24 hours after reperfusion (n = 8 at each time point). Myocardial infarction size was detected using TTC staining. Myocardial infarction area was increased between 2 and 24 hours after reperfusion in all intervention groups. PostC significantly reduced myocardial infarction size after reperfusion. Both AG490 (a selective JAK2 inhibitor) and Wortmannin (a selective PI3K inhibitor) abolished cardioprotection of PostC. *p < 0.05 compared with I/R-2 h and I/R- 24 h groups respectively; #p < 0.05 compared with I/R-2 h, PostC-2 h, PostC+AG490-2 h and PostC+wort-2 h groups respectively. IS = Infarction size, LV = Left ventricle, AAR = Area at risk. Tian et al. Journal of Biomedical Science 2011, 18:53 http://www.jbiomedsci.com/content/18/1/53 Page 4 of 8 found that myocardial apoptosis increases after pro- longed reperfusion in rat hearts. Myocardial reperfusi on injury may increase with the duration of reperfusion. However, Argaud et al. found that myocardial infarction size had no difference between 4 h and 72 h after reper- fusion in rabbit hearts. The difference in animal species and the procedures to induce ischemia/reperfusion injury are considered to be the reasons for these differ- ent results [2,12,13]. PostC was first described by Johansen’ s group in 2003 [14]. After that, the ability of PostC to protect myocar- dium from I/R injury has been confirmed by several stu- dies and in multiple species. PostC not only reduces infarction size but also limits apoptosis after reperfusion. Recent studies reported that PostC affords persistent infarction size reduction after prolonged reperfusion in both canine m odels and humans [2,3]. But they did not distinguish whether this long-term cardioprotection was a continued effect of the early phase or an independent effect. The present results suggestedthatPostCcould limit myocardial apoptosis after reperfusion. Bcl-2 levels were significantly up-regulated by PostC. Interestingly, there was an increase in Bcl-2 levels between 2 and 24 hours after reperfusion i n PostC groups. This indica ted that PostC may reduce myocardial apoptosis during pro- longed reperfusion via up-regulated anti-apoptotic fac- tors such as Bcl-2. Further study focus on other apoptosis-associated proteins such as Bcl-x, BAD and BAX may be helpful to define the long-term benefit of PostC. Figure 3 Myocardial apoptosis at 2 and 24 hours after reperfusion (n = 8 at each time point). Myocardial apoptosis was detected by TUNEL staining. TUNEL-positive cells (black staining) increased during prolonged reperfusion. PostC significantly reduced myocardial apoptosisat both 2 and 24 hours after reperfusion. AG490 and Wortmannin attenuated the anti-apoptotic effects of PostC. *p < 0.05 compared with I/R-2 h and I/R-24 h groups respectively; #p < 0.05 compared with I/R-2 h, PostC-2 h, PostC+AG490-2 h and PostC+wort-2 h groups respectively; &p < 0.05 compared with PostC-2 h and PostC-24 h respectively. Tian et al. Journal of Biomedical Science 2011, 18:53 http://www.jbiomedsci.com/content/18/1/53 Page 5 of 8 The anti-apoptotic effects of the JAK2-STAT3 signal- ing pathway have been shown by several studies in tumors. Several apoptosis-related protein genes, such as Bcl-2 and Bcl-xl, have been identified as target genes of STAT3 [15,16]. Many studies have demonstrated that ischemic preconditioning upregulates COX-2 and iNOS at 24 hours after intervention, which is dependent on transcriptional regulation by the JAK-STAT pathway [17,18]. The present results showed that PostC signifi- cantly activated STAT3 after reperfusion and AG490 attenuated the anti-apopto tic effect of PostC. Elevation of Bcl-2 after reperfusion required STAT3 activation which indicated that PostC may afford a persistent anti- apoptotic effect via a JAK2-STAT3-Bcl-2 pathway. Activation of the PI3K/Akt pathway prevents cardiac myocyte apoptosis and protects the myocardium from I/ R injury. Furthermore, as the major component of the RISK (Reperfusion Injury Salvage Kinase) pa thway, the PI3K/Akt pathway has been shown to play a crucial role in PostC [19-21]. Goodman et al.demonstratedthat JAK-STAT signaling may provide upstream initiat ion of RISK pathway signaling via PI3K-Akt activation, and JAK-STAT signaling is insufficient on its own to provide cardioprotection following PostC without s ubsequent RISK activation [7]. In accordance with this, the present study showed that JAK2 signaling regulated the activa- tion of the PI3K/Akt pathway in PostC. Blocking the PI3K/Akt pathway attenuated the cardioprotection of Figure 4 Protein levels myocardial Bcl-2 at 2 and 24 hours after reper fusi on (n = 8 at each time point). Bcl-2 levels were detected by immunohistochemical staining. PostC elevated Bcl-2 expression in myocardial (brown staining) at both 2 and 24 hours after reperfusion. AG490 abrogated the up-regulation of Bcl-2 levels by PostC. Wortmannin had no effects on Bcl-2 levels. *p < 0.05 compared with I/R-2 h and I/R-24 h groups respectively; #p < 0.05 compared with PostC-2 h and PostC+wort-2 h groups respectively; $p < 0.05 compared with PostC-2 h and PostC-24 h groups respectively. Tian et al. Journal of Biomedical Science 2011, 18:53 http://www.jbiomedsci.com/content/18/1/53 Page 6 of 8 PostC at all time point s. However, wortmannin had no effect on Bcl-2 levels after PostC. The possible explan a- tion of these results is that activation of JAK2-STAT3- Bcl-2 pathway alone may be not sufficient to limit apop- tosis without activation of PI3K/Akt pathway. Conclusions In conclusion, the present study demonstrated that PostC may reduce myocardial apoptosis during pro- longed reperfusion via a JAK2-STAT3-Bcl-2 pathway. As a downstream target of JAK2 signaling, the activation of PI3K/Akt pathway may be necessary in the protection of PostC. Time-course experiments in further study may be helpful to demonstrate precise roles of the pathways in prolonged protection of PostC. However, our results indicated that the protective effect of PostC is not enough to prevent myocardial apoptosis during pro- longed reperfusion. Combin ation therapy targeting apoptosis during prolonged reperfusion may provide more effective protection. Acknowledgements Funding: This study was supported by National Natural Science Foundation of China (81041042), Tianjin Research Key Program of Application Foundation and Advanced Technology (10JCZDJC19200), Tianjin, P. R. China and Science Foundation of Tianjin Medical University (2009KY30). Author details 1 Department of Cardiovascular Surgery, Tianjin Medical University General Hospital, Tianjin, P. R. China. 2 Department of Cardiology, Tianjin Medical University General Hospital, Tianjin, P. R. China. 3 Department of Cardiac Surgery, Liverpool Heart and Chest Hospital, Liverpool, UK. Authors’ contributions YT participated in the design of the study and drafted the manuscript, carried out the surgery of animals. WZ carried out the TTC staining, TUNEL Figure 5 mRNA levels of Bcl-2 at 2 and 24 hours after reperfusion (n = 8 at each group). mRNA levels of Bcl-2 were analysis by qRT-PCR. PostC increased Bcl-2 level after reperfusion. AG490 abrogated the up-regulation of Bcl-2 levels by PostC. Wortmannin had no effects on Bcl-2 levels. *p < 0.05 compared with I/R-2 h and I/R-24 h groups respectively. #p < 0.05 compared with PostC groups. Figure 6 Levels of p-STAT3 at 10 minutes after reperfusion (n = 8 each group). p-STAT3 levels were analyzed by western blot. PostC activated JAK2-STAT3 pathway. (A), JAK2 inhibitor AG490 reduced p-STAT3 levels after PostC. (B), PI3K inhibitor wortmannin had no effects on p-STAT3 levels. *p < 0.05 compared with I/R and PostC+AG490 groups. #p < 0.05 compared with I/R group. Figure 7 Levels of p-Akt at 10 minutes after reperfusion (n = 8 each group). p-Akt levels were analyzed by western blot. PostC activated PI3K/Akt pathway. (A), PI3K inhibitor wortmannin reduced p-Akt levels after PostC. (B), JAK2 inhibitor AG490 reduced p-Akt levels after PostC. *p < 0.05 compared with I/R and PostC+Drug groups respectively. Tian et al. Journal of Biomedical Science 2011, 18:53 http://www.jbiomedsci.com/content/18/1/53 Page 7 of 8 staining and Immunohistochemistry, participated in the sequence alignment. DX carried out the Western-blot and qRT-PCR. PM did the language check of the manuscript. DL performed the statistical analysis. MW conceived of the study, and participated in its design and coordination. All authors read and approved the final manuscript. Competing interests The author declares that they have no competing interests. Received: 16 March 2011 Accepted: 2 August 2011 Published: 2 August 2011 References 1. Penna C, Mancardi D, Raimondo S, Geuna S, Pagliaro P: The paradigm of postconditioning to protect the heart. J Cell Mol Med 2008, 12:435-458. 2. Mykytenko J, Kerendi F, Reeves JG, Kin H, Zatta AJ, Jiang R, Guyton RA, Vinten-Johansen J, Zhao ZQ: Long-term inhibition of myocardial infarction by postconditioning during reperfusion. Basic Res Cardiol 2007, 102:90-100. 3. Thibault H, Piot C, Staat P, Bontemps L, Sportouch C, Rioufol G, Cung TT, Bonnefoy E, Angoulvant D, Aupetit JF, Finet G, André-Fouët X, Macia JC, Raczka F, Rossi R, Itti R, Kirkorian G, Derumeaux G, Ovize M: Long-Term Benefit of Postconditioning. Circulation 2008, 117:1037-1044. 4. Kin H, Wang NP, Mykytenko J, Reeves J, Deneve J, Jiang R, Zatta AJ, Guyton RA, Vinten-Johansen J, Zhao ZQ: Inhibition of myocardial apoptosis by postconditioning is associated with attenuation of oxidative stress-mediated nuclear factor-kappa B translocation and TNF alpha release. Shock 2008, 29:761-768. 5. Sun HY, Wang NP, Halkos M, Kerendi F, Kin H, Guyton RA, Vinten- Johansen J, Zhao ZQ: Postconditioning attenuates cardiomyocyte apoptosis via inhibition of JNK and p38 mitogen-activated protein kinase signaling pathways. Apoptosis 2006, 11:1583-1593. 6. Barry SP, Townsend PA, Latchman DS, Stephanou A: Role of the JAK-STAT pathway in myocardial injury. Trends Mol Med 2007, 13:82-89. 7. Goodman MD, Koch SE, Fuller-Bicer GA, Butler KL: Regulating RISK: a role for JAK-STAT signaling in postconditioning. Am J Physiol Heart Circ Physiol 2008, 295:H1649-1656. 8. Lacerda L, Somers S, Opie LH, Lecour S: Ischaemic postconditioning protects against reperfusion injury via the SAFE pathway. Cardiovasc Res 2009, 84:201-208. 9. Gross ER, Hsu AK, Gross GJ: The JAK/STAT pathway is essential for opioid- induced cardioprotection: JAK2 as a mediator of STAT3, Akt, and GSK-3 beta. Am J Physiol Heart Circ Physiol 2006, 291(2):H827-34. 10. Ruixing Y, Dezhai Y, Hai W, Kai H, Xianghong W, Yuming C: Intramyocardial injection of vascular endothelial growth factor gene improves cardiac performance and inhibits cardiomyocyte apoptosis. Eur J Heart Fail 2007, 9:343-351. 11. Yellon DM, Hausenloy DJ: Myocardial Reperfusion Injury. N Engl J Med 2007, 357:1121-1135. 12. Argaud L, Gateau-Roesch O, Raisky O, Loufouat J, Robert D, Ovize M: Postconditioning Inhibits Mitochondrial Permeability Transition. Circulation 2005, 111:194-197. 13. Zhao ZQ, Nakamura M, Wang NP, Velez DA, Hewan-Lowe KO, Guyton RA, Vinten-Johansen J: Dynamic Progression of Contractile and Endothelial Dysfunction and Infarct Extension in the Late Phase of Reperfusion. J Surg Res 2000, 94:133-144. 14. Zhao ZQ, Corvera JS, Halkos ME, Kerendi F, Wang NP, Guyton RA, Vinten- Johansen J: Inhibition of myocardial injury by ischemic postconditioning during reperfusion: comparison with ischemic preconditioning. Am J Physiol Heart Circ Physiol 2003, 285:579-588. 15. Shyu WC, Lin SZ, Chiang MF, Chen DC, Su CY, Wang HJ, Liu RS, Tsai CH, Li H: Secretoneurin promotes neuroprotection and neuronal plasticity via the Jak2/Stat3 pathway in murine models of stroke. J Clin Invest 2008, 118:133-148. 16. Siddiquee K, Zhang S, Guida WC, Blaskovich MA, Greedy B, Lawrence HR, Yip ML, Jove R, McLaughlin MM, Lawrence NJ, Sebti SM, Turkson J: Selective chemical probe inhibitor of Stat3, identified through structure- based virtual screening, induces antitumor activity. Proc Natl Acad Sci USA 2007, 104:7391-7396. 17. Dawn B, Xuan YT, Guo Y, Rezazadeh A, Stein AB, Hunt G, Wu WJ, Tan W, Bolli R: IL-6 plays an obligatory role in late preconditioning via JAK-STAT signaling and upregulation of iNOS and COX-2. Cardiovasc Res 2004, 64:61-71. 18. Xuan YT, Guo Y, Zhu Y, Wang OL, Rokosh G, Messing RO, Bolli R: Role of the protein kinase C-epsilon-Raf-1-MEK-1/2-p44/42 MAPK signaling cascade in the activation of signal transducers and activators of transcription 1 and 3 and induction of cyclooxygenase-2 after ischemic preconditioning. Circulation 2005, 112:1971-1978. 19. Hausenloy DJ, Tsang A, Yellon DM: The Reperfusion Injury Salvage Kinase Pathway: A Common Target for Both Ischemic Preconditioning and Postconditioning. Trends Cardiovasc Med 2005, 15:69-75. 20. Jin YC, Lee YS, Kim YM, Seo HG, Lee JH, Kim HJ, Yun-Choi HS, Chang KC: (S)-1-(alpha-naphthylmethyl)-6,7-dihydroxy-1,2,3,4-tetrahydroisoquinoline (CKD712) reduces rat myocardial apoptosis against ischemia and reperfusion injury by activation of phosphatidylinositol 3-kinase/Akt signaling and anti-inflammatory action in vivo. J Pharmacol Exp Ther 2009, 330:440-448. 21. Takahama H, Minamino T, Hirata A, Ogai A, Asanuma H, Fujita M, Wakeno M, Tsukamoto O, Okada K, Komamura K, Takashima S, Shinozaki Y, Mori H, Mochizuki N, Kitakaze M: Granulocyte Colony-Stimulating Factor Mediates Cardioprotection Against Ischemia/Reperfusion Injury via Phosphatidylinositol-3-Kinase/Akt Pathway in Canine Hearts. Cardiovasc Drugs Ther 2006, 20:159-165. doi:10.1186/1423-0127-18-53 Cite this article as: Tian et al.: Postconditioning inhibits myocardial apoptosis during prolonged reperfusion via a JAK2-STAT3-Bcl-2 pathway. Journal of Biomedical Science 2011 18:53. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit Tian et al. Journal of Biomedical Science 2011, 18:53 http://www.jbiomedsci.com/content/18/1/53 Page 8 of 8 . indicated that PostC may afford a persistent anti- apoptotic effect via a JAK2-STAT3-Bcl-2 pathway. Activation of the PI3K/Akt pathway prevents cardiac myocyte apoptosis and protects the myocardium. Takahama H, Minamino T, Hirata A, Ogai A, Asanuma H, Fujita M, Wakeno M, Tsukamoto O, Okada K, Komamura K, Takashima S, Shinozaki Y, Mori H, Mochizuki N, Kitakaze M: Granulocyte Colony-Stimulating. study demonstrated that PostC may reduce myocardial apoptosis during pro- longed reperfusion via a JAK2-STAT3-Bcl-2 pathway. As a downstream target of JAK2 signaling, the activation of PI3K/Akt