Role of One N-linked Oligosaccharide Chain on Canine Herpesvirus gD in Its Biological Activity Ken MAEDA, Naoaki YOKOYAMA 1) , Kentaro FUJITA 1) , Xuenan XUAN 2) , and Takeshi MIKAMI 1) * Department of Veterinary Microbiology, Faculty of Agriculture, Yamaguchi University, 1677–1 Yoshida, Yamaguchi 753, 1) Department of Veterinary Microbiology, Faculty of Agriculture, The University of Tokyo, 1–1–1 Yayoi, Bunkyo-ku, Tokyo 113, and 2) Research Center for Protozoan Molecular Immunology, Obihiro University of Agriculture and Veterinary Medicine, Inada-cho, Obihiro, Hokkaido 080, Japan (Received 4 June 1997/Accepted 7 August 1997) ABSTRACT. The YP11mu strain of a plaque-selected canine herpesvirus (CHV) encoded a smaller molecular weight (MW) of gD than those of other strains including YP2 strain (Xuan et al., 1990). When nucleotide sequence of the mutated gD of YP11mu strain (gD(YP11mu)) was compared with that of gDs of other CHV strains, gD(YP11mu) lacked 12 nucleotides encoding 4 amino acids, NKTI, including one predicted potential N-linked glycosylation site and no other change was found in other regions. When the gD(YP11mu) and gD of YP2 strain (gD(YP2)) expressed in COS-7 and insect (Spodoptera frugiperda; Sf9) cells were compared each other, both gDs reacted with a panel of monoclonal antibodies (MAbs) against CHV gD by indirect immunofluorescence analysis and the gD(YP11mu) possessed an MW of approximately 47–51 and 39–44 kDa in COS-7 and Sf9 cells, respectively, which were smaller than the expressed gD(YP2) (approximately 51–55 and 41–46 kDa, respectively) by immunoblot analysis. After treatment with tunicamycin, the MW of both gDs in Sf9 cells became approximately 37 kDa. When hemagglutination (HA) test using canine red blood cells (RBC) were carried out, lysates of Sf9 cells expressing CHV gDs agglutinated canine RBC. Serum from mice inoculated with lysates of Sf9 cells expressing the gDs possessed a high titer of virus-neutralizing (VN) activities against CHV. These results indicated that the deletion of 4 amino acids possessing approximately 4 kDa of glyco-chain from gD of CHV in mammalian cells does not affect HA activity and VN antibody- inducing activity and that this deletion of gD(YP11mu) might be a good selective marker for development of recombinant viruses as a live vaccine. — KEY WORDS: canine herpesvirus, glycoprotein D, hemagglutinin, N-glycosylation site, YP11mu strain. J. Vet. Med. Sci. 59(12): 1123–1128, 1997 in the virus penetration process remains to be further analyzed. Xuan et al. [25] reported that one plaque-selected CHV, YP11mu strain, possessed a smaller molecular weight (MW) of gD than those of other strains including YP2 strain. However its HA activity and reactivity with antibodies against CHV were similar to those of other strains. Therefore, it seems that mutation in the gD of YP11mu strain does not affect biological activities of the gD. By genetical analysis of this mutation, it is expected to obtain further information on functional region of gD. In this communication, we identified the mutated region on the gD of YP11mu strain and expressed the gD in COS- 7 and insect (Spodoptera frugiperda; Sf9) cells. The CHV gD expressed in COS-7 cells specifically adsorbed canine RBC and extracts of CHV gD expressed in Sf9 cells agglutinated canine RBC. Further, antibodies raised in mice immunized with recombinant CHV gDs neutralized CHV infection in vitro. MATERIALS AND METHODS Viruses and cells: Three isolates from our laboratory, YP2, YP11, and the plaque-selected YP11 (YP11mu) [25], two isolates from other laboratories, GCH-1 and Pirene [29], and two reference strains, F-205V and Glasgow CHV2 of CHV were used in this study. All CHV strains were grown in Madin-Darby canine kidney (MDCK) cells for extraction *CORRESPONDENCE TO: Dr. MIKAMI, T., Department of Veterinary Microbiology, Faculty of Agriculture, The University of Tokyo, 1–1–1 Yayoi, Bunkyo-ku, Tokyo 113, Japan. We reported previously that canine herpesvirus (CHV) gD agglutinated canine red blood cells (RBC) and that this hemagglutination (HA) activity was inhibited by monoclonal antibodies (MAbs) against CHV gD [16, 24, 25]. Similarly, we reported that gD of feline herpesvirus type 1 (FHV-1) agglutinated feline RBC and cells expressing the gD adsorbed the RBC [13, 14]. Further, insect cells expressing FHV-1 gD on their cell surface were adhered to several cell lines originating from Felidae but not those from other animals [15]. Therefore, we speculated that the FHV-1 gD might restrict receptor(s) of cells from Felidae. One MAb 25C9 against FHV-1 gD recognized CHV gD by indirect immunofluorescence assay (IFA) and immunoblot analysis, and inhibited HA activity of CHV [12]. CHV gD agglutinates only canine RBC [16, 19, 24] while FHV-1 agglutinates only feline RBC [4, 13, 14, 18]. The reason of these different HA activities has never been studied. In herpes simplex virus (HSV), gD seems to have specific receptors on the surface of cells [8, 9]. In particular, Brunetti et al. reported that gD binds to mannose-6- phosphate receptors [2] and that this interaction is important for virus entry into cells and cell-to-cell transmission [1]. The gDs of alphaherpesviruses are also important for virus penetration to cells [3, 7, 10, 20]. However, the role of gD 1124 K. MAEDA, ET AL. of viral DNA as described previously [16]. COS-7 cells were cultured in DMEM supplemented with 10% FCS and antibiotics. Recombinant Autographa californica nuclear polyhedrosis viruses (rAcNPVs) were grown in Sf9 cells in TC100 medium (GIBCO, Grand Island, N. Y.) supplemented with 10% FCS, 0.3% tryptose phosphate broth (Difco, Detroit, Mich.), and antibiotics. Two rAcNPVs, AccgD (YP2) which expressed CHV gD of YP2 strain in insect cells and AcYM [16], were used. Construction of plasmids: Using two primers, 5’- GGGAATTCATGATTAAACTTCTATTTAT-3’ (CGD-UP) and 5’-TTCTCGAGCTAAACATTTGTTGTTAATT-3' (CGD-DOWN), the gene encoding CHV gD YP11mu was ampilified, digested with restriction enzymes EcoRI and XhoI, and then cloned into EcoRI and XhoI sites of pBluescript KS-, and designated as pBS-cgD (YP11mu) [16]. For expression in COS-7 and Sf9 cells, plasmids pME- cgD (YP11mu) and pAccgD (YP11mu), respectively, were also constructed from pBS-cgD (YP11mu) into pME18S [23] and pAcYM1 [17], respectively, as described previously [15]. As a control, two expression plasmids, pME-cgD (YP2) which expressed CHV gD (YP2) in COS-7 cells [16] and pME-fgD which expressed FHV-1 gD in COS-7 cells [13], were used. DNA sequencing: To identify the mutated nucleotide sequences of CHV gD (YP11mu), DNA sequencing of pBS- cgD (YP11mu) was done with a model 370A Applied Biosystems autosequencer, as described previously [16]. Polymerase chain reaction (PCR) amplification: To clarify the deletion of YP11mu, two primers, 5’- TTACCATCGAGGCCACATAT-3’ (CGD790F) and 5’-GGTGTTGGGGTAGTAGTATC-3’ (CGD902R), were prepared. The viral DNAs of all CHV strains used were amplified by 30 cycles of denaturation (94°C, 1 min), annealing (60°C, 1 min), and polymerization (72°C, 2 min). The amplified fragments were subjected to electrophoresis on 12% polyacrylamide gel. Expression in COS-7 cells: COS-7 cells were transfected with the constructed plasmids according to the methods described previously [21] with minor modifications. Briefly, when COS-7 cells were grown in a 100 mm dish, 7.5 µ g of plasmid DNA prepared in 5 ml of DMEM/DEAE-dextran solution was added to the cells. After incubation for 3 hr at 37°C, the solution was removed. The cells were treated with 5 ml of 10% dimethyl sulfoxide for 1 min and returned to DMEM containing 10% FCS. After 72 hr post- transfection, the transfected cells were scraped off the plates and analyzed by IFA, immunoblot analysis, and hemadsorption (HAD) test. Transfection and selection of recombinant baculovirus: Sf9 cells were co-transfected with linealized BaculoGold TM baculovirus (AcNPV) DNA (PharMingen, San Diego, CA) and pAccgD (YP11mu) by use of Lipofectin reagent (GIBCO BRL, Gaithersburg, MD). After three cycles of plaque purification, the recombinant virus was isolated, and was designated as AccgD (YP11mu). MAbs: MAbs 11F7, 09D1, 10C10, and 05B7 against CHV gD and an MAb 25C9 against FHV-1 gD were previously produced and characterized [5, 12, 25, 26]. IFA: For detection of CHV gD in IFA, transfected cells were smeared on glass slides, air-dried and then fixed with acetone. The fixed cells were incubated for 30 min at 37°C with MAbs against CHV gD or FHV-1 gD. After incubation, the slides were washed 3 times with PBS, and then anti-mouse immunoglobulins (G+M+A) rabbit antibody conjugated with fluorescein isothiocyanate (FITC) (Cappel, PA, U.S.A.) was applied. After incubation for 30 min at 37°C, the slides were washed again, mounted in buffered glycerol, and examined by fluorescence microscopy. For membrane immunofluorescence, transfected cells were suspended in ice-cold PBS containing 3% FCS and 0.1% sodium azide, and then reacted with MAbs for 30 min at 4°C. After washing three times by ice-cold PBS containing 3% FCS and 0.1% sodium azide, FITC- conjugated anti-mouse immunoglobulins were added and the cells were reincubated at 4°C. After further washings for three times, the cells were resuspended in glycerol and mounted for immunofluorescence microscopy. Immunoblot analysis: SDS-polyacrylamide gel electrophoresis (PAGE) was carried out according to the discontinuous Laemmli buffer system [12]. All samples were dissolved in the buffer (62.5 mM Tris-HCl, pH 6.8, 20% glycerol, and 0.001% bromophenol blue), and then disrupted by heating for 2 min at 100°C. Polypeptides were separated on an SDS-polyacrylamide gel and electrophoretically transferred to polyvinylidene difluoride membrane (Immunobilon, Millipore, MA, U.S.A.). The blotting papers were incubated for 30 min at 37°C with a mixture of four MAbs, 11F7, 09D1, 10C10, and 05B7, against CHV gD, or an MAb 10C10. Afterwards, they were washed three times, and incubated with anti-mouse immunoglobulins (G+M+A) peroxidase conjugate (Cappel, PA, U.S.A.) for 30 min at 37°C. The reaction was visualized by addition of a diaminobenzidine-hydrogen peroxidase substrate. HAD and HA tests: HAD and HA activities of expressed CHV gDs were tested as described previously [16]. Immunization of mice: Sf9 cells were infected with AccgD (YP11mu), AccgD (YP2), or AcYM at 10 PFU/cell for 96 hr, washed, suspended in PBS and subjected to three cycles of freezing and thawing. Lysates prepared from each of the infected Sf9 cells (1 × 10 6 ) cells were separately injected into a mouse (Balb/c, 8 weeks old) intraperitoneally in Freund’s complete adjuvant. The same lysate in Freund’s incomplete adjuvant was injected intraperitoneally into the mouse on days 14 and 28. Sera from immunized mice were collected 14 days after the last immunization. VN assay: Virus neutralizing activity of antisera was tested in a 50% plaque reduction assay performed on MDCK cells with or without 5% rabbit serum as a source of complement. Neutralizing titers against CHV YP11mu strain were expressed as the reciprocal antibody dilution giving 50% plaque reduction. 1125 ROLE OF ONE N-LINKED OLIGOSACCHARIDE CHAIN ON CHV GD RESULTS Cloning and sequence analysis of the gene encoding CHV gD (YP11mu): Approximately 1.05 kbp fragment containing an open reading frame (ORF) encoding gD (YP11mu) was amplified from viral DNA by PCR method using two primers, CGD-UP and CGD-DOWN. This amplified fragment was inserted into pBluescript KS- and was designated as pBS-cgD (YP11mu). Nucleotide sequence of the insert fragment of pBS-cgD (YP11mu) was determined and compared with that of 1,050 bp published for CHV gD [11]. The result showed that the nucleotide sequence for the ORF of gD (YP11mu) was 1038 bp and lacked 12 nucleotides, AATAAAACTATT (position at 823–834 nucleotides), which encodes four amino acids, NKTI (position at 275–278 amino acids) (Fig. 1A). No other change was found in the ORF of gD (YP11mu). Further PCR analysis was carried out to confirm the deletion using two primers, CGD790F and CGD902R. The 113 bp fragment amplified by these primers contains the region of mutation of gD (YP11mu). Figure 1B showed that the amplified fragment of only YP11mu strain was 101 bp and was smaller than those (113 bp) of other six CHV strains. These results indicate that this 12 bp deletion was specific for YP11mu strain. Expression of CHV gDs in COS-7 cells: Expression of CHV gD (YP11mu) in COS-7 cells was examined by IFA using MAbs. All of the MAbs against CHV gD and one MAb 25C9 against FHV-1 gD reacted with pME-cgD (YP11mu)-transfected COS-7 cells as well as with pME- cgD (YP2)-transfected COS-7 cells (data not shown). Expression of CHV gD (YP11mu) in COS-7 cells was further confirmed by immunoblot analysis using a mixture of four MAbs, 11F7, 09D1, 10C10, and 05B7 against CHV gD (Fig.2A). The MW of the authentic CHV gD (YP11mu) was approximately 47–51 kDa with a minor band of approximately 44 kDa which seems to be a precursor form of the CHV gD. These bands were smaller than those (approximately 51–55 and 48 kDa) of pME-cgD (YP2)- transfected COS-7 cells. In pME-fgD-transfected cells, any specific band was not detected (Fig. 2A lane3). Expression of CHV gDs in insect cells: Expression of CHV gD (YP11mu) in Sf9 cells was examined by IFA using MAbs. All of the MAbs against CHV gD and one MAb 25C9 against FHV-1 gD reacted with AccgD (YP11mu)- infected Sf9 cells as well as with AccgD (YP2)-infected Sf9 cells (data not shown). Expression of CHV gD (YP11mu) was confirmed by immunoblot analysis using an MAb 10C10 against CHV gD (Fig. 2B). The MAb 10C10 detected a specific band of 39–44 and 41–46 kDa in AccgD (YP11mu)- and AccgD (YP2)-infected Sf9 cells, respectively (Fig. 2A). When AccgD (YP11mu)- and AccgD (YP2)-infected Sf9 cells were treated with 10 µ g/ml of tunicamycin (TM), the both MWs of the TM-treated gD (YP11mu) and gD (YP2) were approximately 37 kDa (Fig. 2B lanes 3 and 4). Since CHV gD consists of 345 amino acid residues with a predicted MW of approximately 38 kDa [10], the estimated MW of the TM-treated gDs seems to be reasonable. HAD and HA tests: We examined whether cells expressed CHV gD (YP11mu) could adsorb canine red blood cells (RBC) and whether the expressed CHV gD (YP11mu) could Fig. 1. Differences in the nucleotide and amino acid sequences of gDs among CHV strains. (A) Nucleotide sequence of heterogeneous region between CHV YP2 and YP11mu strains. Double dots show identical nucleotide sequence. Bars show gaps. NKT showed by a box indicates potential asparagine-linked glycosylation site. Two primers, CGD790F and antisense of CGD902R are boxed. (B) Amplification of the heterogeneous region in several CHV strains. Arrows show length of fragments. 1126 K. MAEDA, ET AL. agglutinate canine RBC. The transfected cells were used for HAD test using canine RBC. It was shown that both pME-cgD (YP11mu)- and pME-cgD (YP2)-transfected COS-7 cells adsorbed canine RBC. These HAD reactions were inhibited by treatment of the cells with HI MAbs against CHV gD (data not shown). Extracts of Sf9 cells infected with recombinant baculoviruses were used for HA test using canine RBC. The results showed that extracts of Sf9 cells infected with AccgD (YP11mu) or AccgD (YP2) agglutinated canine RBC. In addition, these HA activities were inhibited by HI MAbs against CHV gD (data not shown). Immunogenicity of the gD expressed in Sf9 cells against mice: Mice were inoculated three times with AccgD (YP11mu)-, AccgD (YP2)- or AcYM-infected Sf9 cell lysate. As shown in Table 1, pooled serum from mice immunized with lysates from Sf9 cells (1 × 10 6 ) infected with AccgD (YP11mu) or AccgD (YP2) possessed high titers of VN activity. No VN activity was detected in serum from mice immunized with AcYM-infected Sf9 cells. DISCUSSION Sequence analysis showed that twelve nucleotides, AATAAAACTATT, were deleted in the gene of gD (YP11mu) (Fig. 1A). In addition, two repeat sequences, ACTATTAATAAAACTATTAA, flanking this mutated region, existed in the gD gene of YP2 strain and other strains including the parent strain of YP11mu strain (Fig. 1B). Therefore, this mutation of gD (YP11mu) might be accidentally caused by flanking within these repeat sequences, because this YP11mu strain was highly passaged in vitro and then plaque-purified. The gD gene of YP11mu strain lacked twelve nucleotides sequence encoding four amino acids, NKTI, which possessed a calculated MW of 474 daltons (Fig. 1A), but this deletion of 4 amino acids sequence caused reduction of MWs of approximately 4 kDa in mammalian cells and approximately 2 kDa in insect cells (Fig. 2), indicating that this amino acid sequence, NKT, is a N-linked glycosylation site [6] which possessed approximately 4 kDa of glyco- chain in mammalian cells and approximately 2 kDa of glyco-chain in insect cells. Mice immunized with gD (YP11mu) or gD (YP2) produced a high titer of complement-dependent and complement-independent VN antibodies (Table 1), indicating that this deletion region in CHV gD (YP11mu) might not affect complement-dependent and complement-independent VN antibodies-inducing activities. These results showed that this deleted glycosylation site in the gD (YP11mu) does not affect HAD activity, HA activity and immunogenicity. Xuan et al. [25] reported that both YP2 and YP11mu strains grew well in MDCK cells, and that HA activity of lysates from YP11mu strain-infected cells were similar to those of other several CHV strains including YP2 strain. In gDs of HSV-1 and BHV-1, N-linked oligosaccharides are not essential for viral pathogenesis in the mouse model, and the antigenic properties are not altered by carbohydrate removal [22, 28]. These reports support our observation that deletion of N- linked glycosylation in gD (YP11mu) does not affect biological activities of CHV gD. Although the role of other two potential N-linked glycosylation sites of CHV gD remains to be further analyzed, CHV gDs expressed in insect cells possessed HA, HAD and VN antibody-inducing activities in spite of immature glycosylation, indicating that glycosylation of CHV gDs might not affect these biological activities. In conclusion, we identified one N-linked glycosylation site which does not affect HA and HAD activities and immunogenicity of CHV gD. Further analysis of essential Table 1. Immunogenic properties of recombinant gDs Serum against VN titer a) w/o C’ w C’ AccgD (YP11mu) 320 1280 AccgD (YP2) 80 2560 AcYM <40 <40 a) Neutralization titer was expressed as the reciprocal of a serum dilution giving a 50% reduction in plaque number compared with the control. w/o C’: without complement. w C’: with complement. Fig. 2. Immunoblot analysis of gDs expressed in COS-7 or Sf9 cells. (A) Immunoblot analysis of gDs expressed in COS-7 cells with a mixture of MAbs against CHV gD. Lane 1; pME-cgD (YP2)-transfected COS-7 cells, lane 2; pME-cgD (YP11mu)-transfected COS-7 cells, and lane 3; pME-fgD-transfected COS-7 cells. (B) Immunoblot analysis of gDs expressed in Sf9 cells with an MAb 10C10 against CHV gD. Lanes 1 and 3; AccgD (YP2)-infected Sf9 cells, and lanes 2 and 4; AccgD (YP11mu)-infected Sf9 cells. Lanes 3 and 4; recombinant baculovirus-infected cells were treated with 10 µ g/ml of tunicamycin. Bars show specific bands. Molecular weight (in kilodaltons) are indicated at the left. 1127 ROLE OF ONE N-LINKED OLIGOSACCHARIDE CHAIN ON CHV GD regions for HA and HAD activities and immunogenicity would be expected to understand the initial stage of herpesvirus infection. In addition, this deletion of gD (YP11mu) might be a good selective marker for development of a live recombinant vaccine. Indeed, Xuan et al. [27] expressed rabies virus glycoprotein using the YP11mu strain as a vector and examined the biological and immunological characteristics of the recombinant virus in vitro and in vivo. ACKNOWLEDGEMENTS. This work was supported in part by grants from the Ministry of Education, Science, Sports and Culture, from the Ministry of Agriculture, Forestry and Fisheries and by Research Aid of Inoue Foundation for Science. REFERENCES 1. Brunetti, C. R., Burke, R. L., Hoflack, B., Ludwig, T., Dingwell, K. S., and Johnson, D. C. 1995. Role of mannose- 6-phosphate receptors in herpes simplex virus entry into cells and cell-to-cell transmission. J. Virol. 69: 3517–3528. 2. Brunetti, C. R., Burke, R. L., Kornfeld, S., Gregory, W., Masiarz, F. R., Dingwell, K. S., and Johnson, D. C. 1994. Herpes simplex virus glycoprotein D acquires mannose 6- phosphate residues and binds to mannose 6-receptors. J. Biol. Chem. 269: 17067–17074. 3. Fuller, A. O. and Spear, P. G. 1987. Anti-glycoprotein D antibodies that permit adsorption but block infection by her- pes simplex virus 1 prevent virion-cell fusion at the cell surface. Proc. Natl. Acad. Sci. U.S.A. 84: 5454–5458. 4. Horimoto, T., Kasaoka, T., Tuchiya, K., and Takahashi, E. 1989. Identification of feline herpesvirus type 1-hemaggluti- nin. Jpn. J. Vet. Sci. 51: 607–612. 5. Horimoto, T., Limcumpao, J. A., Tohya, Y., Takahashi, E., and Mikami, T. 1990. Feline herpesvirus type 1 glycopro- teins eliciting virus neutralizing and hemag glutination-inhibiting antibodies. Arch. Virol. 111: 127–132. 6. Hubbard, S. C. and Ivatt, R. J. 1981. Synthesis and process- ing of asparagine-linked oligosaccharides. Annu. Rev. Biochem. 50: 555–583. 7. Hughes, G., Babiuk, L. A., and van Drunen Little-van den Hurk, S. 1988. Functional and topographical analyses of epitopes on bovine herpesvirus type 1 glycoprotein IV. Arch. Virol. 103: 47–60. 8. Johnson, D. C., Burke, R. L., and Gregory, T. 1990. Soluble forms of herpes simplex virus glycoprotein D bind to a lim- ited number of cell surface receptors and inhibit virus entry into cells. J. Virol. 64: 2569–2576. 9. Johnson, D. C. and Ligas, M. W. 1988. Herpes simplex vi- ruses lacking glycoprotein D are unable to inhibit virus penetration: Quantitative evidence for virus-specific cell sur- face receptors. J. Virol. 63: 4605–4612. 10. Ligas, M. W. and Johnson, D. C. 1988. A herpes simplex virus mutant in which gD sequences are replaced by beta- galactosidase sequences binds to but unable to penetrate into cells. J. Virol. 62: 1486–1494. 11. Limbach, K. J., Limbach, P., Conte, D., and Paoletti, E. 1994. Nucleotide sequence of the genes encoding the canine herp- esvirus gB, gC and gD homologues. J. Gen. Virol. 75: 2029–2039. 12. Limcumpao, J. A., Horimoto, T., Xuan, X., Tohya, Y., Azetaka, M., Takahashi, E., and Mikami, T. 1991. Homolo- gous and heterologous antibody responses of mice immunized with purified feline herpesvirus type 1 and canine herpesvirus glycoproteins. J. Vet. Med. Sci. 53: 423–432. 13. Maeda, K., Kawaguchi, Y., Ono, M., Inoshima, Y., Miyazawa, T., Tohya, Y., Kai, C., and Mikami, T. 1994. A gD homolo- gous gene of feline herpesvirus type 1 encodes a hemagglutinin (gp60). Virology 202: 1034–1038. 14. Maeda, K., Ono, M., Kawaguchi, Y., Niikura, M., Okazaki, K., Yokoyama, N., Tokiyoshi, K., Tohya, Y., and Mikami, T. 1996. Expression and properties of feline herpesvirus type 1 gD (hemagglutinin) by a recombinant baculovirus. Virus Res. 46: 75–80. 15. Maeda, K., Ono, M., Kawaguchi, Y., Okazaki, K., Yokoyama, N., Tokiyoshi, K., Tohya, Y., and Mikami, T. 1997. Adhe- sion of insect cells expressing the feline herpesvirus type 1 hemagglutinin (gD) to feline cell lines. J. Vet. Med. Sci. 59: 217–219. 16. Maeda, K., Xuan, X., Kawaguchi, Y., Ono, M., Yokoyama, N., Fujita, K., Tohya, Y., and Mikami, T. 1997. Characteriza- tion of canine herpesvirus glycoprotein D (hemagglutinin). J. Vet. Med. Sci. 59: 1003–1009. 17. Matsuura, Y., Possee, R. D., Overton, H. A., and Bishop, D. H. L. 1987. Baculovirus expression vectors: the requirements for high-level expression of proteins, including glycoproteins. J. Gen. Virol. 68: 1233–1250. 18. Mochizuki, M., Konishi, S., and Ogata, M. 1977. Studies on cytopathogenic viruses from cats with respiratory infections. III. Isolation and certain properties of feline herpesviruses. Jpn. J. Vet. Sci. 39: 27–37. 19. Nemoto, K., Horimoto, T., Xuan, X., Kusanagi, K., Takumi, A., Tohya, Y., Azetaka, M., Takahashi, E., and Mikami, T. 1990. Demonstration of canine herpesvirus-specific hemag- glutination. Jpn. J. Vet. Sci. 52: 395–398. 20. Okazaki, K., Honda, E., Minetomo, T., and Kumagai, T. 1986. Mechanisms of neutralization by monoclonal antibodies to different antigenic sites on the bovine herpesvirus type 1 glycoproteins. Virology 150: 260–264. 21. Seed, B. and Aruffo, A. 1987. Molecular cloning of the CD2 antigen, the T-cell erythrocyte receptor, by a rapid immunoselection procedure. Proc. Natl. Acad. Sci. U.S.A. 84: 3365–3369. 22. Sodora, D. L., Cohen, G. H., Muggeridge, M. I., and Eisenberg, R. J. 1991. Absence of asparagine-linked oligosac- charides from glycoprotein D of herpes simplex virus type 1 results in a structurally altered but biologically active protein. J. Virol. 65: 4424–4431. 23. Takebe,Y., Seiki, M., Fujisawa, J., Hoy, P., Yokota, K., Arai, K., Yoshida, M., and Arai, N. 1988. SRα promoter: an effi- cient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R- U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol. Cell. Biol. 8: 466–472. 24. Xuan X., Kojima, A., Murata, T., Mikami, T., amd Otsuka, H. 1997. Analysis of canine herpesvirus gB, gC and gD ex- pressed by a recombinant vaccinia virus. Arch. Virol. 142: 1003–1010. 25. Xuan, X., Horimoto, T., Limcumpao, J. A., Nemoto, K., Tohya, Y., Azetaka, M., Takahashi, E., and Mikami, T. 1990. Canine herpesvirus 47 kD and mutated 41 kD glycoproteins are responsible for hemagglutinination. Jpn. J. Vet. Sci. 52: 899–905. 1128 K. MAEDA, ET AL. 26. Xuan, X., Horimoto, T., Limcumpao, J. A., Takumi, A., Tohya, Y., Takahashi, E., and Mikami, T. 1991. Neutralizing deter- minants of canine herpesvirus as defined by monoclonal antibodies. Arch. Virol. 116: 185–195. 27. Xuan, X., Tuchiya, K., Sato I., Nishikawa, Y., Onodera, Y., Takashima, Y., Yamamoto, A., Katsumata, A., Iwata, A., Ueda, S., Mikami, T., and Otsuka, H. 1997. Biological and immunogenic properties of rabies virus glycoprotein expressed by canine herpesvirus vector. Virology (Submitted for publi- cation). 28. van Drunen Little-van den Hurk, S., Hughes, G., and Babiuk, L. A. 1990. The role of carbohydrate in the antigenic and immunogenic structure of bovine herpesvirus type 1 glyco- protein gI and gIV. J. Gen. Virol. 71: 2053–2063. 29. Yanagisawa, T., Azetaka, M., Midoro, K., Takahashi, R., Fujiwara, K., and Sawa, K. 1987. Fatal herpesvirus infection in a litter of puppies. Jpn. J. Vet. Sci. 49: 519–522. . mutation, it is expected to obtain further information on functional region of gD. In this communication, we identified the mutated region on the gD of YP11mu strain and expressed the gD in COS- 7. antibody-inducing activities in spite of immature glycosylation, indicating that glycosylation of CHV gDs might not affect these biological activities. In conclusion, we identified one N-linked. titers against CHV YP11mu strain were expressed as the reciprocal antibody dilution giving 50% plaque reduction. 1125 ROLE OF ONE N-LINKED OLIGOSACCHARIDE CHAIN ON CHV GD RESULTS Cloning and sequence