Biochemistry, 4th Edition P115 doc

Abbreviated Answers to Problems A-43 cally with phosphate groups on the DNA backbone, so these interactions would be diminished through acetylation and methylation. Phosphorylation of Ser residues would lead to electrostatic repulsion between the DNA backbone and the histone tails. Collectively, these modifications weaken histoneϺDNA interactions. 10. Because the lac repressor is tetrameric and each subunit has an inducer-binding site, it seems likely that inducer binding is cooperative. Cooperative binding of inducer would be advan- tageous, because the slope of the lac operon expression versus [inducer] would be steeper over a narrower [inducer] range. 11. Capping of the 5Ј-end and polyadenylation of the 3Ј-end of mRNA protect the RNA from both 5Ј- and 3Ј-exonucleolytic degradation. Methylations at the 5Ј-end enhance the interaction between cap-binding protein eIF4E (see Figure 30.29), thus increasing the likelihood that the mRNA will be translated. Note also in Figure 30.29 that polyadenylylation provides a protein- binding site for proper assembly of the 40S initiation complex essential to translation. 12. In the A Deeper Look box on page 870, the argument is made that polymerases have a common enzymatic mechanism for nucleotide addition to a growing polynucleotide chain based on two metal ions coordinated to the incoming nucleotide. These metal ions interact with two aspartate residues that are highly conserved in both DNA and RNA polymerases. The discovery of a second Mg 2ϩ ion in the RNA polymerase II active site confirms to the universality of this model. 13. 50 bp of DNA is (50)(0.34 nm/bp) ϭ 17 nm. Because 147 bp of DNA make 1.7 turns around the nucleosome (see Chapter 11) ϭ 86.4 bp/turn of DNA, 50 bp ϭ 0.58 turns, or slightly more than ᎏ 1 2 ᎏ turn of DNA around the histone core octamer. Promoter and response modules are about 20 to 25 bp. 14. CH 2 O O PO Ϫ O N N O OOH N N R CH 2 NH 2 O PO Ϫ O N N O OO N N A NH 2 O O POCH 2 N N O OOH N N G Ϫ O O Ϫ POO CH 2 O PO Ϫ O O O O O OH N NH Y PO Ϫ O 15. ␣-Helices composed of 7 to 8 residues would have a length of 1.05 to 1.2 nm. The overall diameter of B-DNA is about 2.4 nm, but the diameter at the bottom of major groove is significantly less (as a reference, the C 1 Ј–C 1 Ј distance between base-paired nucleotides in separate chains is 1.1 nm). A distance along the B-DNA helix axis of 1.1 nm would correspond to about 3 base pairs, so if such an ␣-helix were laid along the major groove, it could not make contacts with more than 3 base pairs (see also Figure 29.32). 16. Phe 644 acts as a wedge to separate the template and nontemplate strands from one another; Phe 644 is located at the end of the Y-helix. 17. ␣-Amanitin binds in the large cleft between the two largest RNA polymerase II subunits, in particular to an ␣-helix, the “bridge” helix, running across this cleft. Its position in the cleft slows inhibits translocation of DNA and RNA and the entry of the next template nucleotide into the active site. 18. The two protein chains in pdb id ϭ 1GU4 are identical through positions 268 (D) to 333 (Q). Leucines are found at positions 297, 304, 306, 313, 320, 324, 327, and 330. Those at positions 306, 313, 320, and 327 are seven residues apart, as in a leucine zipper. Basic residues (K and R) precede these leucines, occur- ring at positions, 268, 275, 277, 280, 286, 287, 289, 291, 293, 295, and 302. A-44 Abbreviated Answers to Problems 19. A protein such as CAP that interacts with phosphate groups in the DNA backbone does so via electrostatic interactions based on positively charged Arg and Lys side chains. 20. Chromatin is decompacted by HATs and chromatin remodeling complexes. Histone acetylation by HATs disrupts chromatin structure (see problem 9) and chromatin remodeling complexes then mediate ATP-dependent conformational changes in the chromatin that peels about 50 bp of DNA from the core octamer, exposing the DNA for access by the transcriptional machinery. Chapter 30 1. The cDNA sequence as presented: CAATACGAAGCAATCCCGCGACTAGACCTTAAC… represents six potential reading frames, the three inherent in the sequence as written and the three implicit in the complementary DNA strand, which is written 5Ј→3Ј, is: …GTTAAGGTCTAGTCGCGGGATTGCTTCGTATTG Two of the three reading frames of the cDNA sequence given contain stop codons. The third reading frame is a so-called open reading frame (a stretch of coding sequence devoid of stop codons): CAA TACGAAGCAATCCCGCGACTAGACCTTAAC… (alternate codons underlined) The amino acid sequence it encodes is: Gln-Tyr-Glu-Ala-Ile-Pro-Arg-Leu-Asp-Leu-Asn…. Two of the three reading frames of the complementary DNA sequence also contain stop codons. The third may be an open reading frame: …GTT AAGGTCTAGTCGCGGGATTGCTTCGTATTG (alternate codons underlined) An unambiguous conclusion about the partial amino acid sequence of this cDNA cannot be reached. 2. A random (AG) copolymer would contain varying amounts of the following codons: AAA AAG AGA GAA AGG GAG GGA GGG codons for Lys Lys Arg Glu Arg Glu Gly Gly, respectively. Therefore, the random (AG) copolymer would direct the synthesis of a polypeptide consisting of Lys, Arg, Glu, and Gly. The relative frequencies of the various codons are a function of the probability that a base will occur in a codon. For example, if the A/G ratio is 5/1, the ratio of AAA/AAG is (5 ϫ 5 ϫ 5)/ (5 ϫ 5 ϫ 1) ϭ 5/1. If the 3A codon is assigned a value of 100, then the 2A1G codon has a frequency of 20. From this analysis, the relative abundances of these amino acids in the polypeptide should be: Lys ϭ 120; Arg ϭ 24; Glu ϭ 24; Gly ϭ 4.8 (Normalized to Lys ϭ 100: Arg ϭ 20; Glu ϭ 20; Gly ϭ 4) 3. Review the information in Section 30.2, noting in particular the two levels of specificity exhibited by aminoacyl-tRNA synthetases (1: at the level at ATP 34 PP i exchange and aminoacyl adenylate synthesis in the presence of amino acid and the absence of tRNA; and 2: at the level of loading the aminoacyl group on an acceptor tRNA). 4. Base pairs are drawn such that the B-DNA major groove is at the top (see following figure). O R N N N N O N N O CUG G R N N N N H N N O R O O N H H O H N N N N N H H H N N H O R R N CG H GU O R N O R R N N N N N N N H H H H R N H H H H 5. The wobble rules state that a first-base anticodon U can recognize either an A or a G in the codon third-base position; first- base anticodon G can recognize either U or C in the codon third-base position; and first-base anticodon I can recognize either U, C, or A in the codon third-base position. Thus, codons with third-base A or G, which are degenerate for a particular amino acid (Table 30.3 reveals that all codons with third-base purines are degenerate, except those for Met and Trp), could be served by single tRNA species with first-base anticodon U. More emphatically, codons with third-base pyrimidines (C or U) are always degenerate and could be served by single tRNA species with first-base anticodon G. Wobble involving first-base anticodon I further minimizes the number of tRNAs needed to translate the 61 sense codons. Wobble tends to accelerate the rate of translation because the noncanonical base pairs formed between bases in the third position of codons and bases occupy- ing the first-base wobble position of anticodons are less stable. As a consequence, the codonϺanticodon interaction is more transient. 6. The stop codons are UAA, UAG, and UGA. Sense codons that are a single-base change from UAA include CAA (Pro), AAA (Lys), GAA (Glu), UUA (Leu), UCA (Ser), UAU (Tyr), and UAC (Tyr). Sense codons that are a single-base change from UAG include CAG (Gln), AAG (Lys), GAG (Glu), UCG (Ser), UUG (Leu), UGG (Trp), UAU (Tyr), and UAC (Tyr). Sense codons that are a single-base change from UGA include CGA (Arg), AGA (Arg), GGA (Gly), UUA (Leu), UCA (Ser), UGU (Cys), UGC (Cys), and UGG (Trp). That is, 19 of the 61 sense codons are just a single base change from a nonsense codon. 7. The list of amino acids in problem 6 is a good place to start in considering the answer to this question. Amino acid codons in which the codon base (the wobble position) is but a single base change from a nonsense codon are the more likely among this list, because pairing is less stringent at this position. These Abbreviated Answers to Problems A-45 include UAU (Tyr) and UAC (Tyr) for nonsense codons UAA and UAG, and UGU (Cys), UGC (Cys), and UGG (Trp) for nonsense codon UGA. 8. The more obvious answer to this question is that eukaryotic ribosomes are larger, more complex, and hence slower than prokaryotic ribosomes. In addition, initiation of translation requires a greater number of initiation factors in eukaryotes than in prokaryotes. It is also worth noting that eukaryotic cells, in contrast to prokaryotic cells, are typically under less selective pressure to multiply rapidly. 9. Each amino acid of a protein in an extended ␤-sheet–like conformation contributes about 0.35 nm to its length. 10 nm Ϭ 0.35 nm per residue ϭ 28.6 amino acids. 10. Larger, more complex ribosomes offer greater advantages in terms of their potential to respond to the input of regulatory in- fluences, to have greater accuracy in translation, and to enter into interactions with subcellular structures. Their larger size may slow the rate of translation, which in some instances may be a disadvantage. 11. The universal organization of ribosomes as two-subunit structures in all cells—archaea, eubacteria, and eukaryotes—suggests that such an organization is fundamental to ribosome function. Translocation along mRNA, aminoacyl-tRNA binding, peptidyl transfer, and deacylated-tRNA release are processes that require repetitious uncoupling of physical interactions between the large and small ribosomal subunits. 12. Prokaryotic cells rely on N-formyl-Met-tRNA i fMet to initiate protein synthesis. The tRNA i fMet molecule has a number of distinctive features, not found in noninitiator tRNAs, that earmark it for its role in translation initiation (see Figure 30.16). Further- more, N-formyl-Met-tRNA i fMet interacts only with initiator codons (AUG or, less commonly, GUG). A second tRNA Met , designated tRNA m Met , serves to deliver methionyl residues as directed by in- ternal AUG codons. Both tRNA i fMet and tRNA m Met are loaded with methionine by the same methionyl-tRNA synthetase, and AUG is the Met codon, both in initiation and elongation. AUG initiation codons are distinctive in that they are situated about 10 nucleotides downstream from the Shine–Dalgarno sequence at the 5Ј-end of mRNAs; this sequence determines the translation start site (see Figure 30.18). Eukaryotic cells also have two tRNA Met species, one of which is a unique tRNA i Met that functions only in translation initiation. Eukaryotic mRNAs lack a counterpart to the prokaryotic Shine–Dalgarno sequence; apparently the eukaryotic small ribosomal subunit binds to the 5Ј-end of a eukaryotic mRNA and scans along it until it encoun- ters an AUG codon. This first AUG codon defines the eukaryotic translation start site. 13. The Shine–Dalgarno sequence is a purine-rich sequence element near the 5Ј-end of prokaryotic mRNAs (see Figure 30.18). It base-pairs with a complementary pyrimidine-rich region near the 3Ј-end of 16S rRNA, the rRNA component of the prokaryotic 30S ribosomal subunit. Base pairing between the Shine–Dalgarno sequence and 16S rRNA brings the translation start site of the mRNA into the P site on the prokaryotic ribosome. Because the nucleotide sequence of the Shine– Dalgarno element varies somewhat from mRNA to mRNA, whereas the pyrimidine-rich Shine–Dalgarno-binding sequence of 16S rRNA is invariant, different mRNAs vary in their affinity for binding to 30S ribosomal subunits. Those that bind with highest affinity are more likely to be translated. 14. The most apt account is b. Polypeptide chains typically contain hundreds of amino acid residues. Such chains, attached as a peptidyl group to a tRNA in the P site, would show significant inertia to movement, compared with an aminoacyl-tRNA in the A site. 15. Elongation factors EF-Tu and EF-Ts interact in a manner analo- gous to the GTP-binding G proteins of signal transduction pathways (see page 467, as well as pages 1024–1028 and Figure 15.19). EF-Tu binds GTP and in the GTP-bound form delivers an aminoacyl-tRNA to the ribosome, whereupon the GTP is hydrolyzed to yield EF-TuϺGDP and P i . EF-Ts mediates an exchange of the bound GDP on EF-TuϺGDP with free GTP, regen- erating EF-TuϺGTP for another cycle of aminoacyl-tRNA delivery. The ␣-subunit of the heterotrimeric GTP-binding G proteins also binds GTP. G ␣ has an intrinsic GTPase activity and the GTP is eventually hydrolyzed to form G ␣ ϺGDP and P i . Guanine nucleotide exchange factors facilitate the exchange of bound GDP on G ␣ for GTP, in analogy with EF-Ts for EF-Tu. The amino acid sequences of EF-Tu and G proteins reveal that they share a common ancestry. 16. Four: two in the aminoacyl-tRNA synthetase reaction; one by EF-Tu; one by EF-G. 17. a. The proteins are shown as ribbons. b. The rRNA is shown as a strand (line). c. The tRNAs (shown with the sugar–phosphate backbone as a strand and the bases as ring structures) are oriented such that their acceptor stems extend away from the 30S subunit, in the direction from which a 50S subunit will add. d. The tRNA acceptor stems will lie within the peptidyl transferase center of the 50S subunit. 18. a. 64,281. b. If you use the cursor to rotate the structure, many bases around the periphery are easy to see (otherwise, the com- plexity of the structure makes it hard to see them). c. Many such regions are easy to find along the structure’s periphery. d. RNA. 19. The Q␤ phage replicase mRNA shows the most consecutive perfect matches (6) complementary to the Shine-Dalgarno sequence. 20. Chloramphenicol consists of an aromatic ring and several polar functions (a nitro group, two OOH groups, and an amine-N). The aromatic ring might intercalate between bases in the 23S rRNA peptidyl transferase site, the polar functions might form H bonds with nitrogenous bases or sugar OOH groups in the rRNA. The ONO 2 group is also rather bulky in addition to being polar, so it could disrupt peptidyl transferase in a number of ways. Chapter 31 1. Human rhodanese has 296 amino acid residues. Its synthesis would require the involvement of 4 ATP equivalents per residue or 1184 ATP equivalents. Folding of rhodanese by the Hsp60 ␣ 14 complex consumes another 130 ATP equivalents. The total number of ATP equivalents expended in the synthesis and folding of rhodanese is approximately 1314. 2. Because a single proteolytic nick in a protein can doom it to total degradation, nicked proteins are clearly not tolerated by cells and are quickly degraded. Cells are virtually devoid of par- tially degraded protein fragments, which would be the obvious intermediates in protein degradation. The absence of such intermediates and the rapid disappearance of nicked proteins A-46 Abbreviated Answers to Problems from cells indicate that protein degradation is a rigorously selective, efficient cellular process. 3. Hsp70: Hsp70 binds to exposed hydrophobic regions of unfolded proteins. The Hsp70 domain involved in this binding is 18 kD in size and therefore would have a diameter of roughly 3 nm (see problem 5 for the math). Assuming the hydrophobic binding site of Hsp70 stretches across its diameter, it would interact with about 3 nm/0.35 nm ϭ 8 or 9 amino acid residues. Multiple Hsp70 monomers could interact with longer hydrophobic stretches. So, for Hsp70 to interact with a polypeptide chain does not necessarily depend on the protein’s size, but it does depend on its hydrophobicity (and absence of charged groups). Hsp70 and Hsp60 chaperonins: Proteins that interact with both of these classes of chaperones not only must fit the description for Hsp70 targets but must also be small enough to access the Hsp60 chaperonin chamber, which has a diameter of about 5 nm. This restriction means that Hsp60 cannot interact with proteins more than roughly 50 kD in mass (see problem 5). 4. Many eukaryotic proteins have a multidomain or modular organization, where each module is composed of a contiguous sequence of amino acid residues that folds independently into a discrete domain of structure (see Figure 6.26 for examples of this type of sequence and structure organization). Such proteins would be ideal for co-translational folding: As each newly synthesized contiguous sequence emerges from the ribosome tunnel, it begins folding into its characteristic domain structure. The final, fully folded state of the complete protein would be achieved when the various domains assumed their proper spatial relationships to one another through hinge motions oc- curring at intradomain regions of the protein. 5. The maximal diameter for a spherical protein would be 5 nm (radius ϭ 2.5 nm). The volume of this protein is given by V ϭ ᎏ 4 3 ᎏ ␲r 3 ϭ 4/3(3.14)(2.5 ϫ 10 Ϫ9 m) 3 ϭ 65.4 ϫ 10 Ϫ21 mL. If its density is 1.25 g/mL, its mass would be (1.25 g)(65.4 ϫ 10 Ϫ21 mL) ϭ 81.8 ϫ 10 Ϫ21 g/molecule, so its molecular weight ϭ (6.023 ϫ 10 23 )(81.8 ϫ 10 Ϫ21 g) ϭ 492.5 ϫ 10 2 g/mol ϭ 49,250 g/mol, or about 50 kD. 6. There are 649 different phosphorylated forms for a protein having 7 separate phosphorylation sites. 7. GrpE catalyzes nucleotide exchange on DnaK, replacing ADP with ATP, which converts DnaK back to a conformational form having low affinity for its polypeptide substrate. This change leads to release of bound polypeptide, giving it the opportunity to fold, which is an important step in DnaK function. EF-Ts catalyzes nucleotide exchange on EF-Tu, converting it to the conformational form competent in aminoacyl-tRNA binding. Binding of the aminoacyl-tRNAϺEF-Tu complex to the ribosome A site triggers the GTPase activity of EF-Tu as codonϺanticodon recognition takes place and the aminoacyl-tRNAϺEF-Tu complex conformationally adjusts to the A site. DnaJ delivers an unfolded polypeptide chain to DnaK, and its interaction with DnaK also triggers the ATPase activity of DnaK, whereupon the DnaKϺADP complex forms a stable complex with the unfolded polypeptide. In both instances, hydrolysis of bound nucleoside triphosphate is triggered and leads to conformational changes that stabilize the respective complexes. 8. Protein targeting information resides in more generalized features of the leader sequences such as charge distribution, relative polarity, and secondary structure, rather than amino acid sequence per se. Proteins destined for secretion have N-terminal amino acid sequence with one or more basic amino acids followed by a run of 6 to 12 hydrophobic amino acids. The sequence MRSLLILVLCFLPAALGK… has a basic residue (Arg) at position 2 and a run of 12 nonpolar residues (…LLILVLPLAALG…); thus, it appears to be a signal sequence for a secretory protein. Cleavage by the signal pepti- dase would occur between the G and K. 9. Translocation proceeds until a stop transfer signal associated with a hydrophobic transmembrane protein segment is recog- nized. The stop-transfer signal induces a pause in translocation, and the translocon changes its conformation such that the wall of this closed cylindrical structure either opens or exposes a hydrophobic path, allowing the transmembrane segment to diffuse laterally into the hydrophobic phase of the membrane. 10. The maximal diameter for a spherical protein would be 6 nm (radius ϭ 3 nm). The volume of this protein is given by V ϭ ᎏ 4 3 ᎏ ␲r 3 ϭ 4/3(3.14)(3 ϫ 10 Ϫ9 m) 3 ϭ 113 ϫ 10 Ϫ21 mL. If its density is 1.25 g/mL, its mass would be (1.25 g)(113 ϫ 10 Ϫ21 mL) ϭ 141 ϫ 10 Ϫ21 g/molecule, so its molecular weight ϭ (6.023 ϫ 10 23 )(141 ϫ 10 Ϫ21 g) ϭ 851 ϫ 10 2 g/mol ϭ 85,100 g/mol, or about 85 kD. 11. The thickness of a phospholipid bilayer is 5 nm, so the overall channel formed by a 50S ribosome and the translocon channel is 15 nm; 15 nm Ϭ 0.35 nm per amino acid ϭ about 43 amino acid residues. 12. CH 2 CH 2 N H 1 76C O 76C 1 CH 2 CH 2 CH 2 CH 2 CH 2 ϩ NH 3 CH 2 O Ϫ O 48 48 13. E 3 ubiquitin protein ligase selects proteins by the nature of the N-terminal amino acid. Proteins with Met, Ser, Ala, Thr, Val, Gly, or Cys at the amino terminus are resistant to its action. Proteins having Arg, Lys, His, Phe, Tyr, Trp, Leu, Ile, Asn, Gln, Asp, or Glu at their N-terminus are susceptible. N-terminal Pro residues lack a free ␣-amino group, so such proteins are not susceptible. 14. The cell cycle relies on the cyclic synthesis and destruction of cell cycle regulatory proteins. Lactacystin inhibits cell cycle pro- gression by interfering with programmed destruction of proteins by proteasomes. 15. The temperature-induced switch could be based on a temperature-dependent conformational change in the HtrA Abbreviated Answers to Problems A-47 protein that brings the His-Ser-Asp catalytic triad into the proper spatial relationship for protease function. 16. There are many other post-translational modifications, includ- ing acylation, alkylation, amidation (at a protein’s C-terminus), biotinylation, formylation, glycosylation, isoprenylation, and oxidation. See also Table 5.5. 17. This exercise is left to the student. 18. A phosphodegron is defined as one or a series of phosphorylated residues on a substrate protein that interact directly with a protein–protein interaction domain in an E3 ubiquitin ligase, thereby linking the substrate to the ubiquitin conjugation machinery. Phosphorylation can affect the affinity of target protein binding; alternatively, phosphorylation can stimulate E2 activity. 19. It depends on which amino acid is penultimate. If Arg, Lys, His, Phe, Tyr, Trp, Leu, Ile, Asn, Gln, Asp, or Glu follow immediately after Met, the protein will have a short half-life after Met removal. If Ser, Ala, Thr, Val, Gly, Cys, Pro, or another Met follow, the protein should have a long half-life after N-terminal Met removal. 20. To array positively charged residues on one side of an ␣-helix and hydrophobic residues on the other requires a pattern with positively charged residues positioned every 3.6 residues and similarly for hydrophobic residues. A sequence with Arg or Lys at positions 1, 4, 7, 11, 14, and 18 and an array of hydrophobic residues at 2, 3, 5, 6, 8, 9, 10, 12, 13, 15, 16, 17, 19, and 20 would fit this pattern. Chapter 32 1. Polypeptide hormones constitute a larger and structurally more diverse group of hormones than either the steroid or amino acid–derived hormones, and it thus might be concluded that the specificity of polypeptide hormone-receptor interactions, at least in certain cases, should be extremely high. The steroid hormones may act either by binding to receptors in the plasma membrane or by entering the cell and acting directly with proteins controlling gene expression, whereas polypeptides and amino acid–derived hormones act exclusively at the membrane surface. Amino acid–derived hormones can be rapidly intercon- verted in enzyme-catalyzed reactions that provide rapid re- sponses to changing environmental stresses and conditions. See The Student Solutions Manual, Study Guide and Problems Book for additional information. 2. The cyclic nucleotides are highly specific in their action, because cyclic nucleotides play no metabolic roles in animals. Ca 2ϩ ion has an advantage over many second messengers because it can be very rapidly “produced” by simple diffusion processes, with no enzymatic activity required. IP 3 and DAG, both released by the metabolism of phosphatidylinositol, form a novel pair of effectors that can act either separately or synergisti- cally to produce a variety of physiological effects. DAG and phosphatidic acid share the unique property that they can be prepared from several different lipid precursors. Nitric oxide, a gaseous second messenger, requires no transport or translocation mechanisms and can diffuse rapidly to its target sites. 3. Nitric oxide functions primarily by binding to the heme pros- thetic group of soluble guanylyl cyclase, activating the enzyme. An agent that could bind in place of NO—but that does not activate guanylyl cyclase—could reverse the physiological effects of nitric oxide. Interestingly, carbon monoxide, which has long been known to bind effectively to heme groups, appears to function in this way. Solomon Snyder and his colleagues at Johns Hopkins University have shown that administration of CO to cells that have been stimulated with nitric oxide causes attenuation of the NO-induced effects. 4. Herbimycin, whose structure is shown in the figure below, reverses the transformation of cells by Rous sarcoma virus, pre- sumably as a direct result of its inactivation of the viral tyrosine kinase. The manifestations of transformation (on rat kidney cells, for example) include rounded cell morphology, increased glucose uptake and glycolytic activity, and the ability to grow without being anchored to a physical support (termed anchorage- independent growth). Herbimycin reverses all these phenotypic changes. On the basis of these observations, one might predict that herbimycin might also inactivate tyrosine kinases that bear homology to the viral pp60 vϪsrc tyrosine kinase. This inactivation has in fact been observed, and herbimycin is used as a diagnos- tic tool for implicating tyrosine kinases in cell-signaling pathways. 5. The identification of phosphorylated tyrosine residues on cellular proteins is difficult. Quantities of phosphorylated proteins are generally extremely small, and to distinguish tyrosine phosphorylation from serine/threonine phosphorylation is tedious and laborious. On the other hand, monoclonal antibod- ies that recognize phosphotyrosine groups on protein provide a sensitive means of detecting and characterizing proteins with phosphorylated tyrosines, using, for example, Western blot methodology. 6. Hormones act at extremely low concentrations, but many of the metabolic consequences of hormonal activation (release of cyclic nucleotides, Ca 2ϩ ions, DAG, etc., and the subsequent alterations of metabolic pathways) occur at and involve higher concentrations of the affected molecular species. As we have seen in this chapter, most of the known hormone receptors mediate hormonal signals by activating enzymes (adenylyl cyclase, phospholi- pases, protein kinases, and phosphatases). One activated enzyme can produce many thousands of product molecules before it is inactivated by cellular regulation pathways. 7. Vesicles with an outside diameter of 40 nm have an inside diameter of approximately 36 nm and an inside radius of 18 nm. The data correspond to a volume of 2.44 ϫ 10 Ϫ20 L. Then 10,000 molecules/6.02 ϫ 10 23 molecules/mole ϭ 1.66 ϫ 10 Ϫ20 mole. The concentration of acetylcholine in the vesicle is thus 1.66/2.44 M or 0.68 M. 8. The evidence outlined in this problem points to a role for cAMP in fusion of synaptic vesicles with the presynaptic membrane and the release of neurotransmitters. GTP␥S may activate an inhibitory G protein, releasing G ␣i (GTP␥S), which inhibits adenylyl cyclase and prevents the formation of requisite cAMP. 9. In both cases, the fraction of receptor that is bound with hormone is approximately 50%. 10. Statin drugs inhibit the synthesis of new cholesterol in human subjects, but they have no effect on dietary intake of cholesterol. ! ; [ O N H H 3 CO CH 3 O O H 2 NOCO CH 3 CH 3 CH 3 O CH 3 CH 3 O H 3 CO A-48 Abbreviated Answers to Problems Dietary cholesterol accounts for approximately 2/3 of all body cholesterol. Moreover, synthesis of steroid hormones is not generally dependent on ambient levels of cholesterol in the body. Thus the taking of statin drugs would not be expected to influ- ence the levels and functions of steroid hormones in the body. 11. ␤-Strands indeed provide more genetically economical means of traversing a membrane. However, the only significant classes of proteins that employ ␤-strands for membrane traversal are the porins and toxins such as hemolysin. These ␤-strand structures provide no easy way to communicate conformational changes across the membrane. On the other hand, bundles of ␣-helices are more able to convey and transmit conformational changes across a bilayer membrane. 12. The formation and breakdown of cAMP: 13. The point at which no ion flow occurs is the point of equilibrium that balances the chemical and electrical forces across a O O O Ϫ OO Ϫ O HH Ϫ OPO P PO O O ϩ O Ϫ O Ϫ O Ϫ Ϫ OPO P OP H H BH cAMP O O Ϫ O CH 2 Adenine O OHOH B HH O CH 2 Adenine O OHO O Ϫ O HH PHO O CH 2 Adenine O OHOH membrane. The Nernst equation is obtained by setting ⌬G to zero in Equation 9.2. Rearrangement yields RT ln (C 2 /C 1 ) ϭϪZᏲ⌬␺ Using the data in Figure 32.49, one can use this equation to yield an equilibrium potential for K ϩ of Ϫ77 mV and an equilibrium potential for Na ϩ of ϩ53.4 mV. 14. Using the Goldman equation, one can calculate ⌬␺ ϭϪ60 mV, in agreement with values measured experimentally in neurons. 15. The resting potential in neurons is Ϫ60 mV. Local depolariza- tion of the membrane causes the potential to rise approximately 20 mV to about Ϫ40 mV. This change causes the Na ϩ channels to open and Na ϩ ions begin to flow into the cell. This causes the potential to continue increasing to a value of about ϩ30 mV. Because this value is close to the equilibrium potential for Na ϩ , the Na ϩ channels begin to close and K ϩ channels open. K ϩ rushes out of the neuron, returning the membrane potential to a very negative value. There is a slight overshoot of the potential, and the K ϩ channels close and the resting membrane potential is restored. 16. Pathway steps (in Figure 32.4) that involve amplification include the tyrosine kinase of the receptor protein, Raf, MAPKK, and MAPK. 17. If Ras were mutated so as to have no GTPase activity, it would activate Raf indefinitely, and the pathway would run as if hormones were continually activating the receptor tyrosine kinase. 18. There are several possible answers to this problem. One is that the original assays of kinase activities that reflected signaling effects were carried out on whole-cell preparations, in which the G-protein-dependent and G-protein-independent activities would appear as components of the overall activation. The availability of G-protein-uncoupled receptor mutants and ligands that could stimulate arrestin recruitment without G-protein activation made it possible to distinguish the G-protein-dependent and G-protein- independent effects. (See the Further Reading references in this chapter by Luttrell for additional discussion of these issues.) 19. Malathion has been used for years in the eradication of boll weevils, but it has not presented a serious toxicity problem in this program. Apparently, malathion is very toxic to insects, and relatively less toxic to humans, particularly in the low volume applications used for this purpose. 20. This exercise is left to the student, for obvious reasons. Acetyl-CoA carboxylase, in fatty acid synthesis, 723–727, 726F phosphorylation of, 723F, 726–727, 727F Acetyl-coenzyme A, 57T, 520 N-Acetylneuraminic acid, 228 Acetylphenylalanine methyl ester, 438S O-Acetylserine sulfhydrylase, 796 Acid acetic, titration curve for, 39F, 40F N-Acetylneuraminic, 228 adenylic, 295 aldaric, 188 aldonic, 188 amino, 70–92. See also Amino acid arachidic, 220T arachidonic, 220, 220T, 735–736, 736F, 748F aspartic, 72S behenic, 220T bile, 761, 761F cholic, 233, 234S, 761F chorismic, 797, 798F conjugate, 36 cytidylic, 295 deoxycholic, 233, 234S docosahexaenoic, 736B eicosapentaenoic, 736B fatty, 219–222, 220T, 221G, 221S catabolism of, 701–721. See also Fatty acid catabolism essential, 531 fusidic, 983S gibberellic, 230S gluconic, 188 D-glucuronic, 188S glutamic, 72S glycocholic, 761F guanylic, 295 hydroxyeicosanoic, 747 L-iduronic, 188S inosinic, 814, 815F, 816–818, 819F lignoceric, 220T linoleic, 220, 220T, 735–736, 736F muramic, 190 nervonic, 220T neuraminic, 190 octadecanoic, 219 oleic, 219, 220T, 221G, 221S palmitic, 219, 220T palmitoleic, 220T phosphatidic, 223G, 224 phosphoric, 40, 41F polyamino, 142 ribothymidylic, 304 sialic, 228 residues of, 208S stearic, 219, 220T sugar, 187–188, 188S taurocholic, 761F teichoic, 204 tricarboxylic, 532B uric, 293S, 810, 824–825 gout caused by, 824–825 purine catabolism and, 823 structure of, 814S uridylic, 295 uronic, 188 Acid dissociation constant, 37, 39T Acid hydrolysis, 99 Acid–base behavior of glycine, 76–77 Acid–base catalysis, 430–431 Acid–base properties of amino acids, 76–79, 76F, 77T Acidic amino acid, 71 Acidity, 59T Acidosis lactic, 681B respiratory, 44B Aconitase citrate isomerized by, 572 iron–sulfur cluster and, 573 Aconitase reaction in tricarboxylic acid cycle, 573, 573F, 573G Acquired immunodeficiency syndrome, 443B, 876B Acridine orange, 326, 327S Actin, 116F, 265, 481, 481D, 484, 484F Actin gene, 939 Actin-anchoring protein, 486B Actinomycin D, 326, 327S Action potential, 1044–1046, 1045F Activation free energy of, 388 light, 655 Activation loop, 1017 Activation sequence, upstream, 927 Activator transcription, 934 transcriptional, 923 Activator gene, 885 Activator site, 923 Active site, 389, 398 Active transport, 277–285 calcium, 280 cardiac glycosides and, 279, 280G, 280S, 282B as energy-coupling devices, 278 gastric H ϩ ,K ϩ -ATPase, 280–282, 282F B ϭ box; D ϭ definition; F ϭ figure; G ϭ molecular graphic; S ϭ structure; T ϭ table A band, 483 A site, 965 AAAϩ ATPases, 499, 503, 873, 1001 ABC transporters, 283, 284F, 285 Absolute configuration of optically active molecules, 82B Absolute zero, 52 Absorption spectrum ACAT, 757 of chlorophylls, 634F of nucleic acid bases, 293–294, 293F Abzymes, 413 ACC. See Acetyl-CoA carboxylase Acceptor complexes, 269 Acceptor site, 965 Acetal, 191, 191S Acetate as carbon source, 587–589 cellulose, 197 Acetate unit in beta-oxidation, 707–708 in fatty acid synthesis, 723–724, 725F Acetic acid, titration curve for, 39F, 40F Acetoacetate in amino acid catabolism, 809–810 leucine catabolism and, 807 Acetoacetyl-CoA acetyltransferase, 718 Acetoacetyl-CoA thiolase, 718 Acetohydroxy acid synthase, 793 Acetyl phosphate, 61, 63 free energies of hydrolysis of, 57T hydrolysis reaction of, 62F Acetylcholine acetylcholinesterase degrading, 1048, 1050 degradation of, 1050F Acetylcholine receptor, 1047, 1048F Acetylcholine transport protein, 1050 Acetylcholinesterase, 1048, 1050 k cat /K m ratio of, 394T Acetyl-CoA control of gluconeogenesis by, 670 in fatty acid synthesis, 729 leucine catabolism and, 807 mevalonate and, 751–752 in TCA cycle carbon atoms in, 579, 581 carbon dioxide produced from, 571–575, 571F, 573F decarboxylation of pyruvate and, 566–567 Index I-2 Index Active transport (continued) monovalent cation, 278–279, 279F, 279G secondary, 286 Active-site residues, 433B Acute lymphoblastic leukemia, 789B Acute myeloblastic leukemia, 789B Acyl carrier protein, 727, 727F Acyl-CoA dehydrogenase in beta-oxidation, 704–705 mechanism of, 706F Acyl-CoA dehydrogenase reaction, 706F Acyl-CoA synthetase, 702 Acyl-CoA:cholesterol acyltransferase, 757 Acyl-coenzyme A, 665–666 Acyldihydroxyacetone phosphate reductase, 738–739 Acyl-enzyme intermediate, 436 ADA complex, 933 ADA-SCID, biochemical defects in, 378B Adenine, 292, 293S Adenine nucleotide pool, total, 843–844 Adenine phosphoribosyltransferase, 821 Adenosine, 294B, 295, 295S Adenosine deaminase, 378B, 822B, 823 Adenosine-5Ј-diphosphate free energies of hydrolysis of, 57T phosphorylation of, 66 Adenosine-5Ј-monophosphate, 295 free energies of hydrolysis of, 57T glycogen phosphorylase and, 464–465 inosinic acid as precursor to, 814, 815F, 816–818, 820F structure of, 296S Adenosine-5Ј-phosphosulfate, 319B Adenosine-5Ј-triphosphate, 64S S-Adenosylmethionine, 57T, 790, 792F S-Adenosylmethionine synthase, 790 Adenovirus-mediated gene delivery, 377, 378F, 379 Adenylate kinase, 843 Adenylic acid, 295 Adenylosuccinase, 815F, 819 Adenylosuccinate lyase, 815F, 823 Adenylosuccinate synthetase, 819, 823 Adenylyl cyclase, 465F, 466, 1051 modulation of, 1025F Adenylyl transferase, 777 Adenylylation, 461T Adipocyte, 697 Adipose cell, 697 electron micrograph of, 698F pentose phosphate pathway and, 684 Adipose tissue energy metabolism of, 848T energy stored in, 698T fats in, 697, 700–701 metabolic role of, 848F, 851–852 A-DNA, 325T ADP free energies of hydrolysis of, 57 T phosphor ylation of, 66 ADP ribosylated eEF-2, 980B ␣ 1 -Adrenergic receptors, 1043 Adrenocorticotropic hormone, 763, 1009F Adriamycin, 284S Aequorin, 81B Aerobe, types of, 512 Affinity chromatography, 132, 132F Affinity label, 402 Affinity purification, 97 A-form DNA, 323, 324F Agar, 200 Agaropectin, 200 Agarose, 200, 200F, 200S Aggregate, proteoglycan–hyaluronate, 213 Aggregation symmetries of globular protein, 173T Agouti-related peptide, 854 AICAR, 804 AICAR transformylase, 815F AIDS, 876B protease inhibitors for, 443B AIR carboxylase, 815F AIR synthetase, 815F Akt1, 708B Alanine catabolism of, 804 pK a value for, 77T S-, 84B structure of, 72S synthesis of, 793 transamination of pyruvate to, 851F L-Alanine, 84B Alanine tRNA, yeast, 346F, 347F, 347G Albuterol, 482B Alcohol metabolic effects of, 855B structure of, 186S sugar, 189, 189S Alcohol dehydrogenase, 428, 428F, 553, 553F in chemical reaction, 420T NAD ϩ -dependent dehydrogenase and, 579B structure of, 173G Alcoholic fermentation, 553 Aldaric acid, 188 Aldehyde, 188 Alditol, 189 Aldohexose, 182F, 183 Aldol condensation, 544 Aldolase, 431T Aldonic acid, 188 Aldopentose, 182S, 183 Aldose, 182–183, 183S Aldose reductase, 159F, 687B Aldosterone, 764 Aldotetrose, 182S, 183 Aliskiren, 424B Alkaline phosphatase, 420T Alkalosis, respiratory, 44B Alkaptonuria, 810B 1-Alkly-2-Acetylglycerophosphocholine, 744 Alkylating agent, 893 Allantoic acid, 825 Allantoin, 825 Allantoinase, 825 Allosteric effector bisphosphoglycerate as, 475 2,3-bisphosphoglycerate as, 475F Allosteric enzyme, 395 membrane-associated, 1016–1017 Allosteric inhibitor, 457 Allosteric modifier in fatty acid metabolism, 736 Allosteric regulation, 453, 456–467 covalent modification and, 462–467, 462F, 464F, 465F, 465S definition of, 453D general features of, 456–457 in gluconeogenesis, 669–671, 671F of glutamine synthetase, 777, 778F of hemoglobin, 467–468, 473 symmetry model for, 457–459 All-trans-retinal, 230S D-Altrose, 182S Alzheimer’s disease, 172B protein deposits in, 988B ␣-Amanitin, 924, 924F Amide group, coplanar relationship of atoms in, 88F Amide plane, in proteins, 87, 136–137, 137F Amide-linked glycosyl phosphatidylinositol, 257 Amide-linked myristoyl, 257, 258F Amino acid, 70–92. See also Amino acid sequencing; Amino acid synthesis acid–base properties of, 76–79, 76F, 77T alpha, 780S in alpha-helix, 139 basic, 74 carboxyl and amino group reactions of, 77–78 catabolism of, 804–810 of C-3 family, 804 of C-4 family, 806 of C-5 family, 806 intermediates of, 804 of lysine, 809 of valine, isoleucine and methionine, 807 cationic form of, 76F chromatographic separation of, 85–86 commonly in proteins, 71, 72S–73S dietary requirements for, 781B essential, 531, 781T glucogenic, 531 gluconeogenesis and, 662 in green fluorescent protein, 81B helix behavior of, 142T ionization of side chains of, 78–79 ketogenic, 531 membrane transport and, 286 nonessential, 781T nonpolar, 74 not found in proteins, 75S, 76 nuclear magnetic resonance and, 83–85, 84F optical and stereochemical properties of, 79–82 phenylthiohydantoin, 86, 86F pK a value for, 77T polar, uncharged, 74 rarely in proteins, 76 structure of, 10S, 70–76, 70F, 71F synthesis of, 779–810 in transmembrane helices, 251–252 as weak polyprotic acid, 76–78 Amino acid aminotransferase, branched- chain, 793 Amino acid analysis of protein, 99–100 Amino acid analyzer, 99 Amino acid neurotransmitter, 1052–1053 Amino acid residue, 89, 139, 433B Amino acid sequence of chymotrypsinogen, 434, 435F of leader peptides, 921F nature of, 110–117, 110F, 113F, 115F, 116G, 117T number of, 101B Index I-3 pathological variants of, 117T reconstruction of, 105, 106F role of, in structure, 136 Amino acid sequencing chemical methods for, 100–105 cleavage of disulfide bridges in, 101, 102F fragmentation of polypeptide chain and, 103–105, 104F polypeptide chain separation in, 101 reconstruction of sequence in, 105, 106F terminal analysis in, 102–103 enzymatic methods for, 103 by mass spectrometry, 105–109, 106T, 107F–108F, 109F sequence databases and, 109–110 Amino acid synthesis, 779–810 aminotransferase reaction in, 782B of aromatic amino acids, 797–802, 797F, 798F–801F of aspartate family, 787–793, 790, 791F, 792F, 793 histidine, 802, 803F from ␣-keto acid transamination, 780F, 781–782 of ␣-ketoglutarate family, 781B, 781T, 783–787, 783F, 784F–786F, 787B metabolic intermediates in, 781T purine, 802, 804 of pyruvate family, 793, 794F, 795F urea cycle in, 785, 786F, 787, 787B Amino sugar, 190 Aminoacyl-tRNA, 305, 957G EF-Tu and, 973B, 973G Aminoacyl-tRNA binding, 969–972, 970F, 973B Aminoacyl-tRNA synthetase in anticodon, 958 in protein synthesis, 953, 955–958, 955T, 956 F, 957G interpretation of second genetic code by, 953, 955–958 recognition of tRNA by, 956–958 two classes of, 955 ␣-Aminoadipate, 787 ␣-Aminoadipic-6-semialdehyde, 787 Aminoglycoside antibiotics, 981–982 5-Aminoimidazole ribonucleotide, 815F 5-Aminoimidazole-4-carboxamide ribonucleotide, 804 ␤-Aminopropionitrile, 155 B 2-Aminopurine, 892–893, 893F Aminotransferase, 782 branched-chain amino acid, 793 catalytic mechanism of, 407 leucine, 793 Aminotransferase reaction, 782B Aminotriazole, 801B Ammonia channels, 277F Ammonium assimilation of, 775–776, 775F metabolic fate of, 774–776, 775F, 776F titration cur ve for, 40, 41F in urea cycle, 787B Ammonotelic animal, 810 Amobarbital, 617S AMP, 295 free energies of hydrolysis of, 57T glycogen phosphorylase and, 464–465 inosinic acid as precursor to, 814, 815F, 816–818, 820F structure of, 296S AMP deaminase, 823 AMP-activated protein kinase, 845–847 Amphibolic intermediate, 520 Amphipathic helix, 997 Amphipathic molecule, 33 Amphiphilic helix, 153 basic, 1033 Amphiphilic molecule, 33, 33F Amplification, 354D ␣-Amylase, 673 salivary, 196 ␤-Amylase, 673 Amylo-(1,4→1,6)-transglycosylase, 677–678 Amyloid-␤, 988B Amyloid plaque, 988B Amyloidotic polyneuropathy, familial, 172B Amylopectin, 195, 195S Amyloplast, 196 Amylose, 195S, 196S–197S ␣-Amylose, 195 Amytal, 617 S Anabolic steroid, 764, 764F Anabolism amphibolic intermediates in, 520 as biosynthesis, 518 catabolism and, 517, 518 metabolic integration and, 839 NADP ϩ and, 517 NADPH in, 523, 523F pathways of, 520–521 Anaerobe, types of, 512 Anaerobic condition, lactate accumulation in, 553 definition of, 559 Analog base, mutation induced by, 892–893 fluoro-substituted, 834B folate, 818B transition-state, 423 Analyzer, amino acid, 99 Anaplerotic reaction, 582, 584 Anchoring of membrane protein, 256–257 Androgen, 233, 763 4-Androstenedione, 238S Anemia, sickle cell, 476–478 Anfinsen, Christian B., 161–162, 987 Anfinsen cage, 990 Angel dust, 1053 Angiotensin, 437 Angiotensin-converting enzyme inhibitors, 424B Anhydride phosphoric acid, 59–60 phosphoric-carboxylic, 61, 63 Animal acetyl-CoA carboxylase in, 725 metabolic water and, 710 nitrogen excretion in, 810 pyrimidine biosynthesis in, 829–830 transgenic, 889B uric acid oxidation in, 825–826 Animal cell, 21F polysaccharides in, 204 Anion exchange media, 128F Anionic form of amino acid, 76F Annexin protein, 1031 Anomer, 184 Anomeric carbon atom, 184 Anserine, 42, 42F Antagonist, 1050 Anthranilate synthase, 799 Antibiotic, 981–982, 983S Antibody, 176 catalytic, 413 diversity of, 902 as enzyme, 413 immune response and, 897 screening of cDNA library with, 370 Anticancer drug fluoro-substituted pyrimidines for, 835B folate analog as, 818B prenylation reactions in, 259B proteasome inhibitors in, 1003B Anticodon, 345 aminoacyl-tRNA synthetase in, 958 Anticodon loop, 953 Antifreeze glycoprotein, 207, 207S Antigen, 413F definition of, 413D immune response and, 897 O, 203–204 proliferating cell nuclear, 874 Antigenic determinant, 203 Anti-inflammatory drug, nonsteroidal, 750B–751B Antimicrobial agent fluoro-substituted pyrimidines for, 835B folate analog as, 818B Antioxidants, 713B Antiparallel beta-pleated sheet, 143–144 Antiparallel chain in chitin, 198 Antiparallel nature of double helix, 300F Antiport, 286 Antiterminator, 922 ␣ 1 -Antitrypsin, 171B, 171G Antp, 936 AP endonuclease, 891 Apaf-1, 625F Apoenzyme, 385 Apoprotein, 758T Apoptosis, 624–626 Apoptosome, 625–626 Apoptotic protease-activating factor 1, 625F APRT, 821 Aptamers, 348 Apurinic acid, 307 Aquaporin-1, 254F araBAD operon, 918–919 AraC, 919 Arachidic acid, 220T Arachidonate, 747 Arachidonate release, 748–749 Arachidonic acid, 220T, 221G, 221S, 748F fatty acid synthesis and, 735–736, 736F arachidonic acid synthesized from, 736F Archaea, 17, 19 Archaebacterium, rRNA of, 348F Arginine pK a value for, 77T structure of, 73S synthesis of, 783 urea cycle and, 785 Arginine finger, 501 Argininosuccinase, 784 Argininosuccinate synthetase, 784 Aromatic amino acid, 797–802, 797F, 798F–801F I-4 Index Arrestin, 1041 Arrhenius equation, 388 Arsenate, 546 Artificial chromosome, 360 Artificial substrate, 438F Asialoglycoprotein receptor, 209 Asp 61 , 616 Asparaginase, 806 Asparagine, 787 biosynthesis of, 789F leukemia and, 789B pK a value for, 77T structure of, 72S Aspartate, 780S, 787, 1052–1053 Aspartate aminotransferase, 159F Aspartate family of amino acids, 787–793, 791F, 792F Aspartate transcarbamoylase, 826 Aspartic acid pK a value for, 77T structure of, 72S Aspartic protease, 437, 439T, 440–441, 441F, 441S Aspartyl-␤-phosphate, 790 ␤-Aspartyl-semialdehyde, 790 ␤-Aspartyl-semialdehyde dehydrogenase, 790 Aspirin, 749–750 Assay, dye binding, 98B Assimilation ammonium, 775–776, 775F nitrate, 768, 769–770 single-strand, 882–883 Associated transducers and activators of transcription, 1037 Assumption, steady-state, 390 Asymmetric molecule, amino acids as, 79 Asymmetry in amino acids, 70 cell membranes as, 260–261 ATCase, 826, 829 Atherosclerotic plaque, 155B Atomic fluctuation in globular proteins, 165, 165T ATP, 2, 3S, 296, 297S catabolism and, 517 in cellular energy cycle, 521 energy charge and, 843–844 equilibrium ratio and, 67B F 0 effects on, 614–616 formation of, 66 free energies of hydrolysis of, 57T in gluconeogenesis, 668–669 glucose oxidation and, 622–623, 623T glucose-6-phosphate utilization and, 691, 692 glycogen phosphorylase and, 464 in glycolysis, 537 Hatch–Slack pathway and, 658–659 hexose synthesis and, 647–648 human requirement for, 66 hydrolysis of, 62F, 63–65 hydrolysis of phosphoric acid anhy- drides and, 59–60 as intermediate energy-shuttle molecule, 57–58 light-driven synthesis of, 648–650, 649F, 650F metabolic roles of, 843 NADPH and, 840–841 oxidation of palmitic acid and, 708–709 phosphorylation potential and, 844 proton gradient and, 611–620, 614F, 616F, 617F, 618F, 619B, 619F pyruvate carboxylase and, 666 in TCA cycle, 576 in tricarboxylic acid cycle, 563 triphosphate chain of, 60F ATP coupling, 841–843 ATP coupling stoichiometry, 842–843 ATP derivative, sulfide synthesis from, 796–797 ATP hydrolysis, myosin and, 488–490 ATP sulfurylase, 319B ATP synthase, 612F, 614F ATP synthase inhibitor, 618 ATP–ADP translocase, 618, 619F ATPase, 283 ATPase activity, 485 ATP–citrate lyase, 580F, 582, 724 ATP-dependent kinase in purine synthesis, 820–821 ATP: D-glucose-6-phosphotransferase, 385 ATP:GS:adenylyl transferase, 777 Atrial natriuretic peptide, 1021 Atropine, 1051 Attenuation, transcription, 920 Autocoid, 294B Autogenous regulation, 920 Automated DNA sequencing, 318–320 Autophosphorylation, 1018, 1020 Autoregulation, 920 Autotroph, 511D Avian sarcoma virus, 1023 Axial, 187 Axis, twofold rotation, 174 Axonemal dyneins, 494 Axons, 495 Azaserine, 814, 816S Azide, 617–618 AZT, 877, 877S B lymphocyte, 897 Baa helix, 1033 Bacillus cereus, 275–276, 276F Bacillus thuringiensis, 257B Backbone, 167D Bacteria cell walls of, 201–204, 202S, 203F denitrifying, 769 nitrifying, 768 pyrimidine biosynthesis in, 829–830 structure of, 19F Bacterial cell, virus infecting, 21 Bacterial pathway of ornithine biosynthesis, 784F Bacterial transformation experiment, 359F Bacteriophage, 21 Bacteriophage T7 RNA polymerase, 908F Bacteriorhodopsin, 250–251, 251F, 285, 616 light-driven proton transport and, 285, 285F Bactoprenol, 231S Balance, nitrogen, 531 BAR domain binding, 267, 267F Barrier, blood–brain, 1056 Base chemical mutagens reacting with, 893 conjugate, 36 discriminator, 957 methylated, 304 nitrogenous, 291–299, 292F, 293S, 294F, 298S phosphate-linked, 342S phosphite-linked, 342S RNA, 305S Base analog, mutation induced by, 892–893 Base excision repair, 887, 891, 891F Base pair, Watson–Crick, 301S, 321 Base pairing, intrastrand, 342, 344–345 ribosomal RNA and, 346, 348 Base sequence of nucleic acids, 299 Basic amino acid, 71, 76 Basic amphiphilic alpha-helix, 1033 Basic region, 938 Basic region-leucine zipper motif, 938 BCA method, 98B B-DNA, 321, 322F, 324F, 325T, 936 Bear, polar, 223B Behavior, saturation, 271 Behenic acid, 220T ␤-Bend, 145 Benois, Christophe, 543B Benzoylalanine methyl ester, 438S Beta sheet antiparallel pleated, 143–144 fibroin and ␤-keratin as, 149 of globular protein, 152–153 parallel pleated, 143 pleated, 141F, 142–144, 143B, 144F Beta-hydroxyl group, 706–707 Beta-oxidation fatty acids and, 701–702, 701F, 704F peroxisomal, 714 Beta-turn, 144–145, 145F Bicarbonate buffer system, 43B Bicarbonate ion in urea cycle, 787B Bicinchoninic acid, 98B Bifunctional enzyme, 671 Bijvoet, J. M., 82B Bilayer lipid, 244–245, 244F phase transitions, 263–264 Bile acid, 761, 761F Bile salt, 700 Bimolecular reaction, 387 Bimosiamose, 207B Binding cooperative, 178 nucleotide, 832–833 oxygen by hemoglobin, 469 in myoglobin, 469 proteoglycans and, 209–211 Binding change mechanism, 613 Binding isotherm, 122 Binding site, ribosome, 966F, 967 Bioinformatics, 367D Biological structure, 2 Biomolecular recognition, 14–15 Biomolecule anabolic pathways and, 520 carbon as, 4–5 definition of, 1 dimensions of, 7T high-energy , 57–63 radius of, 13T structural organization of, 5 . 761F cholic, 233, 234S, 761F chorismic, 797, 798F conjugate, 36 cytidylic, 295 deoxycholic, 233, 234S docosahexaenoic, 736B eicosapentaenoic, 736B fatty, 219–222, 220T, 221G, 221S catabolism of, 701–721.