Biochemistry, 4th Edition P103 pdf

30.6 How Are Proteins Synthesized in Eukaryotic Cells? 983 O 2 NCC OH H CH 2 OH H NH C CHCl 2 O Chloramphenicol H 3 C CH 3 O CHOH CH 2 N H OO Cycloheximide O CH 3 H 3 C HO O H 3 C HO CH 3 CH 3 OH CH 3 O O H OCH 3 CH 3 H CH 3 H HO HH O O H N(CH 3 ) 2 CH 3 H HOH H HH O Erythromycin HO CH 3 H CH 3 H HO CH 3 H O C OCH 3 COOH CH 3 H 3 C Fusidic acid H OH NH C NH 2 NH 2 + HNC NH 2 + H 2 N H H H HO OH H H O O H H 3 C CHO H OH O H O H H CH 2 OH H 3 CNH OH H HO HH Streptomycin OH H 3 COH OOHO OH N(CH 3 ) 2 OH O C NH 2 Tetracycline HO N N N N N H 3 CCH 3 O HH OHHN H CH 2 CO CH NH 3 + CH 2 OCH 3 Puromycin O N N N N N HH O HH OHO H CH 2 CO CH NH 3 + CH 2 OH Tyrosyl-tRNA PO O O Ϫ H CH 3 FIGURE 30.31 The structures of various antibiotics that act as protein synthesis inhibitors. Puromycin mimics the structure of aminoacyl-tRNA in that it resembles the 3Ј-terminus of a Tyr-tRNA (shaded box). HO O O H 2 N NH 2 O HO HO (a) OH OH NH 2 H 3 C H 3 CNH H 3 C OH O (b) 5Ј 1406 1408 1409 1491 1495 1493 1492 C G U C C A C C 3Ј A A A G C U G G U G G FIGURE 30.32 (a) Structure of geneticin, a representa- tive aminoglycoside antibiotic. Note the characteristic 2-deoxystreptamine (2-DOS) core structure, in red. (b) The base sequence of the small RNA loop within the 16S rRNA decoding center. Note that unpaired adenine residues 1408, 1492, and 1493 constitute the internal loop structure. (Adapted from Figure 1 in Her- mann,T., 2005.Drugs targeting the ribosome. Current Opinion in Structural Biology 15:355–366.) 984 Chapter 30 Protein Synthesis The most common effect of antibiotics that interact with the PTC is to occupy space within this center, such that the amino acid or peptidyl chain linked at the 3Ј-end of a tRNA cannot be positioned properly for the peptide-bond forming reaction. This mode of inhibition is consistent with the catalytic role of PTC in pre- cisely orienting the substrates so that the peptide bond-forming reaction can occur. This effect is more common for aminoacyl-tRNAs in the A site, although some drugs can bridge the A and P sites and affect both aminoacyl-tRNA and peptidyl-tRNA orientation. Ribosomes with long peptidyl chains attached to the tRNA in the P site are less susceptible to macrolide antibiotics. SUMMARY 30.1 What Is the Genetic Code? The genetic code is the code of bases that specifies the sequence of amino acids in a protein. The genetic code is a triplet code. Given the four RNA bases—A, C, G, and U—a total of 4 3 ϭ 64 three-letter codons are available to specify the 20 amino acids found in proteins. Of these 64 codons, 61 are used for amino acids, and the remaining 3 are nonsense, or “stop,” codons. The genetic code is unambiguous, degenerate, and universal. 30.2 How Is an Amino Acid Matched with Its Proper tRNA? During protein synthesis, aminoacyl-tRNAs recognize the codons through base pairing using their anticodon loops. A second genetic code exists, the code by which each aminoacyl-tRNA synthetase adds its amino acid to tRNAs that can interact with the codons that specify its amino acid. A common set of rules does not govern tRNA recognition by aminoacyl- tRNA synthetases. The tRNA features recognized are not limited to the anticodon and in some instances do not even include the anticodon. Usually, an aminoacyl-tRNA synthetase recognizes a set of sequence elements in its cognate tRNAs. 30.3 What Are the Rules In Codon–Anticodon Pairing? Anticodons are paired with codons in antiparallel orientation. There are more codons than there are amino acids, and considerable degeneracy exists in the genetic code at the third base position. The first two bases of the codon and the last two bases of the anticodon form canonical Watson–Crick base pairs, but pairing between the third base of the codon and the first base of the anticodon follows less stringent rules, allowing some anticodons to recognize more than one codon, in accordance with Crick’s wobble hypothesis. Some codons for a particular amino acid are used more than the others. Nonsense suppression occurs when suppressor tRNAs read nonsense codons. 30.4 What Is the Structure of Ribosomes, and How Are They Assem- bled? Ribosomes are ribonucleoprotein particles that act as mechano- chemical systems in protein synthesis. They move along mRNA tem- plates, orchestrating the interactions between successive codons and the corresponding anticodons presented by aminoacyl-tRNAs. Ribosomes catalyze the formation of peptide bonds. Prokaryotic ribosomes consist of two subunits, 30S and 50S, which are composed of 50 different proteins and 3 rRNAs—16S, 23S, and 5S. The general shapes of the ribosomal subunits are determined by their rRNA molecules; ribosomal proteins serve a largely structural role in ribosomes. Ribosomes spontaneously self-assemble in vitro. The 30S subunit provides the decoding center that matches up the tRNA anticodons with the mRNA codons. The 50S subunit has the peptidyl transferase center that catalyzes peptide bond formation. This center consists solely of 23S rRNA; the ribosome is a ribozyme. Eukaryotic cytosolic ribosomes are lar ger than prokaryotic ribosomes. 30.5 What Are the Mechanics of mRNA Translation? Ribosomes move along the mRNA in the 5Ј→3Ј direction, recruiting aminoacyl-tRNAs whose anticodons match up with successive codons and joining amino acids in peptide bonds in a polymerization process that forms a particular protein. Protein synthesis proceeds in three distinct phases: initiation, elongation, and termination. Elongation involves two steps: peptide bond formation and translocation of the ribosome one codon further along the mRNA. At each stage, energy is provided by GTP hydrolysis, and specific soluble protein factors participate. Many of these soluble proteins are G-protein family members. Initiation involves binding of mRNA by the small ribosomal subunit, followed by binding of fMet-tRNA i f Met that recognizes the first codon. Elongation is accomplished via a repetitive cycle in which successive aminoacyl-tRNAs add to the ribosomeϺmRNA complex as directed by codon binding, the 50S subunit catalyzes peptide bond formation, and the polypeptide chain grows by one amino acid at a time. Ribosomes have three tRNA-binding sites: the A site, where incoming aminoacyl-tRNAs bind; the P site, where the growing peptidyl-tRNA chain is bound; and the E site, where deacylated tRNAs exit the ribosome. Ter- mination occurs when the ribosome encounters a stop codon in the mRNA. Polysomes are the active structures in protein synthesis. 30.6 How Are Proteins Synthesized in Eukaryotic Cells? The process of protein synthesis in eukaryotes strongly resembles that in prokary- otes, but the events are more complicated. Eukaryotic mRNAs have 5Ј-terminal 7 methyl G caps and 3Ј-polyadenylylated tails. Initiation of eukaryotic protein synthesis involves three stages and multiple proteins. This complexity offers many opportunities for regulation, and eukaryotic cells employ a variety of mechanisms for post-transcriptional regulation of gene expression. Many antibiotics are specific inhibitors of prokaryotic protein synthesis, making them particularly useful for the treatment of bacterial infections and diseases. PROBLEMS Preparing for an exam? Create your own study path for this chapter at www.cengage.com/login. 1. (Integrates with Chapter 12.) The following sequence represents part of the nucleotide sequence of a cloned cDNA: CAATACGAAGCAATCCCGCGACTAGACCTTAAC Can you reach an unambiguous conclusion from these data about the partial amino acid sequence of the protein encoded by this cDNA? 2. A random (AG) copolymer was synthesized using a mixture of 5 parts adenine nucleotide to 1 part guanine nucleotide as substrate. If this random copolymer is used as an mRNA in a cell-free protein synthesis system, which amino acids will be incorporated into the polypeptide product? What will be the relative abundances of these amino acids in the product? 3. Review the evidence establishing that aminoacyl-tRNA synthetases bridge the information gap between amino acids and codons. Indi- cate the various levels of specificity possessed by aminoacyl-tRNA Further Reading 985 synthetases that are essential for high-fidelity translation of messen- ger RNA molecules. 4. (Integrates with Chapter 11.) Draw base-pair structures for (a) a GϺC base pair, (b) a CϺG base pair, (c) a GϺU base pair, and (d) a UϺG base pair. Note how these various base pairs differ in the po- tential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical nucleic acid. 5. Point out why Crick’s wobble hypothesis would allow fewer than 61 anticodons to be used to translate the 61 sense codons. How might “wobble” tend to accelerate the rate of translation? 6. How many codons can mutate to become nonsense codons through a single base change? Which amino acids do they encode? 7. Nonsense suppression occurs when a suppressor mutant arises that reads a nonsense codon and inserts an amino acid, as if the nonsense codon were actually a sense codon. Which amino acids do you think are most likely to be incorporated by nonsense suppressor mutants? 8. Why do you suppose eukaryotic protein synthesis is only 10% as fast as prokaryotic protein synthesis? 9. If the tunnel through the large ribosomal subunit is 10 nm long, how many amino acid residues might be contained within it? (Assume that the growing polypeptide chain is in an extended ␤-sheet–like conformation.) 10. Eukaryotic ribosomes are larger and more complex than prokaryotic ribosomes. What advantages and disadvantages might this greater ribosomal complexity bring to a eukaryotic cell? 11. What ideas can you suggest to explain why ribosomes invariably exist as two-subunit structures, instead of a larger, single-subunit entity? 12. How do prokaryotic cells determine whether a particular methionyl- tRNA Met is intended to initiate protein synthesis or to deliver a Met residue for internal incorporation into a polypeptide chain? How do the Met codons for these two different purposes differ? How do eukaryotic cells handle these problems? 13. What is the Shine–Dalgarno sequence? What does it do? The effi- ciency of protein synthesis initiation may vary by as much as 100-fold for different mRNAs. How might the Shine–Dalgarno sequence be responsible for this difference? 14. In the protein synthesis elongation events described under the section on translocation, which of the following seems the most apt account of the peptidyl transfer reaction: (a) The peptidyl-tRNA delivers its peptide chain to the newly arrived aminoacyl-tRNA situated in the A site, or (b) the aminoacyl end of the aminoacyl-tRNA moves toward the P site to accept the peptidyl chain? Which of these two scenarios makes more sense to you? Why? 15. (Integrates with Chapter 15.) Why might you suspect that the elongation factors EF-Tu and EF-Ts are evolutionarily related to the G proteins of membrane signal transduction pathways described in Chapter 15? 16. How many ATP equivalents are consumed for each amino acid added to an elongating polypeptide chain during the process of protein synthesis? 17. Go to www.pdb.org and bring up PDB file 1GIX, which shows the 30S ribosomal subunit, the three tRNAs, and mRNA. In the box on the right titled “Images and Visualization,” click “All Images,” and then scroll down to look at the Interactive View. By moving your cursor over the image, you can rotate it to view it from any perspective. a. How are the ribosomal proteins represented in the image? b. How is the 16S rRNA portrayed? c. Rotate the image to see how the tRNAs stick out from the structure. Which end of the tRNA is sticking out? d. Where will these ends of the tRNAs lie when the 50S subunit binds to this complex? 18. Go back to www.pdb.org and bring up PDB file 1FFK, which shows the 50S ribosomal subunit. In the box titled “Images and Visualiza- tion,” click “All Images.” Scroll down to look at the Interactive View. Right-click the image to discover more information and tools. a. How many atoms are represented in this structure? b. Are the bases of the nucleotides visible anywhere in the structure? c. Can you find double helical re gions of RNA? d. Right-click and, under “Select,” select all proteins. Right-click again and select “Render,” then “Scheme,” and then “CPK Space- fill” to highlight the ribosomal proteins. Go back and cancel the protein selection. Then select “Nucleic,” and render nucleic acid in “CPK Spacefill.” Which macromolecular species seems to pre- dominate the structure? Preparing for the MCAT Exam 19. Review the list of Shine–Dalgarno sequences in Figure 30.18 and select the one that will interact best with the 3Ј-end of E. coli 16S rRNA. 20. Chloramphenicol (Figure 30.31) inhibits the peptidyl transferase activity of the 50S ribosomal subunit. The 50S peptidyl transferase active site consists solely of functionalities provided by the 23S rRNA. What sorts of interactions do you think take place when chloramphenicol binds to the peptidyl transferase center? Which groups on chloramphenicol might be involved in these interactions? FURTHER READING General Cech, T. R., Atkins, J. F., and Gesteland, R. F., 2005. The RNA World, 3rd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Lewin, B., 2008. Genes IX. Sudbury, MA: Jones and Bartlett. The Genetic Code Cedergren, R., and Miramontes, P., 1996. The puzzling origin of the genetic code. Trends in Biochemical Sciences 21:199–200. Huttenhofer, A., and Bock, A., 1998. RNA structures involved in seleno- protein synthesis. In RNA Structure and Function, Simons, R. W., and Grunberg-Monago, M., eds., pp. 603–639. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Khorana, H. G., et al., 1966. Polynucleotide synthesis and the genetic code. Cold Spring Harbor Symposium on Quantitative Biology 31:39–49. The use of synthetic polyribonucleotides in elucidating the genetic code. Knight, R. D., et al., 1999. Selection, history, and chemistry: Three faces of the genetic code. Trends in Biochemical Sciences 24:241–247. Nirenberg, M. W., and Leder, P., 1964. RNA codewords and protein synthesis. Science 145:1399–1407. Nirenberg, M. W., and Matthaei, J. H., 1961. The dependence of cell- free protein synthesis in E. coli upon naturally occurring or synthetic polyribonucleotides. Proceedings of the National Academy of Sciences U.S.A. 47:1588–1602. Wang, L., Xie, J., and Schultz, P. G., 2006. Expanding the genetic code. Annual Review of Biophysics and Biomolecular Structure 35:225–249. Aminoacylation of tRNAs and the Second Genetic Code Arnez, J. G., and Moras, D., 1997. Structural and functional considera- tions of the aminoacylation reaction. Trends in Biochemical Sciences 22:211–216. Carter, C. W., Jr., 1993. Cognition, mechanism, and evolutionary rela- tionships in aminoacyl-tRNA synthetases. Annual Review of Biochem- istry 62:715–748. Hale, S. P., et al., 1997. Discrete determinants in transfer RNA for editing and aminoacylation. Science 276:1250–1252. Ibba, M., Curnow, A. W., and Söll, D., 1997. Aminoacyl-tRNA synthesis: Divergent routes to a common goal. Trends in Biochemical Sciences 22:39–42. 986 Chapter 30 Protein Synthesis Normanly, J., and Abelson, J., 1989. tRNA identity. Annual Review of Bio- chemistry 58:1029–1049. Review of the structural features of tRNA that are recognized by aminoacyl-tRNA synthetases. Park, S. G., Ewalt, K. L., and Kim, S. 2005. Function expansion of aminoacyl-tRNA synthetases and their interacting factors: New per- spectives on housekeepers. Trends in Biochemical Sciences 30:569–574. Perona, J. J., and Hou, Y. M., 2007. Indirect readout of tRNA for aminoacylation. Biochemistry 46:10419–10432. Schimmel, P., and Schmidt, E., 1995. Making connections: RNA-dependent amino acid recognition. Trends in Biochemical Sciences 20:1–2. Sheppard, K., Yuan, J., Hohn, M. J., Jester B., Devine K. M., and Söll, D., 2008. From one amino acid to another: tRNA-dependent amino acid biosynthesis. Nucleic Acids Research 36:1813–1825. Codon–Anticodon Recognition Crick, F. H. C., 1966. Codon–anticodon pairing: The wobble hypothesis. Journal of Molecular Biology 19:548–555. Crick’s original paper on wobble interactions between tRNAs and mRNA. Crick, F. H. C., et al., 1961. General nature of the genetic code for proteins. Nature 192:1227–1232. An insightful paper on insertion/ deletion mutants providing convincing genetic arguments that the genetic code was a triplet code, read continuously from a fixed start- ing point. This genetic study foresaw the nature of the genetic code, as later substantiated by biochemical results. Ribosome Structure and Function Ban, N., et al., 2000. The complete atomic structure of the large ribosomal subunit at 2.4 Å resolution. Science 289:905–920. Carter, A. P., et al., 2000. Functional insights from the structure of the 30S ribosomal subunit and its interactions with antibiotics. Nature 407:340–348. Cate, J. H., et al., 1999. X-ray crystal structure of 70S functional ribosomal complexes. Science 285:2095–2104. Kaminishi, T., Wilson, D. N., Takemoto, C., Harms, J. M., et al., 2007. A snapshot of the 30S ribosomal subunit capturing mRNA via the Shine-Dal garno interaction. Structure 15:289–297. Korostelev, A., and Noller, H. F., 2007. The ribosome in focus: New structures bring new insights. Trends in Biochemical Sciences 32:434–441. Moore, P. B., and Steitz, T. A., 2002. The involvement of RNA in ribosome function. Nature 418:229–235. Ogle, J. M., Carter, A. P., and Ramakrishnan, V., 2003. Insights into the decoding mechanism from recent ribosome structures. Trends in Biochemical Sciences 28:259–266. Ramakrishnan, V., 2002. Ribosome structure and the mechanism of translation. Cell 108:557–572. Spahn, C. M. T., et al., 2001. Structure of the 80S ribosome from Sac- charomyces cerevisiae–tRNA-ribosome and subunit–subunit interactions. Cell 107:373–386. Stark, H., et al., 2002. Ribosome interactions of aminoacyl-tRNA and elongation factor Tu in the codon-recognition complex. Nature Structural Biology 9:849–854. Tenson, T., and Ehrenberg, M., 2002. Regulatory nascent peptides in the ribosomal tunnel. Cell 108:591–594. Valle, M., et al., 2002. Locking and unlocking of ribosomal motions. Cell 114:123–134. T he Ribosome Is a Ribozyme Cech, T. R., 2000. The ribosome is a ribozyme. Science 289:878–879. Green, R., Samaha, R. R., and Noller, H. F., 1997. Mutations at nucleotides G2251 and U2585 of 23 S rRNA perturb the peptidyl transferase center of the ribosome. Journal of Molecular Biology 266:40–50. Green, R., Switzer, C., and Noller, H. F., 1998. Ribosome-catalyzed peptide-bond formation with an A-site substrate covalently linked to 23S ribosomal RNA. Science 280:286–289. Protein Synthesis: Initiation, Elongation, and Termination Factors Allen, G. S., Zavialov, A., Gursky, R., Ehrenberg, M., and Frank, J., 2005. The cryo-EM structure of a translation initiation complex from Escherichia coli. Cell 121:703–712. Beringer, M., 2008. Modulating the activity of the peptidyl transferase center of the ribosome. RNA 14:795–801. Beringer, M., and Rodnina, M. V., 2007. The ribosomal peptidyl transferase. Molecular Cell 26:311–321. Bieling, P., Beringer, M., Adio, S., and Rodnina, M. V., 2006. Peptide bond formation does not involve acid–base catalysis by ribosomal residues. Nature Structural and Molecular Biology 13:423–428. Clark, B. F. C., and Nyborg, J., 1997. The ternary complex of EF-Tu and its role in protein synthesis. Current Opinion in Structural Biology 7:110–116. Clark, B. F. C., et al., eds., 1996. Prokaryotic and eukaryotic translation factors. Biochimie 78:1119–1122. Dever, T. E., 1999. Translation initiation: Adept at adapting. Trends in Biochemical Sciences 24:398–403. Ehrenberg, M., and Tenson, T., 2002. A new beginning to the end of translation. Nature Structural Biology 9:85–87. Nissen, P., et al., 1995. Crystal structure of the ternary complex of Phe- tRNA Phe , Ef-Tu, and a GTP analog. Science 270:1464–1472. Ogle, J. M., and Ramakrishnan, R., 2005. Structural insights into translational fidelity. Annual Review of Biochemistry 74:129–177. Poole, E. S., Askarian-Amiri, M. E., Major, L. L., McCaughan, K. K., et al., 2003. Molecular mimicry in the decoding of translational stop signals. Progress in Nucleic Acids Research and Molecular Biology 74: 83–121. Voss, N. R., Gerstein, M., Steitz, T. A., and Moore, P. B., 2006. The geometry of the ribosomal polypeptide exit tunnel. Journal of Molec- ular Biology 360:893–906. Zavialov, A. V., and Ehrenberg, M., 2003. Peptidyl-tRNA regulates the GTPase activity of translation factors. Cell 114:113–122. Eukaryotic Protein Synthesis Gingras, A-C., et al., 1999. eIF-4 initiation factors: Effectors of mRNA re- cruitment to ribosomes and regulators of translation. Annual Review of Biochemistry 68:913–963. Hinnebush, A. G., 2006. eIF3: A versatile scaffold for translation initiation complexes. Trends in Biochemical Sciences 31:553–562. Matsuo, H., et al. 1997. Structure of translation factor eIF4E bound to 7mGDP and interaction with 4E-binding protein. Nature Structural Biology 4:717–724. Pain, V. M., 1996. Initiation of protein synthesis in eukaryotic cells. Eu- ropean Journal of Biochemistry 236:747–771. Rhoads, R. E., 1999. Signal transduction pathways that regulate eukaryotic protein synthesis. Journal of Biological Chemistry 274:30337–30340. Rhoads, R., Dinkova, T. D., and Komeeva, N. L., 2006. Mechanism and regulation of translation in C. elegans. WormBook 28:1–18. Sachs, A. B., and Varani, G., 2000. Eukaryotic translation initiation: There are two sides (at least) to every story. Nature Structural Biology 7:356–361. Samuel, C. E., 1993. The eIF-2a protein kinases, regulators of translation in eukaryotes from yeast to humans. Journal of Biological Chem- istry 268:7603–7606. Tarun, S. Z., Jr., et al., 1997. Translation factor eIF4G mediates in vitro poly(A) tail dependent translation. Proceedings of the National Acad- emy of Sciences U.S.A. 94:9046–9051. Protein Synthesis Inhibitors Endo, Y., et al., 1987. The mechanism of action of ricin and related toxic lectins on eukaryotic ribosomes. The site and the characteristics of the modification in 28S ribosomal RNA caused by the toxins. Jour- nal of Biological Chemistry 262:5908–5912. Hermann, T., 2005. Drugs targeting the ribosome. Current Opinion in Structural Biology 15:355–366. Polacek, N., and Mankin, A. S., 2005. The ribosomal peptidyl transferase center: Structure, function, evolution, inhibition. Critical Re- views in Biochemistry and Molecular Biology 40:285–311. Schlünzen, F., et al., 2000. Structural basis for the interaction of antibiotics with the peptidyl transferase center in eubacteria. Nature 413: 814–821. Yonath, A., 2005. Antibiotics targeting ribosomes: Resistance, selectivity, synergism, and cellular regulation. Annual Review of Biochemistry 74: 649–679. Gabriel Vong 31 Completing the Protein Life Cycle: Folding, Processing, and Degradation The human genome apparently contains about 20,500 genes, but some estimates suggest that the total number of proteins in the human proteome may approach 1 million. What processes introduce such dramatically increased variation into the products of protein-encoding genes? We’ve reviewed (or will soon cover) many of these processes; a partial list (with examples) includes: 1. Gene rearrangements (immunoglobulin G) 2. Alternative splicing (fast skeletal muscle troponin T) 3. RNA editing (apolipoprotein B) 4. Proteolytic processing (chymotrypsinogen or prepro-opiomelanocortin; see Chapter 32) 5. Isozymes (lactate dehydrogenase) 6. Protein sharing (the glycolytic enzyme enolase is identical to ␶-crystallin in the eye) 7. Protein–protein interactions at many levels (oligomerization, supramolecular complexes, assembly of signaling pathway protein complexes upon scaffold proteins) 8. Covalent modifications of many kinds (phosphorylation or glycosylation, with multisite phosphorylation or variable degrees of glycosylation, to name just two of the dozens of possibilities) Thus, the nascent polypeptide emerging from a ribosome is not yet the agent of biological function that is its destiny. First, the polypeptide must fold into its native tertiary structure. Even then, seldom is the nascent, folded protein in its final functional state. Proteins often undergo various proteolytic processing reactions and covalent modifications as steps in their maturation to functional molecules. Finally, at the end of their usefulness, damaged by chemical reactions or dena- tured due to partial unfolding, they are degraded. In addition, some proteins are targeted for early destruction as part of regulatory programs that carefully control available amounts of particular proteins. Damaged or misfolded proteins are a se- rious hazard; accumulation of protein aggregates can be a cause of human disease, including the prion diseases (see Chapter 28) and diseases of amyloid accumulation, such as Alzheimer’s, Parkinson’s, or Huntington’s disease. 31.1 How Do Newly Synthesized Proteins Fold? As Christian Anfinsen pointed out 40 years ago, the information for folding each protein into its unique three-dimensional architecture resides within its amino acid sequence or primary structure (see Chapter 6). Proteins begin to fold even before their synthesis by ribosomes is completed (Figure 31.1a). However, the cytosolic environment is a very crowded place, with effective protein concentrations as high as 0.3 grams/mL. Macromolecular crowding enhances the likelihood of nonspecific protein association and aggregation. The primary driving force for protein folding is the burial of hydrophobic side chains away from the aqueous solvent and reduction in Vong’s Flying Crane. Origami—the Asian art of paper folding—arose in China almost 2000 years ago when paper was rare and expensive and the folded shape added special meaning. Protein folding, like origami, takes a functionless form and creates a structure with unique identity and purpose. Life is a process of becoming, a combination of states we have to go through. Anais Nin (1903–1977) KEY QUESTIONS 31.1 How Do Newly Synthesized Proteins Fold? 31.2 How Are Proteins Processed Following Translation? 31.3 How Do Proteins Find Their Proper Place in the Cell? 31.4 How Does Protein Degradation Regulate Cellular Levels of Specific Proteins? ESSENTIAL QUESTION Proteins are the agents of biological function. Protein turnover (synthesis and decay) is a fundamental aspect of each protein’s natural history. How are newly synthesized polypeptide chains transformed into mature, active proteins, and how are undesired proteins removed from cells? Create your own study path for this chapter with tutorials, simulations, animations, and Active Figures at www.cengage.com/login. Nascent means “undergoing the process of being born”or, in the molecular sense,“newly synthesized.” 988 Chapter 31 Completing the Protein Life Cycle: Folding, Processing, and Degradation solvent-accessible surface area (see Chapter 6). The folded protein typically has a buried hydrophobic core and a hydrophilic surface. Protein aggregation is typically driven by hydrophobic interactions, so burial of hydrophobic regions through folding is a crucial factor in preventing aggregation. To evade such problems, nascent proteins are often assisted in folding by a family of helper proteins known as molecular chaperones (see Chapter 6), because, like the chaperones at a prom, their purpose is to prevent inappropriate liaisons. Chaperones also serve to shepherd proteins to their ultimate cellular destinations. Also, mature proteins that have become partially unfolded may be rescued by chaperone-assisted refolding. Chaperones Help Some Proteins Fold A number of chaperone systems are found in all cells. Many of the proteins in these systems are designated by the acronym Hsp (for heat shock protein) and a number indicating their relative mass in kilodaltons (as in Hsp60). Hsps were originally observed as abundant proteins in cells given brief exposure to high temperature (42° C or so). The principal Hsp chaperones are Hsp70, Hsp60 (the chaperonins), and Hsp90. In general, proteins whose folding is chaperone-dependent pass down a pathway in which Hsp70 acts first on the newly synthesized protein and then passes the partially folded intermediate to a chaperonin for completion of folding. Nascent polypeptide chains exiting the large ribosomal subunits are met by ribosome-associated chaperones (TF, or trigger factor, in Escherichia coli; NAC HUMAN BIOCHEMISTRY Alzheimer’s, Parkinson’s, and Huntington’s Disease Are Late-Onset Neurodegenerative Disorders Caused by the Accumulation of Protein Deposits As noted in Chapter 6, protein misfolding problems can cause disease by a variety of mechanisms. For example, protein aggregates can impair cell function. Amyloid plaques (so named because they resemble the intracellular starch, or amyloid, deposits found in plant cells) and neurofibrillary tangles (NFTs) are proteinaceous deposits found in the brains of individuals suffering from any of several neu- rogenerative diseases. In each case, the protein is different. In Alzheimer’s, disease is caused both by extracellular amyloid deposits composed of proteolytic fragments of the amyloid precursor protein (APP) termed amyloid-␤ (A␤) and intracellular NFTs composed of the microtubule-binding protein tau (␶). A␤ is a peptide 39 to 43 amino acids long that polymerizes to form long, highly ordered, insoluble fibrils consisting of a hydrogen-bonded parallel ␤-sheet structure in which identical residues on adjacent chains are aligned directly, in register (see accompanying figure). Why A␤ aggregates in some people but not others is not clear. In Parkinson’s, the culprit is NFTs composed of polymeric ␶; no amyloid plaques are evident. In Huntington’s disease, the protein deposits occur as nuclear inclu- sions composed of polyglutamine (polyQ) aggregates. PolyQ aggregates arise from mutant forms of huntingtin, a protein that charac- teristically has a stretch of glutamine residues close to its N-terminus. Huntingtin is a 3144-residue protein encoded by the ITI5 gene, which has 67 exons. Exon 1 encodes the polyglutamine region. In- dividuals whose huntingtin gene has fewer that 35 CAG (glutamine codon) repeats never develop the disease; those with 40 or more al- ways develop the disease within a normal lifetime. The nuclear in- clusions in Huntington’s disease are huntingtin-derived polyglutamine fragments that have aggregated to form ␤-sheet–containing amyloid fibrils. Impairment of cellular function by proteinaceous deposits may be a general phenomenon. In vitro experiments have demonstrated that aggregates of proteins not associated with disease can be cytotoxic, and the ability to form amyloid deposits is a general property of proteins. The evolution of chaperones to assist protein folding and proteasomes to destroy improperly folded proteins may have been driven by the necessity to prevent protein aggregation. 12 Fibril axis 24 30 40 ᮡ A model for the A␤ 1–40 structural unit in ␤-amyloid fibrils. Fibrils con- tain ␤-strands perpendicular to the fibril axis, with interstrand hydrogen bonding parallel to the fiber axis. The top face of the ␤-sheet is hydrophobic and presumably interacts with neighboring A␤ molecules in fibril formation. (Figure adapted from Figure 1 in Thompson, L. K., 2003. Unraveling the secrets of Alzheimer’s ␤-amyloid fibrils. Proceedings of the National Academy of Sciences, U.S.A. 100:383–385.) 31.1 How Do Newly Synthesized Proteins Fold? 989 [nascent chain-associated complex] in eukaryotes). In E. coli, the 50S ribosomal protein L23, which is situated at the peptide exit tunnel, serves as the docking site for TF, directly linking protein synthesis with chaperone-assisted protein folding. TF and NAC mediate transfer of the emerging nascent polypeptide chain to the Hsp70 class of chaperones, although many proteins do not require this step for proper folding. Hsp70 Chaperones Bind to Hydrophobic Regions of Extended Polypeptides In Hsp70-assisted folding, proteins of the Hsp70 class bind to nascent polypeptide chains while they are still on ribosomes (Figure 31.1b). Hsp70 (known as DnaK in E. coli) recognizes exposed, extended regions of polypeptides that are rich in hydrophobic residues. By interacting with these regions, Hsp70 prevents nonproductive associations and keeps the polypeptide in an unfolded (or partially folded) state until productive folding interactions can occur. Completion of folding requires release of the protein from Hsp70; release is energy-dependent and is driven by ATP hydrolysis. Hsp70 proteins such as DnaK consist of two domains: a 44-kD N-terminal ATP- binding domain and an 18-kD central domain that binds polypeptides with exposed hydrophobic regions (Figure 31.2a). The DnaKϺATP complex receives an unfolded (or partially folded) polypeptide chain from DnaJ (Figure 31.2b). DnaJ is an Hsp40 family member. Interaction of DnaK with DnaJ triggers the ATPase activity of DnaK; the DnaKϺADP complex forms a stable complex with the unfolded polypeptide, preventing its aggregation with other proteins. A third protein, GrpE, catalyzes nucleotide exchange on DnaK, replacing ADP with ATP, which converts DnaK back to a conformational form having low affinity for its polypeptide substrate. Release of the polypeptide gives it the opportunity to fold. Multiple cycles of interaction with DnaK (or Hsp70) give rise to partially folded intermediates or, in some cases, completely folded proteins. The partially folded intermediates may be passed along to the Hsp60/chaperonin system for completion of folding (Figure 31.1c). ~85% ~15% GroEL GroES Hsp70 (a) (b) (c) FIGURE 31.1 Protein folding pathways. (a) Chaperone- independent folding.The protein folds as it is synthesized on the ribosome (green) (or shortly thereafter). (b) Hsp70- assisted protein folding. Hsp70 (gray) binds to nascent polypeptide chains as they are synthesized and assists their folding.(c) Folding assisted by Hsp70 and chaperonin complexes.The chaperonin complex in E. coli is GroES–GroEL.The majority of proteins fold by pathways (a) or (b). (Adapted from Figure 2 in Netzer, W.J., and Hartl, F. U., 1998. Protein folding in the cytosol: Chaperonin-dependent and -independent mechanisms. Trends in Biochemical Sciences 23: 68–73; and Figure 2 in Hartl, F.U., and Hayer-Hartl, M., 2002. Molec- ular chaperones in the cytosol: From nascent chain to folded protein, Science 295:1852–1858.) ATPase domain 1 385 393 537 638 N N C C C D E B A L 1,2 L 3,4 L 4,5 L 5,6 5 6 1 2 7 8 4 3 Peptide-binding domain Domain organization and structure of the Hsp70 family member, DnaK (a) ATP J J J ATP ADP I N GroEL DnaJ DnaK DnaJ-U U, I ADP, DnaJ GrpE P i DnaK mechanism of action(b) FIGURE 31.2 Structure and function of DnaK: (a) Domain organization and structure of the Hsp70 family member, DnaK.The ribbon diagram on the lower left is the ATP-binding domain of the DnaK analog, bovine Hsc70; bound ADP is shown as a stick diagram (purple). The ribbon diagram on the lower right is the polypeptide- binding domain of DnaK.The small blue ovals highlight the position of the polypeptide substrate; the protein regions that bind the polypeptide substrate are blue-green. (b) DnaK mechanism of action: DnaJ binds an unfolded protein (U) or partially folded intermediate (I) and delivers it to the DnaKϺATP complex.The nucleotide exchange protein GrpE replaces ADP with ATP on DnaK and the partially folded intermediate ([I]) is released. I has several possible fates: It may fold into the native state, N; it may undergo another cycle of interaction with DnaJ and DnaK; or it may be become a substrate for folding by the GroEL chaperonin system. (Adapted from Figures 1a and 2a in Frydman, J., 2001.Folding of newly translated proteins in vivo:The role of molecular chaperones. Annual Review of Biochemistry 70:603–647.) 990 Chapter 31 Completing the Protein Life Cycle: Folding, Processing, and Degradation The GroES–GroEL Complex of E. coli Is an Hsp60 Chaperonin The Hsp60 class of chaperones, also known as chaperonins, assists some partially folded proteins to complete folding after their release from ribosomes. Chaperonins sequester partially folded molecules from one another (and from extraneous interactions), allowing folding to proceed in a protected environment. This protected environment is sometimes referred to as an “Anfinsen cage” because it provides an enclosed space where proteins fold spontaneously, free from the possibility of aggregation with other proteins. Chaperonins are large, cylindrical protein complexes formed from two stacked rings of subunits. The chaperonins have been organized into two groups, I and II, on the basis of their source and structure. Group I chaperonins are found in bacteria, group II in archaea and eukaryotes. The group I chaperonin in E. coli is the GroES–GroEL complex (Figure 31.1c). GroEL is made of two stacked seven-membered rings of 60-kD subunits that form a cylindrical ␣ 14 oligomer 15 nm high and 14 nm wide (Figure 31.3). Each GroEL ring has a 5-nm central cavity where folding can take place. This cavity can accommodate proteins up to 60 kD in size. GroES, sometimes referred to as a co-chaperonin, consists of a single seven- membered ring of 10-kD subunits that sits like a dome on one end of GroEL (Figure A DEEPER LOOK How Does ATP Drive Chaperone-Mediated Protein Folding? The chaperones that mediate protein folding do so in an ATP- dependent manner, as illustrated in Figures 31.2 and 31.3. The affinity of chaperones for their unfolded or misfolded protein substrates is determined by the nature of the nucleotide bound by the ATP-binding domain of these proteins, which functions as an ATPase. If ATP is bound, the chaperone adopts a conformation with an open substrate-binding pocket. ATP increases the rate of association of the chaperone Hsp70 (DnaK) with an unfolded peptide or protein substrate by 100-fold, but it increases the rate of dissociation of the unfolded protein from the chaperone even more, by a factor of 1000. Overall, the chaperone’s affinity for an unfolded protein substrate decreases 10-fold (or more) when it binds ATP. On the other hand, if the substrate-binding site on the peptide- binding domain of DnaK is occupied by an unfolded protein substrate in conjunction with binding of the co-chaperone (DnaJ in Figure 31.2), ATP hydrolysis by the ATPase domain is triggered. The presence of ADP in the ATP-binding (ATPase) domain causes a shift in the substrate-binding site of the peptide-binding domain to a closed conformation, high-affinity state. Thus, ATP-dependent chaperones cycle between two stable conformational states, just like allosteric proteins. Bound ATP favors the open conformation for the protein substrate-binding site, and ADP favors the closed conformation. (When ADP is released and no nucleotide occupies the ATP-binding site of the ATPase domain, the peptide-binding site remains in the closed, high-affinity conformation; see Figure 31.2). What is the underlying mechanism that controls these ATP- regulated conformational changes? The ATP-Dependent Allosteric Regulation of Hsp70 Chaperones Is Controlled by a Proline Switch Clearly, the two domains of Hsp70 (DnaK)—the peptide-binding domain and the ATP-binding (or ATPase) domain—communicate with each other, because the nature of the nucleotide bound to the ATP domain determines the affinity of the peptide-binding domain for unfolded substrates. Markus Vogel, Bernd Bukau, and Matthais Mayer of the Center for Molecular Biology at the University of Heidelberg (Germany) argue that four distinct elements are needed for communication between these separate domains: an ATP sensor (which must include residues within the ATP-binding site), a transducer (to communicate the presence of ATP to the distant peptide-binding site), a lever (operated by the ATP-binding domain to exert its effect on the distant peptide-binding domain), and a switch that controls the lever (the switch is needed to lock the protein in either the open conformation or the closed conformation so that either alternative conformation is stable). The switch that controls the conformational transitions of Hsp70 involves two universally conserved residues in the ATPase domain of Hsp70 family members, a proline (Pro 143 ) and a surface-exposed arginine (Arg 151 ; panel a of the figure). Pro 143 is the switch, and Arg 151 is a relay for the lever. Replacement of either of these residues by amino acid substitutions disrupts and/or destabilizes the switch. Other nearby residues, Glu 171 and Lys 70 , function as ATP sensors. It is believed that Lys 70 also serves as the nucleophile that initiates ATP hydrolysis through attack on the ␥-phosphate of ATP. Arg 151 acts as a relay between Pro 143 , events occurring during ATP hydrolysis, and the peptide-binding domain (panels b–d of the figure). When ATP binding is sensed by Lys 70 and Glu 171 (panel b), Pro 143 is shifted, which causes Arg 151 to move in the direction of the peptide-binding domain of DnaK (panel c). In turn, this protein-binding domain assumes the open, low- affinity conformation. The interaction of DnaK with an unfolded protein substrate and co-chaperone DnaJ moves Arg 151 back toward Pro 143 , which causes Lys 70 and Glu 171 to initiate ATP hydrolysis (panel d). ADP now occupies the nucleotide-binding site of the ATPase domain, and the protein-binding domain of DnaK is locked in the closed, high-affinity conformation. The consequence of these events is that DnaK cycles between binding and releasing unfolded (or partially folded) proteins, fueled by ATP hydrolysis within the ATPase domain. In effect, ATP binding and hydrolysis drive DnaK from an open, low-affinity conformational state to a closed, high-affinity conformational state. When unfolded (or partially folded) proteins are not held by DnaK, they have the opportunity to fold so that any solvent-accessible hydrophobic surfaces they might still retain are buried. Once a protein has adopted a stable folded state, it lacks exposed hydrophobic surfaces and thus escapes the cycle of binding and release by DnaK. More generally, Hsp70 provides an elegant example of protein conformational transitions based on the binding of ATP versus ADP at an effector site, with the added dimension that the effector site in this case is also an ATPase. 31.1 How Do Newly Synthesized Proteins Fold? 991 31.3). The end of GroEL where GroES is sitting is referred to as the apical end. Each GroEL subunit has two structural domains: an equatorial domain that binds ATP and interacts with neighbors in the other ␣ 7 ring and an apical domain with hydrophobic residues that can interact with hydrophobic regions on partially folded proteins. The apical domain hydrophobic patches face the interior of the central cavity. An unfolded (or partially folded) protein binds to the apical patches and is delivered to the central cavity of the upper ␣ 7 ring (Figure 31.3c). ATP binding to the subunits of the upper ␣ 7 ring causes rapid (Ͻ100 msec), forced unfolding of the substrate protein, followed by two events that occur on a slower time scale (ϳ1 sec): (1) GroES is re- cruited to GroEL, and (2) the ␣-subunits undergo a conformational change that buries their hydrophobic patches. The ␣-subunits now present a hydrophilic surface to the central cavity. This change displaces the bound partially folded polypeptide into the sheltered hydrophilic environment of the central cavity, where it can fold, free from danger of aggregation with other proteins. GroES also promotes ATP hydrolysis (Figure 31.3c). The GroELϺADPϺGroES complex dissociates when ATP binds to the subunits of the other (lower) ␣ 7 ring. Dissociation of GroES allows the partially folded (or folded) protein to escape from GroEL. If the protein has achieved its native conformation, its hydrophobic residues will be buried in its core and the hy- (a) OOP ␣ O O OP ␤ OP ␥ O Mg E171 w O w w w w O O R151 K70 P143 ATP sensors Switch Relay (b) P143 OOP ␣ O O OP ␤ OP ␥ O Mgw O w w w w O O E171 R151 K70 E171 R151 K70 P143 (c) ATP sensors Switch Relay P143 OOP ␣ O O OP ␤ OP ␥ O Mgw O w w w w O O E171 R151 K70 E171 R151 K70 P143 (d) ATPase catalysts Switch Relay ᮡ (a) Side chains involved in the ATP- and ADP-dependent allosteric regulation of the Hsp70 family member DnaK. Lower numbers indicate DnaK amino acid residues; upper numbers indicate the corresponding residues in Hsc70 (the human counterpart to DnaK). This illustration highlights residues in or near the ATP-binding site of the ATPase domain. The site is occupied by ADP, P i , one Mg 2ϩ , and two K ϩ ions. See Figure 31.2a for the location of this site within the ATPase domain. Carbon atoms are gray; oxygen, red; nitrogen, blue; and phosphorus, yellow. P143 sits at the center of an H-bonded network of residues, which includes K70, Y145, F146, R151, and E171. (b–d) The mechanism of ATP- and ADP-dependent allosteric transitions in Hsp70. Events in the ATP-binding site of the ATPase domain are communicated to the protein-binding site of the peptide-binding domain through K70 and E171, which act as ATP sensors; P143, which acts as the switch; and R151, which is part of the lever that relays the events from the ATPase domain to the other domain. (a: Adapted from Figure 1 in Vogel, M., Bukau, B., and Mayer, M. P., 2006. Allosteric regulation of Hsp70 chaperones by a proline switch. Molecular Cell 21:359–367. Courtesy of Bernd Bukau and Matthias Mayer. b–d: Adapted from Figure 6 in Vogel, M., Bukau, B., and Mayer, M. P., 2006. Allosteric regulation of Hsp70 chaperones by a proline switch. Molecular Cell 21:359–367.) 992 Chapter 31 Completing the Protein Life Cycle: Folding, Processing, and Degradation drophobic patches on the ␣ 7 rings will have no affinity for it. On the other hand, if the protein is only partially folded, it may be bound again, gaining access to the Anfinsen cage of the ␣ 7 ring and another cycle of folding. The folding of rhodanese, a 33-kD protein, requires the hydrolysis of about 130 equivalents of ATP. The group II chaperonin and eukaryotic analog of GroEL, CCT (also called TriC) is also a double-ring structure, but each ring consists of eight different subunits that vary in size from 50 to 60 kD. Furthermore, group II chaperonins lack a GroES counterpart. Prefoldin (also known as GimC), a hexameric protein composed of six subunits from two related classes (two ␣ and four ␤), can serve as a co-chaperone for CCT, much as GroES does for GroEL. However, prefoldin also acts like an Hsp70 protein, because it binds unfolded polypeptide chains emerging from ribosomes and delivers them to CCT. Prefoldin resembles a jellyfish, with six tentacle-like coiled coils extending from a barrel-shaped body. The ends of the ten- tacles have hydrophobic patches for binding unfolded proteins. Prior to substrate protein binding, CCT exists in a partly open state. ATP binding opens the ring even more, a state in which prefoldin delivers the substrate protein. ATP hydrolysis closes the chamber and drives the folding process. ATP- induced conformation changes that promote protein folding propagate from one subunit to the next around the ring structure. The Eukaryotic Hsp90 Chaperone System Acts on Proteins of Signal Transduction Pathways Hsp 90 constitutes 1% to 2% of the total cytosolic proteins of eukaryotes, its abundance reflecting its importance. Like other Hsp chaperones, its action depends on cyclic binding and hydrolysis of ATP. Conformational regulation of signal transduction molecules seems to be a major purpose of Hsp90. Receptor tyrosine kinases, soluble tyro- (b) ATP ATP 7 GroES 7 U, I (c) ~ 15 sec ~ 1 sec< 100 ms 7 P i 7 ADP, GroES N ADP ADPATP ATP ATP ATP FIGURE 31.3 Structure and function of the GroEL–GroES complex. (a) Structure and overall dimensions of GroEL–GroES (top view, left; side view, right) (pdb id ϭ 1AON). (b) Section through the center of the complex to reveal the central cavity. (c) Model of the GroEL cylin- der (blue) in action. An unfolded (U) or partially folded (I) polypeptide binds to hydrophobic patches on the apical ring of ␣ 7 -subunits, followed by ATP binding, forced protein unfolding, and GroES (red) association. (a) 140 A ° 80 A ° 10 A ° 33 A ° 80 A ° 71 A ° 184 A °

Định dạng
Số trang	10
Dung lượng	723,53 KB