Dissertation Effects of SW20.1 on suppressing Adipogenesis in 3T3-L1 Adipocytes via the ATF3-Resistin Pathway and attenuating obesity-induced metabolic dysfunction in High Fat diet-induc
Introduction
Background
Obesity is one of the most prevalent metabolic disorders worldwide, affecting 61 percent of adults, and is associated with various medical illnesses, such as dyslipidemia, diabetes mellitus, hypertension, malignancies, and osteoarthritis [1, 2] These associations are contingent upon the excessive differentiation and proliferation of adipocytes Adipogenesis is characterized by structural alterations, lipid accumulation, lipogenic enzyme production, and the storage of excess energy as triglyceride (TG) in adipocytes [3-5] Inhibition of adipogenesis and TG deposition in adipocytes may therefore be of critical therapeutic value in drugs designed to treat or prevent Obesity
The primary treatment for Obesity is a change in lifestyle [6] Nevertheless, pharmacotherapy is recommended when these methods are ineffective or when Obesity is severe Although certain anti-obesity medications have been approved and marketed, however, some of them have been discontinued due to severe adverse effects, such as: Amphetamines, rimonabant, and sibutramine [7, 8] Therefore, there is an urgent need to produce effective and safe anti-obesity medications
Adipose tissue consists of white adipose tissue (WAT), brown adipose tissue (BAT), and brite adipose tissue and is involved in both energy storage and thermogenesis regulation Adipose tissue also secretes numerous hormones, cytokines, and metabolites, which are known as the adipokines
[9] Resistin is an adipose tissue-derived signaling cysteine-rich protein An elevated plasma resistin level is associated with various dysfunctions, including altered lipid and carbohydrate metabolism, inflammation, and insulin resistance [10] Furthermore, resistin is related to knee osteoarthritis, ovarian cancer, and acute pancreatitis [11-13] A human study revealed the association of resistin with obesity and impaired insulin sensitivity [14]
Salvia miltiorrhiza (or S miltiorrhiza radix) is a member of the Labiatae family Because of its beneficial ability to enhance cardiovascular health and reduce platelet aggregation, S miltiorrhiza is a well-known herb used to treat numerous ailments in traditional Chinese medicine [15] S miltiorrhiza contains multiple chemical substances More than 50 water-soluble components and 30 liposoluble components have been identified in S miltiorrhiza [16] Most water-soluble components of S miltiorrhiza exhibit antioxidative, anticoagulant, and myocardial protective effects, which are mainly attributed to blood activation and blood clot elimination [15, 17] Primary tanshinones, which are liposoluble components of S miltiorrhiza, exhibit antibacterial, anti-inflammatory, and myocardial protective effects and protective effects for endothelial cells [18] In addition to tanshinone I and tanshinone IIA, several specific liposoluble components of S miltiorrhiza have been determined to exert antiobesity effects [19, 20]
Activating transcription factor 3 (ATF3), a member of the ATF/cAMP response element-binding (CREB) family, binds to the cyclic AMP response element in promoters containing the consensus sequence TGACGTCA [21,
22] ATF3 is a homodimer-forming transcriptional repressor It forms a heterodimer with the members of the ATF/CERB or CCAAT/enhancer- binding protein (C/EBP) family to exert suppressive or stimulatory effects
[23, 24] Ultraviolet radiation, cAMP, calcium influx, and cytokines are stress signals that can increase the generation of ATF3, which is normally produced at low levels in normal or quiescent cells [25, 26] ATF3 can inhibit the mRNA expression of peroxisome proliferator-activated receptor J (PPARJ) and C/EBPα, thus suppressing adipocyte development [27] High- fat diet (HFD)-fed ATF3 −/− mice gained more weight than did their littermate wild-type control mice and developed impaired glucose metabolism and hyperlipidemia [28, 29] Furthermore, 16C (an ATF3 stimulant) effectively alleviated metabolic syndrome in mice with HFD-induced obesity [30]
We examined ATF3 inducers from a modified Chinese herb single- compound library utilizing ATF3-specific promoter-screening techniques SW20.1, a synthetic molecule similar to neo-tanshinlactone, was derived from Salvia miltiorrhiza ST32da and ST32db, which are derivatives of SW20.1, have been demonstrated to have anti-obesity effects in mice that were fed high-fat diets, known for inducing obesity [28, 31] [32] Therefore, we hypothesized that SW20.1 might have an excellent antiobesity and anti- metabolic syndrome via inducing ATF3 expression.
Objectives
In our study, we aimed to investigate the anti-obesity and anti- metabolic syndrome effects of SW20.1 and ST32db in mice that were induced to become obese through a high-fat diet (HFD) Additionally, we sought to explore whether the molecular mechanism underlying the effects of SW20.1 involved the ATF3-mediated signaling pathway.
Literature Review
The functions of ATF3
ATF3 is a member of the ATF/cAMP response element-binding (CREB) family and binds to the cyclin AMP response element (CRE) in promoters containing the consensus sequence TGACGTCA [33, 34] This factor is a homodimer-forming transcriptional repressor It forms a heterodimer with members of the ATF/CERB or CCAAT/enhancer binding protein (C/EBP) families to exert suppressive or stimulatory actions [23, 24] UV radiation, cAMP, calcium influx, and cytokines are among the stress signals that can increase ATF3, which is produced at low levels in normal and quiescent cells
[25, 26] ATF3 and ATF3-regulated signals were related to metabolic, immunity, and oncogenesis [35] In addition, ATF3 has been shown to play crucial functions throughout postnatal cortical growth and damage recovery
In early developing cortical neuronal cultures, the inhibition of ATF3 specifically inhibited neurite outgrowth and differentiation and caused increased cell death [36]
Regarding cancer, ATF3 is considered a regulator for prostate, breast, colon, lung, and liver cancers [35] In prostate cancer, ATF3 is a tumor suppression linked to ATF3 and AKT signaling through the loss of phosphatase and tension homolog protein ( Pten) [37] ATF3 binds to the androgen receptor (AR) and inhibits the androgen signaling that is essential for the proliferation and survival of prostatic epithelial cells [38] Besides, ATF3 can also suppress the p53 mutation, which serves for chemoresistance, migration, and invasion [39, 40] The upregulation of ATF3 expression is observed in metastatic breast cancer However, in contrast to its transient expression in normal mammary epithelial cells, TGFβ plays a critical role in sustaining and prolonging ATF3 expression [41-44] ATF3 serves a dual function by promoting apoptosis in normal mammary epithelial cells and stimulating proliferation in breast cancer cells, thereby contributing to metastasis This dual role is reminiscent of the dichotomy exhibited by TGFβ
[45, 46], which induces epithelial to mesenchymal transition through ATF3 The involvement of the Wnt and p53 signaling pathways have been identified in the regulation of the ATF3 expression [43, 47] Depending on the cellular context, ATF3 can act as either an oncogene or a tumor suppressor gene [48, 49]
Based on data from breast cancer studies, ATF3 appears to play a role in the development, invasion, and metastasis of breast cancer Higher levels of ATF3 expression may be linked to a poor prognosis, indicating its potential oncogenic role in breast tumorigenesis and progression These findings suggest that ATF3 could serve as a valuable biomarker or therapeutic target for breast cancer [50] A recent study demonstrated that dampening the ATF3 expression can improve the efficiency of chemotherapy, indicating that ATF3 is involved with chemotherapy resistance and cancer metastasis while using the chemotherapy drug paclitaxel (PTX) [51]
One of the most prevalent solid tumors in the world is colorectal cancer ATF3's role in colon cancer is contradictory, with both pro- and anti- tumorigenic functions reported [52].ATF3 expression is lower in human colorectal cancer than in the nearby non-cancerous tissue [53], and both in vitro and in vivo, the silencing of ATF3 via RNA interference (RNAi) promoted cancer cell migration [54] Another study revealed that ATF3 inhibits cancer cell invasion and migration in human colorectal cancer cells and is a direct target for TCF4/E-catenin binding [55]
Lung cancer has a significant prevalence and a low five-year survival rate (16.6%), making it a major contributor to cancer-related deaths globally
In contrast to colorectal cancer, lung cancer tissues, and cells exhibit elevated levels of ATF3 mRNA and protein compared to normal tissues and cells Increased expression of ATF3 in tumors is strongly associated with higher tumor grade, lymph node metastasis, and poorer overall survival [56] Moreover, ATF3 was the upstream gene of the hippo-YAP pathway under AETC, promoting apoptosis in NSCLC cell lines [57]
ATF3 was shown to be expressed at low levels in numerous hepatocellular carcinoma (HCC) tumor tissues in light of colorectal cancer
In addition, decreased ATF3 expression was related to clinical cancer stage and pathological tumor grade in HCC patients Consequently, reduced ATF3 expression was substantially associated with poor overall survival in HCC patients Moreover, ATF3 expression in HCC patients was linked with macrophage infiltration levels and macrophage immune marker sets [58] One of the intriguing functions of ATF3 is its involvement in glycolipid metabolism and metabolic disorders Lipids and glucose play crucial roles in various physiological functions, including serving as raw materials for cellular biosynthesis, regulating cell signal transduction, and maintaining body temperature Imbalances in lipid and glucose metabolism can lead to glycolipid metabolic disorders such as obesity, diabetes, and cardiovascular disease [59] Moreover, obesity, diabetes, hypertension, and cardiovascular disease are significant risk factors for the development and progression of chronic kidney disease (CKD) [60] Therefore, targeting glycolipid metabolism is a key therapeutic strategy for addressing metabolic syndrome Recent evidence highlights the essential roles of ATF3 in glucose metabolism ATF3 inhibits intestinal lipid absorption, enhances hepatic triglyceride hydrolysis and fatty acid oxidation, promotes macrophage- mediated reverse cholesterol transport, and mitigates Western diet-induced nonalcoholic fatty liver disease and atherosclerosis progression Furthermore, apart from its involvement in lipid metabolism, ATF3 has also been identified as a crucial regulator of glucose metabolism [61]
The liver, as a crucial metabolic organ, plays a central role in regulating glucolipid metabolism Dysfunction of the liver can lead to conditions such as nonalcoholic fatty liver disease (NAFLD), type 2 diabetes mellitus, and dyslipidemia The regulatory network of hepatic glucolipid metabolism is governed by a complex interplay of signaling molecules, intracellular pathways, and transcription factors Previous studies have suggested a protective role of ATF3 in the progression of high-fat diet-induced NAFLD and nonalcoholic steatohepatitis (NASH) by inhibiting liver inflammation, hepatocellular apoptosis, hepatic stellate cell activation, and fibrosis [61] Kim et al [62] demonstrated that injecting ATF3 siRNA into ZDF rats promoted fatty acid oxidation, suppressed inflammatory responses, and improved glucose tolerance, proposing ATF3 as a potential target linking hepatic steatosis to impaired glucose homeostasis Recent research has revealed a significant reduction in hepatic ATF3 expression in patients with NAFLD and mouse models of diabetes and obesity Mechanistically, hepatic ATF3's interaction with HNF4α has been implicated in the pathogenesis of NAFLD [63] Furthermore, Xu.at al explored the impact of ATF3 on bile acid and lipoprotein metabolism in atherosclerosis, showing that hepatocyte
ATF3 enhances high-density lipoprotein (HDL) uptake, inhibits intestinal lipid absorption, promotes macrophage-mediated reverse cholesterol transport, and alleviates dyslipidemia by inducing scavenger receptor group
B type 1 (SR-BI) and repressing cholesterol 12α-hydroxylase (CYP8B1) in the liver through its interaction with p53 and hepatocyte nuclear factor 4α, respectively [64]
The adipose tissue, recognized as a vital metabolic and endocrine organ, plays a crucial role in maintaining glucose and lipid balance through its intricate functions at both local and systemic levels Adipose tissue, also known as body fat, is not just an inert storage site for excess energy It is now widely recognized as an active endocrine organ that secretes various molecules, collectively known as adipokines, which have a significant impact on metabolism and overall health At a local level, adipose tissue serves as an energy reservoir by storing triglycerides in specialized cells called adipocytes When energy is needed, these triglycerides are broken down into fatty acids and released into the bloodstream for other tissues to utilize Adipose tissue also plays a crucial role in maintaining glucose homeostasis It secretes adipokines such as adiponectin, which enhances insulin sensitivity in muscle and liver cells, thereby promoting glucose uptake and reducing blood glucose levels On the other hand, adipose tissue also releases other adipokines, such as resistin and TNF-alpha, which can impair insulin action and contribute to insulin resistance Beyond its local functions, adipose tissue also communicates with other organs and tissues through the release of adipokines and other signaling molecules For example, it can modulate insulin sensitivity in distant tissues like the liver and skeletal muscle, influence inflammation, and affect the function of organs such as the brain, pancreas, and cardiovascular system The dysregulation of adipose tissue function can contribute to the development of metabolic disorders such as obesity, insulin resistance, type 2 diabetes, and cardiovascular diseases Understanding the complex interplay between adipose tissue and various metabolic processes is crucial for developing strategies to prevent and treat these conditions
Traditionally, adipose tissue can be categorized into white adipose tissue (WAT), beige adipose tissue, and brown adipose tissue (BAT), distinguished by their distinct tissue colors and energy storage or dissipation functions Disruption of adipocyte differentiation is closely linked to adipose tissue dysfunction, leading to an increased susceptibility to metabolic complications associated with obesity, such as insulin resistance, hepatic steatosis, diabetes, and hyperlipidemia [65, 66] Consequently, the regulation of adipocyte differentiation has emerged as a promising strategy for mitigating metabolic disorders associated with obesity
Numerous studies have emphasized the critical role of transcriptional regulation in the adipocyte differentiation [67, 68] Notably, two key transcription factors, CCAAT/enhancer binding protein α (C/EBPα) and peroxisome proliferator-activated receptor γ (PPARγ), have been identified as master regulators of terminal adipocyte differentiation ATF3 has been shown to inhibit the mRNA expression of PPARγ and C/EBPα, thereby suppressing adipocyte development [69, 70] Recent evidence, including our own research, suggests that ATF3 plays a modulatory role in adipogenesis and contributes to the reduction of obesity [28, 31, 71] Interestingly, Ku et al [72] reported that the ATF3 inducer ST32db could impede the differentiation of 3T3-L1 preadipocytes by inhibiting adipogenesis and enhancing lipolysis through the activation of the β3-adrenoceptor (β3- AR)/PKA/p38, AMPK, and ERK signaling pathways These findings align with previous studies demonstrating that lentivirus or thapsigargin-mediated overexpression of ATF3 inhibits adipocyte differentiation by binding to the ATF/CRE site on the promoters of C/EBPα and PPARγ2, thereby reducing transcription in 3T3-L1 cells [27, 73] Consistent with its role in suppressing adipocyte differentiation, ATF3 demonstrates an anti-obesity effect in mice
[72] Sulfuretin-induced ATF3 expression in WAT and adipocytes has significantly reduced eWAT and liver weights in mice [74] ATF3-deficient mice fed a high-fat diet consistently exhibit increased depot weights in WAT (including inguinal WAT, mesenteric WAT, and retroperitoneal WAT) [28] These ATF3-deficient mice also exhibit greater weight gain, impaired glucose metabolism, and hyperlipidemia compared to their wild-type counterparts [28, 71] Taken together, these studies suggest that ATF3 could serve as a promising therapeutic target for modulating adipocyte differentiation to combat obesity.
The effectiveness of ATF3- inducer drugs
Salvia miltiorrhiza, also known as S miltiorrhiza radix, belongs to the Labiatae family It is a well-known traditional Chinese herb with notable therapeutic properties for enhancing cardiovascular health and reducing platelet aggregation [15] Extensive research has identified a wide range of chemical compounds derived from S miltiorrhiza Over 50 water-soluble components and more than 30 liposoluble components have been identified thus far [75] The water-soluble components mainly consist of phenolic acid compounds, including danshensu (salvianolic acid A), salvianolic acid B, protocatechuic aldehyde, caffeic acid, and rosmarinic acid In mice with diet- induced obesity, Salvianolic acid B has been shown to enhance glucolipid metabolism by regulating adipogenic transcription factors [76] The research conducted by Tian An suggests that Salvianolic acid B has the potential to regulate fat deposition and metabolism in obese mice This regulatory effect is attributed to its ability to modulate the expression of long non-coding RNAs (lncRNAs) and influence the expression of messenger RNAs (mRNAs) involved in lipid metabolism and inflammation-related signaling pathways On the other hand, the liposoluble components primarily consist of conjugated quinones and ketones, such as tanshinone I, tanshinone IIA, and cryptotanshinone [75] According to Dae Young Jung, et al, Tanshinone
I exhibits an anti-obese effect in diet-induced obese (DIO) mice This effect is achieved by inhibiting early adipogenesis, which involves the suppression of mitochondrial energy metabolism (MCE) and regulation of the early adipogenic transcription cascade [15] Naimur Rahman's research suggests that cryptotanshinone, a compound found in Salvia miltiorrhiza, can inhibit the differentiation of pre-adipocytes by regulating the expression of adipogenesis-related genes through the STAT3 signaling pathway [77] The water-soluble components of S miltiorrhiza exhibit antioxidant, anticoagulant, and anti-myocardial ischemia effects, which are closely associated with their traditional roles in blood activation and clot elimination
[78, 79] In contrast, the main liposoluble compounds, particularly tanshinone I and tanshinone IIA, possess antibacterial, anti-inflammatory, myocardial protective, and endothelial cell-protecting properties [78] [80] Furthermore, several specific liposoluble components of S miltiorrhiza have been investigated for their anti-obesity activities [15, 19, 81]
In our previous research, we conducted a screening of ATF3 inducers from a modified Chinese herb single-compound library at the National Research Institute of Chinese Medicine We discovered that compounds related to Salvia miltiorrhiza and their chemically synthesized derivatives showed significant potential as ATF3 inducers [28] Among them, ST32da, a synthetic compound derived from Salvia miltiorrhiza and closely related to neo-tanshinlactone, exhibited practical anti-obesity effects in mice with diet- induced obesity ST32da upregulated ATF3 expression, leading to the downregulation of adipokine genes and the promotion of adipocyte browning This effect was achieved by inhibiting the carbohydrate- responsive element-binding protein-stearoyl-CoA desaturase-1 axis [28] Another compound, ST32db, which is a lipid-soluble synthetic derivative with structural similarities to components found in Salvia miltiorrhiza, ranked among the top possibilities for ATF3 activation ST32db induced browning by inhibiting the p38 pathway in vivo It is worth noting that most known browning inducers upregulate the p38 pathway, which in turn promotes the expression of UCP1, such as cardiac natriuretic peptides or the T3 hormone [31, 82] Additionally, ST32dc demonstrated anti-obesity effects by inhibiting the ChREBP promoter activity [28] Yi-Han discovered that 7-methoxy-4-methyl-1H-chromeno[4,3-c] pyrazol-4-one, a type of ATF3-inducing drug, demonstrated beneficial effects against metabolic syndrome The drug was found to reduce body weight by decreasing adipose mass and decrease in the size of differentiated adipocytes Additionally, it improved plasma triglyceride levels and had a positive impact on liver function [30]
In the study conducted by Suji Kim, sulfuretin, a synthesized drug with the chemical structure (Z)-2-(3,4-dihydroxybenzylidene)-6- hydroxybenzofuran-3(2H)-one, was identified as an ATF3 inducer This compound demonstrated anti-obesity effects and improved insulin sensitivity in mice with diet-induced obesity [74].
The functions of adipokines
Adipose tissue encompasses different types, including white adipose tissue (WAT), brown adipose tissue, and brite adipose tissue, and it serves various functions such as energy storage and thermogenesis regulation Additionally, adipose tissue secretes a range of hormones, cytokines, and metabolites collectively known as adipokines [9] The predominant component of adipose tissue is mature adipocytes that arise from preadipocytes Extensive research on mature adipocytes has revealed their role not only in storing free fatty acids (FFAs) but also in producing various adipokines that can impact overall metabolism [83, 84] One well-known adipokine is adiponectin, which acts as a hemostatic factor and exerts regulatory effects on glucolipid metabolism and insulin sensitivity Its anti- inflammatory, anti-fibrotic, and antioxidant properties contribute to its physiological effects In rodents and humans with obesity or insulin resistance, adiponectin expression markedly decreases [85]
Interestingly, there is evidence suggesting that ATF3 plays a negative regulatory role in adiponectin gene expression For instance, a study by Kim et al [86] demonstrated that ATF3 can negatively regulate adiponectin gene expression by specifically binding to the putative AP-1 binding site (TGACTCTC, -376/-369) within the adiponectin promoter in 3T3-L1 adipocytes Additionally, ATF3 has been found to transcriptionally repress the adiponectin receptor-2 (adipoR2) gene by directly binding to the 5' flanking promoter region of AdipoR2 This interference with the protective effects of adiponectin can impact the obesity-related insulin resistance [87] Leptin, one of the most extensively studied adipokines, was first identified in 1994 by Jeffrey Friedman's research group as the product of the obese (ob) gene in mice and the lep gene in humans [88] Mice with a loss- of-function mutation in the ob gene exhibit hyperphagia, weight gain, and insulin resistance, which can be ameliorated by administering exogenous leptin [89] Leptin is a 16-kDa non-glycosylated protein primarily synthesized in the subcutaneous white adipose tissue (WAT) [90-92] Its structural composition consists of a bundle of four α-helices held together by cysteine disulfide bonds, resembling the structure of granulocyte-colony stimulating factor (G-CSF) and IL-6 Leptin exerts its effects through the leptin receptor (LEPR in humans, Ob-R in mice), which belongs to the class
I cytokine receptor family and spans the cell membrane [93] The leptin receptor has six known isoforms: the long form (ObRb) and four isoforms with short cytoplasmic tails (ObRa, ObRc, ObRd, and ObRe), as well as a soluble form (ObRf) ObRb possesses a complete cytoplasmic tail that contains three conserved tyrosine residues crucial for mediating downstream signaling [94]
Within the brain, leptin interacts with cells in specific hypothalamic nuclei that express the long form of the leptin receptor (ObRb), initiating downstream signaling pathways that regulate appetite and energy expenditure [95] Although obesity is characterized by elevated levels of circulating leptin in proportion to increased fat mass, obese individuals generally exhibit resistance to the effects of leptin The development of leptin resistance in obesity likely involves multiple mechanisms These include negative regulation of ObRb signaling in the hypothalamus [96, 97], heightened signaling of proinflammatory cytokines in the brain [98], cleavage of hypothalamic ObR by increased activity of matrix metalloproteinase-2 (MMP-2) [99], and reduced transport of leptin across the blood-brain barrier [100]
Resistin, initially identified in obese mice, is an adipocyte-derived protein associated with insulin resistance in obesity [101, 102] It is a cysteine-rich protein with a molecular weight of 12.5 kDa, consisting of a signal peptide, a variable region, and a conserved C terminus The cysteine residues within resistin form disulfide bonds, allowing its assembly into a trimeric structure Subsequently, interchain disulfide bond formation leads to the formation of a high molecular weight hexamer In mice, resistin circulates as both a low molecular weight trimer and a high molecular weight hexamer In humans, it exists in circulation as a trimer and a high molecular weight oligomer with a molecular weight of 660 kDa [103]
Interestingly, in humans, resistin is predominantly expressed in peripheral blood mononuclear cells (PBMCs), bone marrow, and macrophages, with minimal production by adipocytes, which differs from its expression pattern in mice [104, 105] Murine resistin is proposed to interact with receptors such as decorin [106] and ROR1 [107], while adenylyl cyclase-associated protein 1 (CAP1) is suggested as a receptor for human resistin [108] Although resistin has been shown to compete with lipopolysaccharide (LPS) for binding to toll-like receptor 4 (TLR4), direct binding of resistin to TLR4 has not been demonstrated [109] In adipocytes, resistin contributes to the suppression of insulin-mediated signaling by activating the suppressor of cytokine signaling 3 (SOCS3) [110] Studies on ob/ob mice lacking resistin have shown improved glucose tolerance and insulin sensitivity [111] Clinical studies have found weak correlations between circulating resistin levels and body fat or body mass index (BMI)
[97], and resistin levels do not consistently correlate with insulin resistance or metabolic syndrome [98, 99], suggesting divergent functions of resistin between rodents and humans Resistin, as an adipose tissue-derived cysteine- rich protein, is associated with various dysfunctions, including altered lipid and carbohydrate metabolism, inflammation, and insulin resistance [10] Moreover, resistin has been implicated in conditions such as knee osteoarthritis, ovarian cancer, and acute pancreatitis [11-13] Human studies have also shown the link between resistin to obesity and reduced insulin sensitivity [14].
Study Design and Methods
Material and Methods
Synthesis of [1,1'-biphenyl]-2-yl acetate: The mixture of 2- phenylphenol, acetic anhydride, pyridine, and DMAP was heated at 140°C for 1.5 hours After the reaction, the solution was diluted with ethyl acetate (EtOAc), washed with distilled water and NaHCO3, dried with Na2SO4, filtered, and concentrated under vacuum The residue was purified by flash chromatography
Synthesis of 1-(2-hydroxy-[1,1'-biphenyl]-3-yl)ethan-1-one: The mixture of [1,1'-biphenyl]-2-yl acetate and aluminum trichloride was heated at 130°C for 0.5 hours After the reaction, ice-water was added to the black residue The solution was diluted with ethyl acetate (EtOAc), washed with distilled water, dried with Na2SO4, filtered, and concentrated under vacuum The residue was purified by flash chromatography
Synthesis of 4-hydroxy-8-phenyl-2H-chromen-2-one: To a solution of 1-(2-hydroxy-[1,1'-biphenyl]-3-yl)ethan-1-one in anhydrous toluene in an ice bath, NaH was slowly added Diethyl carbonate in anhydrous toluene was added dropwise when hydrogen evolution ceased The mixture was stirred at 110°C overnight After the reaction, the mixture was slowly added to ice-cold water and then acidified with 2N HCl until a precipitate formed The solid was filtered and collected
Synthesis of (E)-4-(but-2-en-1-yloxy)-8-phenyl-2H-chromen-2-one: A solution of 4-hydroxy-8-phenyl-2H-chromen-2-one and potassium carbonate in DMF was treated with crotyl bromide and stirred under N2 at
56°C for 3 hours After filtration to remove K2CO3, the filtrate was concentrated under vacuum The residue was diluted with ethyl acetate (EtOAc), washed with distilled water, dried with Na2SO4, filtered, and concentrated under vacuum The residue was purified by flash chromatography
Synthesis of 1,2-dimethyl-1,2-dihydro-11H-benzo[h]furo[3,2- c]chromen-11-one: To a solution of (E)-4-(but-2-en-1-yloxy)-8-phenyl-2H- chromen-2-one in DMF, I2 was added The resulting mixture was stirred under N2 at 140°C for 30 minutes and then cooled to room temperature The mixture was diluted with ethyl acetate (EtOAc), washed with distilled water, dried with Na2SO4, filtered, and concentrated under vacuum The residue was purified by flash chromatography
3.1.2 Cell Culture and Adipocyte Differentiation
We cultured 3T3-L1 mouse preadipocytes obtained from the American Type Culture Collection (Manassas, VA, USA) in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) fetal bovine serum (FBS) and 100 U/mL penicillin/streptomycin (100 mg/mL) 3T3-L1 cells that reached confluence were cultured in differentiation medium consisting of DMEM, 0.5 mM IBMX, 10% FBS, 5 g/mL insulin, and 1 M dexamethasone (MDI) SW20.1 was dissolved in dimethyl sulfoxide (DMSO) to obtain a stock concentration of 25 nM To determine the effects of SW20.1, 3T3-L1 cells were treated with SW20.1 for 8 days during cell differentiation DMSO at the final concentration of 0.5% was used as the control To investigate the effects of depleting ATF3, 3T3-L1 cells were cultured in 6-well plates with a density of 5 x 104 cells per well The cells were then transiently transfected with shRNA-ATF3 (cloning vector pLKO.1; target sequence: ACCTCTTTATCCAACAGATAA), obtained from the RNAi Core, Sinica Academy in Taipei, Taiwan Following a 48- hour incubation period, the cells were treated with SW20.1 at a concentration of 30 μM for a duration of 6 hours
After 8-day SW20.1 treatment during 3T3-L1 preadipocyte differentiation, the differentiated adipocytes were washed twice with phosphate-buffered saline and fixed for 1 h with 10% formalin Then, the cells were stained with Oil Red O working solution for 30 min Subsequently, the cells were washed four times with distilled water before optical microscopy analysis The Oil Red O staining solution was eluted with 100% isopropanol (v/v), and its optical absorbance at 500 nm was measured
3T3-L1 preadipocytes were seeded in 6-well plates at a density of 5 x
104 cells per well and cultured in a suitable medium Subsequently, the cells were exposed to different concentrations (7.5, 15, 30, and 60 àM) of SW20.1 Following a 5-day and 8-day incubation period, the cells were kept in darkness and treated with an MTT solution, which was allowed to react for
4 hours at a temperature of 37°C Afterward, the supernatants were removed, and dimethyl sulfoxide (DMSO) was added to each well The plates were agitated to facilitate the dissolution of the formazan crystal product Finally, the absorbance of the samples was measured at 570 nm using a multiwell plate reader from Molecular (Sunnyvale CA, USA) Cell viability was determined by calculating the percentage of viable cells, with the untreated cells serving as the reference point and assigned a viability value of 100%
3.1.5 Quantitative Reverse Transcription Polymerase Chain Reaction (qRT PCR)
Total RNA was extracted from cultured cells or adipose tissues by using the Trizol reagent (Invitrogen) RNA was reverse transcribed to cDNA using a cDNA synthesis kit (iScript, Biorad) Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using a real-time PCR system (ABI StepOnePlus, Applied Biosystems, Grand Island, NY, USA) with SYBR green (Biorad) The primer sequences used for qPCR are listed in Table 1
By using a magnetic ChIP kit (Pierce Magnetic ChIP Kit), a chromatin immunoprecipitation (ChIP) assay was performed on 3T3-L1 cells fixed with 1% formaldehyde (Thermo Fisher Scientific) Chromatin was immunoprecipitated using an anti-ATF3 antibody (Abcam ab254268) DNA was detected using standard PCR The primers used for PCR are listed in
In this study, we used male C57BL/6 mice To investigate the effects of SW20.1 and ST32db on obesity and metabolic syndrome, 7-week-old mice were fed an HFD (45% kcal from fat) with or without the intraperitoneal administration of SW20.1 (60 mg/kg/week) or ST32db (75 mg/kg/week) for
10 weeks, three times per week In the control group, we injected the mice with 100% DMSO (1 mL/kg) The body weight and food intake of the mice were measured weekly throughout the experiments After treatment, insulin sensitivity and glucose tolerance were measured The mice were then sacrificed, and their blood and tissue samples were collected All procedures were performed in accordance with the guidelines of the Institutional Animal Care and Use Committee of Taipei Medical University, Taiwan
3.1.8 Glucose and Insulin Tolerance Tests
For the glucose tolerance test (GTT), the mice were fasted for 16 h before being administered an intraperitoneal injection of glucose (2 g/kg body weight) in saline Plasma glucose levels were measured from blood samples collected from the tail vein at 0, 15, 30, 60, 90, and 120 min after glucose injection For the insulin tolerance test (ITT), the mice were fasted for 6 h before being administered an intraperitoneal injection of 1 U/kg body weight of insulin in saline Plasma glucose levels were measured from blood samples collected from the tail vein at 0, 15, 30, 45, 60, 90, and 120 min after insulin injection We used a commercial glucose meter to measure plasma glucose levels [30]
Blood samples (500 PL) were collected from the tail vein and centrifuged at 6000 ×g for 3 min to separate the serum from the cells Within
24 h of blood collection, serum biochemical parameters were analyzed The serum levels of blood urea nitrogen, creatinine, TG, glutamic oxaloacetic transaminase, and glutamate pyruvate transaminase were determined using an automated analyzer (SPOTCHEM EZ SP-4430, Azkray, Kyoto, Japan)
3.1.10 Histology, Adipocyte Size Measurement, and Adipocyte
Statistic analysis
All data are expressed as the mean ± standard error from at least three experiments Statistical analysis was conducted using an unpaired t test, one- way analysis of variance (ANOVA), and repeated two-way ANOVA followed by the Tukey test A p value of