Revealed the origin of the mong cai pig population in quang ninh province by studying the specific gene sequences (khóa luận tốt nghiệp)

VIETNAM NATIONAL UNIVERSITY OF AGRICULTURE FACULTY OF BIOTECHNOLOGY THESIS TITLE: REVEALED THE ORIGIN OF THE MONG CAI PIG POPULATION IN QUANG NINH PROVINCE BY STUDYING THE SPECIFIC GENE SEQUENCES HANOI – 2022 VIETNAM NATIONAL UNIVERSITY OF AGRICULTURE FACULTY OF BIOTECHNOLOGY THESIS TITLE: REVEALED THE ORIGIN OF THE MONG CAI PIG POPULATION IN QUANG NINH PROVINCE BY STUDYING THE SPECIFIC GENE SEQUENCES Student : Cao Thi Thu Thuy Course : 63 Department : Biotechnology Supervisor : MSc Nguyen Quoc Trung HANOI – 2022 COMMITMENTS I hereby declare that all the data and results in this thesis are frank and have never been used in any reports yet I also assure the information cited in my thesis indicated its origin, and all the help is appreciated Hanoi, December 2022 Student Cao Thi Thu Thuy i ACKNOWLEDGEMENTS First and foremost, I have to express my appreciation to the directory of the Vietnam National University of Agriculture, the board of deans, and lectures in the Faculty of Biotechnology for creating a meaningful learning environment and providing me the precious knowledge throughout my academic years In terms of the thesis conducting process, many people helped me a lot to complete this study Specifically, this is my dear supervisor, MSc Nguyen Quoc Trung, who brings the most inspiration and aspiration for me to pursue bioscience Without his support throughout these two years, I would not have gained as many honors as I have at present Besides, I cannot neglect the ardent support from my lab-mates in the Laboratory of Molecular Biology and Applied Biotechnology, there is no word to express my gratitude to the whole of you In addition, I would like to sincerely thank the lecturers and students from the Faculty of Veterinary medicine, VNUA for their help during the sample-collecting trip This study also gained financial support from the People’s Committee in Quang Ninh province, Vietnam (Conservation of Mong Cai pig genetic resources in Quang Ninh province, 2021-2023) Last but not least, I would like to thank my nearest and dearest, thank Timmy, who was there for me through all my ups and downs, until this point and my academic career way later Hanoi, December 2022 Student Cao Thi Thu Thuy ii TABLE OF CONTENTS COMMITMENTS i ACKNOWLEDGEMENTS ii TABLE OF CONTENTS iii LIST OF ABBREVIATIONS v LISTS OF TABLES vi LIST OF FIGURES vi ABSTRACT viii Chapter I INTRODUCTION Chapter II LITERATURE REVIEW 2.1 Evolution and domestication of pigs 2.2 Molecular study of evolution and domestication of pigs 2.2.1 Studies based on mitochondrial genome 2.2.2 Studies based on nucleus DNA 10 2.2.3 Studies based on MC1R sequence 13 2.3 Study on origin and phylogeny of Mong Cai pig breed based on DNA analysis .21 2.3.1 Study on nucleus DNA in Mong Cai pig 21 2.3.2 Study on Mong Cai pig phenotype 24 2.3.3 Study on Mong Cai pig mitochondrial genome .25 Chapter III MATERIALS AND METHODS 28 3.1 Materials 28 3.2 Methods 28 3.2.1 Sampling and DNA extraction method 28 3.2.2 Study on mtDNA methods .29 3.2.3 Study on MC1R sequence 31 Chapter IV RESULTS AND DISCUSSION 34 4.1 Mitochondrial DNA sequence analysis 34 iii 4.1.1 Phylogeny study on mtDNA D-loop sequence of Mong Cai pig and other 15 pig breeds 34 4.1.2 Developing marker set to determine the maternal origin of Mong Cai pig 37 4.2 MC1R gene sequence analysis results 39 4.2.1 Sequencing and polymorphism detection 39 4.2.2 Haplotype diversity .41 4.2.3 Phylogenic analysis .42 4.2.4 Accession numbers 44 4.3 Discussion .44 4.3.1 Diversity in the Mong Cai pig population 44 4.3.2 The potential association between MC1R gene and coat color of Mong Cai pig .45 4.3.3 Origin of Mong Cai breed 47 Chapter V CONCLUSIONS AND PROPOSALS .49 5.1 Conclusions 49 5.2 Proposals 50 REFERENCES 51 APPENDIX 55 iv LIST OF ABBREVIATIONS Abbreviation Meaning α-MSH α-melanocyte-stimulating Hormone ASP/ ASIP Agouti-signaling Protein BC Before Christ cAMP Cyclic Adenosine Monophosphate D-loop Displacement loop ESR1 Estrogen Receptor EDNRB Endothelin Receptor Type B GPIP Glucose Phosphate Isomerase-processed MC1R Melanocortin Receptor MITF Melanocyte Inducing Transcription Factor MSA Multiple Sequence Alignment mtDNA Mitochondrial DNA PCR Polymerase Chain Reaction SNP Single Nucleotide Polymorphism TYR Tyrosinase TYRP1 Tyrosinase-Related Protein UPGMA Unweighted Pair Group Method using arithmetic Averages VnP Vietnamese native Pig v LISTS OF TABLES Table 3.1: Genbank accession codes for mtDNA pig breeds and the site of D-Loop region 29 Table 3.2: PCR primers and conditions used for amplification of melanocortin receptor (MC1R) gene 32 Table 4.1: The detected variation in the D-Loop region among Mong Cai pigs and 15 other pig breeds in Asia and Europe 34 Table 4.2: PCR primers and conditions used for amplification of fragment in mtDNA D-loop region 37 Table 4.3: Expected bands amplified by two primer pairs designed based on mtDNA sequences 38 Table 4.4: Variations of the melanocortin receptor (MC1R) gene and allelic frequency in the European pigs, Asian pigs, and Mong Cai pigs based on coat color phenotype 40 Table 4.5: Haplotypes and polymorphism in the melanocortin receptor (MC1R) gene among Mong Cai pigs, European pigs, and Asian pigs 41 Table 4.6: Haplotypes distribution in data set of Mong Cai pigs, European pigs, and Asian pigs 41 vi LIST OF FIGURES Figure 2.1: The domestication of the Eurasian or “Russian” boar resulted in hundreds of breeds of domestic pigs Figure 2.2: Schematic overview of the history of the pig (Sus scrofa) Figure 2.3: Mitochondrial genome position (source: https://www.genome.gov/) Figure 2.4: Pedigree depicting mitochondrial inheritance that shows inheritance is transmitted through the maternal line Figure 2.5: Neighbor-joining trees of wild boar and domestic pig mitochondrial DNA haplotypes (Giuffra et al., 2000) .11 Figure 2.6: Tong Cheng pig .13 Figure 2.7: Allele frequency of c.699 in ESR1 in Chinese pigs and European pigs (C Wang et al., 2015) 13 Figure 2.8: Melanin synthesis-biochemical pathway (Robins, 1991; Searle, 1968) 15 Figure 2.9: The model of the genetics of coat color determination in mice 17 Figure 2.10: Phenotype and geographical origin of the 20 European pig breeds: 19 Figure 11: Distribution of some typical Chinese local pig breeds (Y Wang et al., 2022) 20 Figure 2.12: The unweighted pair-group method using arithmetic averages dendrograms based on Nei’s (1972) model (Nguyen Thi Dieu Thuy et al., 2006) 22 Figure 2.13: Geographical localizations of eight pig populations analyzed in this study (Pham Doan Lan et al., 2014) 23 Figure 2.14: Genetic relationship among eight studied pig populations (Pham Doan Lan et al., 2014) 24 Figure 2.15: Multiple correspondence analysis of the characteristics of Vietnamese native pig populations shows the distributions of the various Vietnamese native pig breeds (Ishihara et al., 2020) 25 vii Figure 2.16: The UPGMA phylogenetic tree of 162 pig complete mitochondrial DNA sequences (Thuy Nhien Thi Tran et al., 2016) .26 Figure 4.1: ML phylogenic tree based on the mtDNA D-loop in the dataset (2 Mong Cai pigs, 15 other pig breeds) 36 Figure 4.2: PCR product of the partial mtDNA D-loop region amplified by Mtmc3 primer 39 Figure 4.3: PCR product of the partial mtDNA D-loop region amplified by Mtmc4 primer 40 Figure 4.4: The phenotypes of knotted black saddle (left) and seamless black saddle (right) Mong Cai pigs 42 Figure 4.5: ML phylogenic tree based on the coding sequence of MC1R gene in the dataset (26 Mong Cai pigs, 20 Asian and European pigs) 43 viii between indigenous Asian and European pigs In addition, the SNP c.729A>G and the knotted black saddle phenotype identified in my study constitute a significant marker for selecting Mong Cai pig phenotypes 48 Chapter V CONCLUSIONS AND PROPOSALS 5.1 Conclusions - Designing a marker set based on mtDNA D-loop sequence to discriminate Mong Cai pig from other pig breeds: Two marker pairs Mtmc3 and Mtmc4 were designed based on mtDNA Dloop region of Mong Cai pigs and then proved the maternal lineage diversity in Mong Cai population in Quang Ninh province at present This is evidence of the crossbreeding trend in swine farms in Vietnam The crossbreeding of local pigs with exotic breeds could help rapidly increase meat production and reduce unflavored traits, however, it is the primary reason for the loss of indigenous pig genetic resources - Sequencing the MC1R gene in Mong Cai pigs: For the first time, the MC1R gene in the Mong Cai pig breed was sequenced and analyzed in terms of diversity and haplotype MC1R gene in 26 Mong Cai pigs consists of an exon region, measuring 963bp and coding for 321 amino acids This contributes a useful document for further studies on the specific black coat color in Mong Cai pigs as well as the domestication research of Vietnamese native pigs - Investigate the haplotype diversity in MC1R sequence among Mong Cai individuals: Five substitutions and four haplotypes were detected in the Mong Cai population A vast majority of individuals belonged to the same haplotype with a number of Chinese pigs The divergence in polymorphism and phenotype of Mong Cai pig may have an association by the SNP c.729A>G The polymorphism in this sequence can be used as a marker for selecting Mong Cai pig phenotypes 49 - Revealing the origin of the Mong Cai pig population in Quang Ninh province: This study provided strong evidence for the Asian origin of Mong Cai pigs and the close genetic relationship with Chinese pig breeds based on molecular research MC1R gene responds for coat color, but it also diversified between Asian and European domestic pigs 5.2 Proposals This study should be combined with research on microsatellites to provide more evidence and determine the purebred Mong Cai pig In terms of the study on the MC1R gene and coat color of Mong Cai pig, a larger sample size should be carried out to provide convincing evidence on the association of gene polymorphism with coat phenotype All things considered, the way from gene to protein and then phenotype always is a miracle, and this attracts me a lot It may take decades to explore the solution to this problem But this work provides me with the background and passion to pursue this topic 50 REFERENCES 10 11 12 13 Ai, H., Huang, L., & Ren, J (2013) Genetic Diversity, Linkage Disequilibrium and Selection Signatures in Chinese and Western Pigs Revealed by Genome-Wide SNP Markers PLOS ONE, 8(2), e56001 https://doi.org/10.1371/JOURNAL.PONE.0056001 Andersson, L (2003) Melanocortin receptor variants with phenotypic effects in horse, pig, and chicken Annals of the New York Academy of Sciences, 994, 313–318 https://doi.org/10.1111/J.1749-6632.2003.TB03195.X Anh Tuan Bui, Nguyen, D H., Ngoc Minh Nghiem, & Thi Bich Thuy Vo (2018) Genetic diversity of mitochondrial genome and evolutional origin of six Vietnamese indigenous pig breeds Vietnam Journal of Science and Technology, 53–59 Bailey, J M., Dunne, M P., & Martin, N G (2000) Genetic and environmental influences on sexual orientation and its correlates in an Australian twin sample Journal of Personality and Social Psychology, 78(3), 524–536 https://doi.org/10.1037//00223514.78.3.524 Bosse, M (2020) The hybrid nature of pig genomes: Unraveling the mosaic haplotype structure in wild and commercial Sus scrofa populations Wageningen University Brown, W M., George, M., & Wilson, A C (1979) Rapid evolution of animal mitochondrial DNA Proceedings of the National Academy of Sciences of the United States of America, 76(4), 1967 https://doi.org/10.1073/PNAS.76.4.1967 Chen, L., Guo, W., Ren, L., Yang, M., Zhao, Y., Guo, Z., Yi, H., Li, M., Hu, Y., Long, X., Sun, B., Li, J., Zhai, S., Zhang, T., Tian, S., Meng, Q., Yu, N., Zhu, D., Tang, G., … Li, N (2016) A de novo silencer causes elimination of MITF-M expression and profound hearing loss in pigs BMC Biology, 14(1), 1–15 https://doi.org/10.1186/S12915-016-0273-2/FIGURES/6 Darwin, C (1868) The Variation of Animals and Plants under Domestication John Murray Drögemüller, C., Giese, A., Martins-Wess, F., Wiedemann, S., Andersson, L., Brenig, B., Fries, R., & Leeb, T (2006) The mutation causing the black-and-tan pigmentation phenotype of Mangalitza pigs maps to the porcine ASIP locus but does not affect its coding sequence Mammalian Genome 2006 17:1, 17(1), 58–66 https://doi.org/10.1007/S00335-005-0104-1 Du, Z., D’alessandro, E., Zheng, Y., Wang, M., Chen, C., Wang, X., & Song, C (2022) Retrotransposon Insertion Polymorphisms (RIPs) in Pig Coat Color Candidate Genes Animals, 12(8), 969 https://doi.org/10.3390/ANI12080969/S1 Duc Nguyen Van (2006) Mong Cai pig genetic resource : Vol 6th edition Labor and Social Publisher Fang, M., Larson, G., Ribeiro, H S., Li, N., & Andersson, L (2009) Contrasting Mode of Evolution at a Coat Color Locus in Wild and Domestic Pigs PLoS Genetics, 5(1) https://doi.org/10.1371/JOURNAL.PGEN.1000341 Frantz, L A F., Haile, J., Lin, A T., Scheu, A., Geörg, C., Benecke, N., Alexander, M., Linderholm, A., Mullin, V E., Daly, K G., Battista, V M., Price, M., Gron, K J., Alexandri, P., Arbogast, R M., Arbuckle, B., Bǎlǎşescu, A., Barnett, R., Bartosiewicz, L., … Larson, G (2019) Ancient pigs reveal a near-complete genomic turnover following their introduction to Europe Proceedings of the National Academy of Sciences of the United States of America, 116(35), 17231–17238 https://doi.org/10.1073/PNAS.1901169116/SUPPL_FILE/PNAS.1901169116.SD02.X 51 14 15 16 17 18 19 20 21 22 23 24 25 26 LSX Giuffra, E., Kijas, J M H., Amarger, V., Carlborg, Ö., Jeon, J T., & Andersson, L (2000) The origin of the domestic pig: independent domestication and subsequent introgression Genetics, 154(4), 1785 https://doi.org/10.1093/GENETICS/154.4.1785 Hunt, R., Sauna, Z E., Ambudkar, S V., Gottesman, M M., & Kimchi-Sarfaty, C (2009) Silent (synonymous) SNPs: should we care about them? Methods in Molecular Biology (Clifton, N.J.), 578, 23–39 https://doi.org/10.1007/978-1-60327-411-1_2 Ishihara, S., Yamasaki, F., Ninh, P H., Dinh, N C., Arakawa, A., Taniguchi, M., Cuc, N T K., Mikawa, S., Takeya, M., & Kikuchi, K (2020) The phenotypic characteristics and relational database for Vietnamese native pig populations Animal Science Journal, 91(1), e13411 https://doi.org/10.1111/ASJ.13411 Jackson, I J (1994) Molecular and developmental genetics of mouse coat color Annual Review of Genetics, 28(1), 189–217 https://doi.org/10.1146/ANNUREV.GE.28.120194.001201 Johansson Moller, M., Chaudhary, R., Hellmén, E., Höyheim, B., Chowdhary, B., & Andersson, L (1996) Pigs with the dominant white coat color phenotype carry a duplication of the KIT gene encoding the mast/stem cell growth factor receptor Mammalian Genome 1996 7:11, 7(11), 822–830 https://doi.org/10.1007/S003359900244 Jones, G F (1998) Genetic Aspects of Domestication, Common Breeds and Their Origin CAB International, The Genetics of the Pig, 17–50 Kijas, J M H., Moller, M., Plastow, G., & Andersson, L (2001) A frameshift mutation in MC1R and a high frequency of somatic reversions cause black spotting in pigs Genetics, 158(2), 779–785 https://doi.org/10.1093/GENETICS/158.2.779 Kijas, J M H., Wales, R., Törnsten, A., Chardon, P., Moller, M., & Andersson, L (1998) Melanocortin receptor (MC1R) mutations and coat color in pigs Genetics, 150(3), 1177 https://doi.org/10.1093/GENETICS/150.3.1177 Klungland, H., Vage, D I., Gomez-Raya, L., Adalsteinsson, S., & Lien, S (1995) The role of melanocyte-stimulating hormone (MSH) receptor in bovine coat color determination Mammalian Genome, 6(9), 636–639 https://doi.org/10.1007/BF00352371 Krause-Kyora, B., Makarewicz, C., Evin, A., Flink, L G., Dobney, K., Larson, G., Hartz, S., Schreiber, S., Von Carnap-Bornheim, C., Wurmb-Schwark, N., & Nebel, A (2013) Use of domesticated pigs by Mesolithic hunter-gatherers in northwestern Europe Nature Communications 2013 4:1, 4(1), 1–7 https://doi.org/10.1038/ncomms3348 Lemke, U., Mergenthaler, M., Rưßler, R., Huyen, L T T., Herold, P., Kaufmann, B., & Valle Zárate, A (2008) Pig production in Vietnam - A review CAB Reviews: Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources, https://doi.org/10.1079/PAVSNNR20083023 Li, J., Yang, H., Li, J R., Li, H P., Ning, T., Pan, X R., Shi, P., & Zhang, Y P (2010a) Artificial selection of the melanocortin receptor gene in Chinese domestic pigs during domestication Heredity 2010 105:3, 105(3), 274–281 https://doi.org/10.1038/hdy.2009.191 Li, J., Yang, H., Li, J R., Li, H P., Ning, T., Pan, X R., Shi, P., & Zhang, Y P (2010b) Artificial selection of the melanocortin receptor gene in Chinese domestic pigs during domestication Heredity 2010 105:3, 105(3), 274–281 https://doi.org/10.1038/hdy.2009.191 52 27 28 29 30 31 32 33 34 35 36 37 38 39 Lin, J Y., & Fisher, D E (2007) Melanocyte biology and skin pigmentation Nature, 445(7130), 843–850 https://doi.org/10.1038/NATURE05660 Liu, R., Jin, L., Long, K., Chai, J., Ma, J., Tang, Q., Tian, S., Hu, Y., Lin, L., Wang, X., Jiang, A., Li, X., & Li, M (2016) Detection of genetic diversity and selection at the coding region of the melanocortin receptor (MC1R) gene in Tibetan pigs and Landrace pigs Gene, 575(2 Pt 2), 537–542 https://doi.org/10.1016/J.GENE.2015.09.032 Lu, C., Yu, H., Xing, Y., Cheng, Y Y., Wu, Q Y., Li, S M., Fu, H Y., Zhang, X., Hao, L L., & Liu, D (2017) Haplotype diversity in MC1R locus between the Min and white-haired pig breeds Https://Doi.Org/10.1080/09064702.2017.1337215, 67(1–2), 28–33 https://doi.org/10.1080/09064702.2017.1337215 Luetkemeier, E S., Sodhi, M., Schook, L B., & Malhi, R S (2010) Multiple Asian pig origins revealed through genomic analyses Molecular Phylogenetics and Evolution, 54(3), 680–686 https://doi.org/10.1016/J.YMPEV.2009.11.004 Mao, H., Ren, J., Ding, N., Xiao, S., & Huang, L (2010) Genetic variation within coat color genes of MC1R and ASIP in Chinese brownish red Tibetan pigs Animal Science Journal = Nihon Chikusan Gakkaiho, 81(6), 630–634 https://doi.org/10.1111/J.17400929.2010.00789.X Marklund, S., Kijas, J., Rodriguez-Martinez, H., Ronnstrand, L., Funa, K., Moller, M., Lange, D., Edfors-Lilja, I., & Andersson, L (1998) Molecular Basis for the Dominant White Phenotype in the Domestic Pig Genome Research, 8(8), 826–833 https://doi.org/10.1101/GR.8.8.826 Moreiras, H., Seabra, M C., & Barral, D C (2021) Melanin Transfer in the Epidermis: The Pursuit of Skin Pigmentation Control Mechanisms International Journal of Molecular Sciences, 22(9), 4466 https://doi.org/10.3390/IJMS22094466 Muñoz, M., Bozzi, R., García, F., Núđez, Y., Geraci, C., Crovetti, A., García-Casco, J., Alves, E., Škrlep, M., Charneca, R., Martins, J M., Quintanilla, R., Tibau, J., Kušec, G., Djurkin-Kušec, I., Mercat, M J., Riquet, J., Estellé, J., Zimmer, C., … Óvilo, C (2018) Diversity across major and candidate genes in European local pig breeds PLOS ONE, 13(11), e0207475 https://doi.org/10.1371/JOURNAL.PONE.0207475 Okumura, N., Ishiguro, N., Nakano, M., Hirai, K., Matsui, A., & Sahara, M (1996) Geographic population structure and sequence divergence in the mitochondrial DNA control region of the Japanese wild boar (Sus scrofa leucomystax), with reference to those of domestic pigs Biochemical Genetics, 34(5–6), 179–189 https://doi.org/10.1007/BF02407018 Pham, L D., Do, D N., Nam, L Q., van Ba, N., Minh, L T A., Hoan, T X., Cuong, V C., & Kadarmideen, H N (2014) Molecular genetic diversity and genetic structure of Vietnamese indigenous pig populations Journal of Animal Breeding and Genetics = Zeitschrift Fur Tierzuchtung Und Zuchtungsbiologie, 131(5), 379–386 https://doi.org/10.1111/JBG.12068 Purwantini, D., Yuwanta, T., Hartatik, T., & Smoyowati, I (2013) Morphology and genetic diversity of mitochondrial DNA D-loop region using PCR-RFLP analysis in Magelang duck and other native duck Journal of the Indonesian Tropical Animal Agriculture, 38(1), 1–9 https://doi.org/10.14710/JITAA.38.1.1-9 Ren, J., Mao, H., Zhang, Z., Xiao, S., Ding, N., & Huang, L (2010) A 6-bp deletion in the TYRP1 gene causes the brown colouration phenotype in Chinese indigenous pigs Heredity 2011 106:5, 106(5), 862–868 https://doi.org/10.1038/hdy.2010.129 Robbins, L S., Nadeau, J H., Johnson, K R., Kelly, M A., Roselli-Rehfuss, L., Baack, 53 40 41 42 43 44 45 46 47 48 49 50 E., Mountjoy, K G., & Cone, R D (1993) Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function Cell, 72(6), 827–834 https://doi.org/10.1016/0092-8674(93)90572-8 Robins, A H (1991) Biological Perspective on Human Population Cambridge University Press Searle, A G (1968) Comparative genetics of coat colour in mammals Comparative Genetics of Coat Colour in Mammals Sponenberg, D P (1996) Equine Coat Color Genetics Iowa State University Press Thiruvenkadan, A K., Kandasamy, N., & Panneerselvam, S (2008) Coat colour inheritance in horses Livestock Science, 117(2–3), 109–129 https://doi.org/10.1016/J.LIVSCI.2008.05.008 Thuy, N T D., Melchinger-Wild, E., Kuss, A W., Cuong, N V., Bartenschlager, H., & Geldermann, H (2006) Comparison of Vietnamese and European pig breeds using microsatellites Journal of Animal Science, 84(10), 2601–2608 https://doi.org/10.2527/JAS.2005-641 Thuy Nhien Thi Tran, Ni, P., Chen, J., Le, T T., Steve, K., Han, J., Wang, H., & Zhao, S (2016) The complete mitochondrial genome of Mong Cai pig (Sus scrofa) in Vietnam Http://Www.Tandfonline.Com/Action/AuthorSubmission?JournalCode=tmdn20&page =instructions, 1(1), 226–227 https://doi.org/10.1080/23802359.2016.1155424 Tsai, L C., Lee, J C I., Liao, S P., Weng, L H., Linacre, A., & Hsieh, H M (2009) Establishing the mitochondrial DNA D-loop structure of Columba livia Electrophoresis, 30(17), 3058–3062 https://doi.org/10.1002/ELPS.200900194 Wang, C., Wang, H., Zhang, Y., Tang, Z., Li, K., & Liu, B (2015) Genome-wide analysis reveals artificial selection on coat colour and reproductive traits in Chinese domestic pigs Molecular Ecology Resources, 15(2), 414–424 https://doi.org/10.1111/1755-0998.12311 Wang, Y., Zhang, C., Peng, Y., Cai, X., Hu, X., Bosse, M., & Zhao, Y (2022) Wholegenome analysis reveals the hybrid formation of Chinese indigenous DHB pig following human migration Evolutionary Applications, 15(3), 501–514 https://doi.org/10.1111/EVA.13366 Watanabe, T., Hayashi, Y., Kimura, J., Yasuda, Y., Saitou, N., Tomita, T., & Ogasawara, N (1986) Pig mitochondrial DNA: polymorphism, restriction map orientation, and sequence data Biochemical Genetics, 24(5–6), 385–396 https://doi.org/10.1007/BF00499094 Wu, X., Tan, Z., Shen, L., Yang, Q., Cheng, X., Liao, K., Bai, L., Shuai, S., Li, M., Li, X., Zhang, S., & Zhu, L (2017) Coat colour phenotype of Qingyu pig is associated with polymorphisms of melanocortin receptor gene Asian-Australasian Journal of Animal Sciences, 30(7), 938–943 https://doi.org/10.5713/AJAS.16.0376 54 APPENDIX Appendix 1: The alignment result of mtDNA D-loop region of pig breeds: Mong Cai (KU556691; KX147100); Huong (KY964306); Meishan (KM998967); Hampshire (AY574046) Appendix 2: Mong Cai pig’s MC1R coding sequences with GenBank association codes OP142697 – OP142700 >MC010 ATGCCTGTGCTTGGCCCGGAGAGGAGGCTGCTGGCTTCCCTCAGCTCCGCACCCC CAGCCGCCCCCCGCCTCGGGCTGGCCGCCAACCAGACCAACCAGACGGGCCCCC AGTGCCTGGAGGTGTCCATTCCCGACGGGCTCTTCCTCAGCCTGGGGCTGGTGAG CCTCGTGGAGAACGTGCTGGTGGTGGCCGCCATCGCCAAGAACCGCAACCTGCA CTCGCCCATGTACTACTTCGTCTGCTGCCTGGCCGTGTCGGACCTGCTGGTGAGC GTGAGCAACATGCTGGAGACGGCCGTGCTGCCGCTGCTGGAGGCGGGCGCCCTG GCCGCCCAGGCCGCCGTGGTGCAGCAGCTGGACAACGTCATGGACGTGCTCATC TGCGGCTCCATGGTGTCCAGCCTCTGCTTCCTGGGCGCCATCGCCGTGGACCGCT ACGTGTCCATCTTCTACGCGCTGCGCTACCACAGCATCGTGACGCTGCCCCGCGC GGGGCGGGCCATCGCGGCCATCTGGGCGGGCAGCGTGCTCTCCAGCACCCTCTTC ATCGCCTACTACCACCACACGGCCGTCCTGCTGGGCCTCGTCAGCTTCTTCGTGG CCATGCTGGCGCTCATGGCGGTACTGTACGTCCACATGCTGGCCCGGGCCTGCCA GCACGGCCGGCACATCGCCCGGCTCCACAAGACGCAGCACCCCACCCGCCAGGG CTGCGGCCTCAAGGGCGCAGCCACCCTCACCATCCTGCTGGGCGTCTTCCTCCTC TGCTGGGCACCCTTCTTCCTGCACCTCTCCCTCGTCGTCCTCTGCCCCCAGCACCC CACCTGCGGCTGCGTCTTCAAGAACGTCAACCTCTTTCTGGCCCTCGTCATCTGC AACTCCATCGTGGACCCCCTCATCTACGCCTTCCGCAGCCAGGAGCTCCGCAAGA CCCTCCAGGAGGTGCTGCAGTGCTCCTGGTGA >MC020 ATGCCTGTGCTTGGCCCGGAGAGGAGGCTGCTGGCTTCCCTCAGCTCCGCACCCC CAGCCGCCCCCCGCCTCGGGCTGGCCGCCAACCAGACCAACCAGACGGGCCCCC AGTGCCTGGAGGTGTCCATTCCCGACGGGCTCTTCCTCAGCCTGGGGCTGGTGAG CCTCGTGGAGAACGTGCTGGTGGTGGCCGCCATCGCCAAGAACCGCAACCTGCA CTCGCCCATGTACTACTTCGTCTGCTGCCTGGCCGTGTCGGACCTGCTGGTGAGC GTGAGCAACATGCTGGAGACGGCCGTGCTGCCGCTGCTGGAGGCGGGCGCCCTG GCCGCCCAGGCCGCCGTGGTGCAGCAGCTGGACAACGTCATGGACGTGCTCATC TGCGGCTCCATGGTGTCCAGCCTCTGCTTCCTGGGCGCCATCGCCGTGGACCGCT ACGTGTCCATCTTCTACGCGCTGCGCTACCACAGCATCGTGACGCTGCCCCGCGC GGGGCGGGCCATCGCGGCCATCTGGGCGGGCAGCGTGCTCTCCAGCACCCTCTTC ATCGCCTACTACCACCACACGGCCGTCCTGCTGGGCCTCGTCAGCTTCTTCGTGG CCATGCTGGCGCTCATGGCGGTACTGTACGTCCACATGCTGGCCCGGGCCTGCCA GCACGGCCGGCACATCGCCCGGCTCCACAAGACGCAGCACCCCACCCGCCAGGG CTGCGGCCTCAAGGGCGCGGCCACCCTCACCATCCTGCTGGGCGTCTTCCTCCTC TGCTGGGCACCCTTCTTCCTGCACCTCTCCCTCGTCGTCCTCTGCCCCCAGCACCC CACCTGCGGCTGCGTCTTCAAGAACGTCAACCTCTTTCTGGCCCTCGTCATCTGC AACTCCATCGTGGACCCCCTCATCTACGCCTTCCGCAGCCAGGAGCTCCGCAAGA CCCTCCAGGAGGTGCTGCAGTGCTCCTGGTGA >MC12009 ATGCCTGTGCTTGGCCCGGAGAGGAGGCTGCTGGCTTCCCTCAGCTCCGCACCCC CAGCCGCCCCCCGCCTCGGGCTGGCCGCCAACCAGACCAACCAGACGGGCCCCC AGTGCCTGGAGGTGTCCATTCCCGACGGGCTCTTCCTCAGCCGGGGGCTGGTGAG CCTCGTGGAGAACGTGCTGGTGGTGGCCGCCATCGCCAAGAACCGCAACCTGCA CTCGCCCATGTACTACTTCGTCTGCTGCCTGGCCGTGTCGGACCTGCTGGTGAGC GTGAGCAACATGCTGGAGACGGCCGTGCTGCCGCTGCTGGAGGCGGGCGCCCTG GCCGCCCAGGCCGCCGTGGTGCAGCAGCTGGACAACGTCATGGACGTGCTCATC TGCGGCTCCATGGTGTCCAGCCTCTGCTTCCTGGGCGCCATCGCCGTGGACCGCT ACGTGTCCATCTTCTACGCGCTGCGCTACCACAGCATCGTGACGCTGCCCCGCGC GGGGCGGGCCATCGCGGCCATCTGGGCGGGCAGCGTGCTCTCCAGCACCCTCTTC ATCGCCTACTACCACCACACGGCCGTCCTGCTGGGCCTCGTCAGCTTCTTCGTGG CCATGCTGGCGCTCATGGCGGTACTGTACGTCCACATGCTGGCCCGGGCCTGCCA GCACGGCCGGCACATCGCCCGGCTCCACAAGACGCAGCACCCCACCCGCCAGGG CTGCGGCCTCAAGGGCGCAGCCACCCTCACCATCCTGCTGGGCGTCTTCCTCCTC TGCTGGGCACCCTTCTTCCTGCACCTCTCCCTCGTCGTCCTCTGCCCCCAGCACCC CACCTGCGGCTGCGTCTTCAAGAACGTCAACCTCTTTCTGGCCCTCGTCATCTGC AACTCCATCGTGGACCCCCTCATCTACGCCTTCCGCAGCCAGGAGCTCCGCAAGA CCCTCCAGGAGGTGCTGCAGTGCTCCTGGTGA >MC13013 ATGCCTGTGCTTGGCCCGGAGAGGAGGGTGCTGGCTTCCCTCAGCTCCGCACCCC CAGCCGCCCCCCGCCTCGGGCTGGCCGCCAACCAGACCAACCAGACGGGCCCCC AGTGCCTGGAGGTGTCCATTCCCGACGGGCTCTTCCTCAGCCTGGGGCTGGTGAG CCTCGTGGAGAACGTGCTGGTGGTGGCCGCCATCGCCAAGAACCGCAACCTGCA CTCGCCCATGTACTACTTCGTCTGCTGCCTGGCCGTGTCGGACCTGCTGGTGAGC GTGAGCAACATGCTGGAGACGGCCGTGCTGCCGCTGCTGGAGGCGGGCGCCCTG GCCGCCCAGGCCGCCGTGGTGCAGCAGCTGGACAACGTCATGGACGTGCTCATC TGCGGCTCCATGGTGTCCAGCCTCTGCTTCCTGGGCGCCATCGCCGTGGACCGCT ACGTGTCCATCTTCTACGCGCTGCGCTACCACAGCATCGTGACGCTGCCCCGCGC GGGGCGGGCCATCGCGGCCATCTGGGCGGGCAGCGTGCTCTCCAGCACCCTCTTC ATCGCCTACTACCACCACACGGCCGTCCTGCTGGGCCTCGTCAGCTTCTTCGTGG CCATGCTGGCGCTCATGGCGGTACTGTACGTCCACATGCTGGCCCGGGCCTGCCA GCACGGCCGGCACATCTCCCGGCTCCACAAGACGCCGCACCCCACCCGCCAGGG GTGCGGCGTCAAGGGGGCAGCCACCCTCACCATCCTGCTGGGCGTCTTCCTCCTC TGCTGGGCACCCTTCTTCCTGCACCTCTCCCTCGTCGTCCTCTGCCCCCAGCACCC CACCTGCGGCTGCGTCTTCAAGAACGTCAACCTCTTTCTGGCCCTCGTCATCTGC AACTCCATCGTGGACCCCCTCATCTACGCCTTCCGCAGCCAGGAGCTCCGCAAGA CCCTCCAGGAGGTGCTGCAGTGCTCCTGGTGA Appendix 3: Figures of 26 Mong Cai pigs which were studied in analysing about MC1R gene 010 12006 12007 080 32029 32095 12008 13014 13015 32016 42024 21026 020 13002 41021 42022 32033 42027 42030 13153 32007 3628 31089 32046 12009 13013 Result of part 4.1.2 has been accepted for poster presentation and published in proceeding of the Vietnam National Conference on Biotechnology 2022 Time: November 04th, 2022 Place: Tay Nguyen University ********** DESIGNING THE DNA MARKERS FOR DETERMINING THE MATERNAL LINEAGE ORIGIN OF THE MONG CAI PIG BREED Thuy Thi Thu Cao1, Giang Huong Nguyen1, Khoa Van Nguyen1, Mai Thi Thanh Nguyen1, Trung Thanh Ngo2, Trung Quoc Nguyen1* 1Faculty 2Faculty of Biotechnology, Vietnam National University of Agriculture of Veterinary Medicine, Vietnam National University of Agriculture SUMMARY Mong Cai pig (Sus scrofa) is the most popular indigenous pig breed in Vietnam, having the preeminent feature of fertility, a large number of piglets per litter, and saving the piglets carefully, typically with a black saddle coat phenotype The introgression of exotic pig breeds into Vietnam and crossing with Mong Cai pigs aimed at increasing yield productivity has occurred at the expense of variables in their phenotypes In this study, the mitochondrial genome of the Mong Cai pig was compared with other breeds to design DNA primers that could identify the maternal origin of this breed A total of 91 Mong Cai pigs along with an individual of Hampshire breed, an individual of Meishan breed, and individuals of Huong breed, were sampled at swine farms in Quang Ninh province Two primer pairs Mtmc3, Mtmc4 were developed based on multiple sequences alignment of these pig breeds’ whole mtDNA sequences, to amplify the amplicon varying from 700bp to 1000bp to cover the Indel detected among D-loop regions A total of alleles representing pig breeds were found from the amplified result for each primer pair It was found that several Mong Cai pig individuals had maternal origin from Hampshire, Meishan, and Huong breed It is due to the outcrossing trend by farmers to improve production traits in this breed The two designed markers proved a high level of polymorphism and currently assisted in maternal lineage identification of the Mong Cai breed These markers should be further studied to determine the origin and save the Mong Cai pure breeding individual Keywords: marker, D-loop, mtDNA, Mong Cai pig, maternal origin *Author for corresponding: Tel +84 97 6588239; Email: nqtrung@vnua.edu.vn The sample collecting method used in this study has been accepted for abstract presentation and published in the proceeding of The 13th International Conference on Application of Information Technology in Agriculture Asian-Pacific region Time: November 24th -26th, 2022 Place: University of Engineering and Technology, Vietnam National University, Hanoi (VNU-UET) ****** LOW-COST AND FARMER-FRIENDLY METHOD FOR SURVEYING LOCAL ANIMAL RESOURCES: MONGCAI PIG BREED Nguyen Quoc Trung1, Nguyen Huong Giang2, Nguyen Van Khoa2, Nguyen Thi Thanh Mai2, Cao Thi Thu Thuy2 , Nguyen Tien Duc2 , Ngo Thanh Trung3 , Tong Van Hai2* 1) Vietnam National University of Agriculture, Faculty of Biotechnology, Vietnam nqtrung@vnua.edu.vn 2) Vietnam National University of Agriculture, Faculty of Biotechnology, Vietnam 3) Vietnam National University of Agriculture, Faculty of Veterinary Medicine, Vietnam * Corresponding author ABSTRACT: Mong Cai pig is an indigenous pig breed, which originated in Quang Ninh province, Vietnam, with the typical traits for the breed There are many difficulties to evaluate the quality of this breed, as well as for farmers, in the selection process at present We studied a farmer-friendly method based on common online platforms to survey and monitor Mong Cai pig genetic resources A survey form was created on Google form based on the special traits of the Mong Cai pig breed, quantity traits, and some general information All these categories were evaluated, and pictures of each individual were taken, then immediately filled on this online form The information of each pig was instantly saved in excel format and cloud storage after the categories parameter and pictures are recorded This method can be easily connected among farms then providing a useful database source for further analysis of the disease, inheritance, etc Keywords: Database, Mong Cai pig, farmer-friendly, genetic resources, survey