Isolation and characterization of fungus associated with leaf spot of grapevines in viet nam (khóa luận tốt nghiệp)

VIETNAM NATIONAL UNIVERSITY OF AGRICULTURE FACULTY OF BIOTECHNOLOGY  THESIS TITLE: ISOLATION AND CHARACTERIZATION OF FUNGUS ASSOCIATED WITH LEAF SPOT OF GRAPEVINES IN VIET NAM HANOI – 2022 VIETNAM NATIONAL UNIVERSITY OF AGRICULTURE FACULTY OF BIOTECHNOLOGY  UNDERGRADUATE THESIS ISOLATION AND CHARACTERIZATION OF FUNGUS ASSOCIATED WITH LEAF SPOT OF GRAPEVINES IN VIET NAM Student’s name : Giap Thi Thuy Chi Student’s code : 620429 Class : K62-CNSHE Supervisor : Dr PHAM HONG HIEN MSc NGUYEN THANH HUYEN HA NOI – 2022 COMMITMENT I hereby declare that all the data and the results that I have provided in this thesis are truthful, accurate, and not used in any other reports I also assure you that any help in this thesis has been greatly appreciated thankful and the information cited has been acknowledged Hanoi, May, 2022 Student Giap Thi Thuy Chi i ACKNOWLEDGEMENTS First and foremost, I have to thank the Vietnam National University of Agriculture for giving me a chance to study in a professional environment that provided me the sufficient knowledge throughout four and a half academic years In doing my thesis, many people helped me bring this work into existence, but the most influential and inspiring person I would like to extend thanks to is my supervisor, MSc Nguyen Thanh Huyen without her assistance and dedicated involvement in every step throughout the thesis, this thesis would have never been accomplished I would like to express my deep gratitude to all teachers from the Faculty of Biotechnology, who encouraged me to enhance my knowledge and help me get orientation for my thesis Getting through my undergraduate thesis required more than academic support, and I have many, many people to thank for listening to and, at times, having to tolerate me, thank all my friends, who were with me up until this point, simultaneously motivate me to accomplish more Last but not least, I would like to thank myself, and my parents who endured this long process, for always supporting and assisting me during the process of completed graduate thesis Ha Noi, May, 2022 Student Giap Thi Thuy Chi ii ABSTRACT Grapevine (Vitis spp.) is among the most widely grown fruit crops worldwide and plays a significant role in its commercial value in Vietnam as well as having an excellent source of nutrition However, recently many diseases appeared and affected the yield and quality such as downy mildew (Plasmopara viticola), powdery mildew (Uncinula necator), and leaf spot (Phomopsis viticola) Among them, leaf spot disease is a fairly common disease and causes a significant reduction in the yield of Grapevines The thesis was conducted in leaf spots of grapevines collected from different places in Ha Noi and Bac Giang, Vietnam in 2021 The fungus was Isolated from leaf spot disease on grapevines, and the fungus was selected and then used for artificial infection into healthy grapevine leaves The fungal strains causing the grape leaf spots will be selected to study the morphological and biochemical characteristics, as well as the conditions affecting the growth of the fungus Then, these fungal strains are identified by molecular tools Research results show that strains (SM and HV) of fungi have been isolated, but after re-infection, only one strain (SM) is capable of causing leaf spot disease on grape leaves, SM strain has mycelium that is profusely branched (monopodial branching) Studying the growth conditions of fungal strains proves that SM grows well on MEA and PDA, at around the temperature range of 20-30°C with pH from 5.0 to 8.0 SM strain has the ability to produce chitinase, cellulase, and pectinase The causal fungus strain (SM) was identified as Phomopsis viticola iii INDEX COMMITMENT i ABSTRACT iii LIST OF ABBREVIATIONS vi LIST OF TABLES vii LIST OF FIGURES viii I INTRODUCTION .1 1.1 Introduction 1.2 Research purpose 1.3 Requirement II LITERATURE REVIEW 2.1 General introduction of grapevines .2 2.1.1 Distribution 2.1.2 Description of morphological characteristics of the grapevine 2.1.3 Nutrients 2.1.4 Uses .7 2.2 Grapevine pathogens 2.2.1 Downy mildew (Plasmopara viticola) 2.2.2 Powdery mildew (Uncinula necator) 10 2.2.3 Leaf spot (Phomopsis viticola) 11 2.3 Commercial production 14 III MATERIALS AND METHODS 17 3.1 Materials 17 3.1.1 Sample collection 17 3.1.2 Chemicals and medium components 17 3.1.3 Laboratory apparatuses and equipment 19 3.1.4 Research location and time 19 3.2 Methods 19 3.2.1 Isolation of fungus causing leaf spot disease on grapes (Chomnunti et al ,2014) 19 iv 3.2.2 Artificial infection (Jayawardena, Ruvishika S., et al.,2016) 19 2011) 20 3.2.4 The effects of some factors on fungal growth (culture medium, temperature, and pH ) 20 3.2.5 Extracellular enzyme production of isolated fungal strain 21 3.2.6 DNA extraction, PCR amplification and Sequencing 22 3.2.7 Phylogenetic analysis 23 IV RESULTS AND DISCUSSION 24 4.1 Isolation of fungal pathogens causing leaf spots from grapevines leaf 24 4.2 Artificial infection 25 4.3 Morphological characteristics of SM strain 25 4.4 The effects of culture medium on SM strain growth 27 4.5 Effect of different temperatures on the growth of SM strain 28 4.6 Effect of different pH on the growth of SM strain 29 4.7 Testing extracellular enzyme activity 30 4.8 DNA extraction, PCR amplification and Sequencing and Phylogenetic analysis 33 4.8.1 DNA extraction, PCR amplification of SM strain 33 4.8.2 Phylogenetic analysis of SM strain 34 V CONCLUSION AND SUGGESTION 36 5.1 Conclusion 36 5.2 Suggestion 36 REFERENCES 37 v LIST OF ABBREVIATIONS Abbreviations Explanations PDA Potato Dextrose Agar SDA Sabouraud Dextrose Agar MEA Malt Extract Agar CDA Czapek Dox Agar WA Water Agar ISP International Streptomyces Project et al Et alia CWDEs CMC cell wall-degrading enzymes Carboxymethyl cellulose vi LIST OF TABLES Table 2.1 Nutrition of Grapes Table 3.1 Experimental materials for detecting extracellular enzymes 18 Table 4.1 Morphological characterization of two isolated fungal strains 24 Table 4.2 The ability of extracellular enzyme production of SM 31 vii LIST OF FIGURES Figure 2.1 One grapevine garden in Ninh Thuan Figure 2.2 Symptoms of powny mildew disease Figure 2.3 Symptoms of powdery mildew disease 11 Figure 2.4 Symptoms of leaf spot disease 13 Figure 3.1 Leaf samples with leaf spot disease 17 Figure 4.1 Fungal strains isolated from infected grape leaves 24 Figure 4.2 Re-infection of isolated fungal strains (HV, SM) in grapevine leaf and control sample on the 3rd days 25 Figure 4.3 Microscopic observation of the selected fungus strain-SM 26 Figure 4.4 Growth of SM strain in different media on the 5th days 27 Figure 4.5 Growth of SM strain in different temperatures on the 5th days 28 Figure 4.6 Growth of SM strain in different pH on the 5th days 30 Figure 4.7 Chitinase activity of the SM strain 31 Figure 4.8 Cellulase activity of the SM strain 32 Figure 4.9 Pectinase activity of the SM strain 32 Figure 4.10 PCR product of SM strain on gel agarose 33 Figure 4.11 Phylogenetic tree of SM strain 34 viii The morphological characters of both colony and conidia were in agreement with those described by van Rensburg et al (2006) for Phomopsis sp., 4.4 The effects of culture medium on SM strain growth The SM strain was incubated at 30°C on the different media: PDA, CDA, SDA, ISP2, MEA, and WA Figure 4.4 Growth of SM strain in different media on the 5th day The SM strain was grown on different media (PDA, CDA, SDA, ISP2, MEA, and WA) for days at 30°C Based on the growth diameter of fungal hyphae, as well as the filament density that could be obtained found that in PDA medium, SM strain can grow well with the largest colony diameter (89.5 mm), then MEA medium (87.67 mm), and in WA medium, the fungus strain almost did not grow 27 The results in this study is consistent with the results of Mary ‐ Lorène Goddard et al., (2014) show that Phomopsis sp thrived in the PDA medium similar to the study of Mbong et al., (2015) also showed that in the PDA and MEA medium, Phomopsis sp largest growth However, according to Guo and Ko (1993), the PDA medium is not the medium in which the fungus grows best, but the SDA medium, agreeing with Guo and Ko, Tsopmbeng et al., (2012) also studied and suggested that Phomopsis sp grow better on the SDA medium than on PDA medium 4.5 Effect of different temperatures on the growth of SM strain The fungus isolate was incubated on the PDA media at different temperatures: 15°C, 20°C, 30°C, 37°C, and 45°C Figure 4.5 Growth of SM strain in different temperatures on the 5th day The SM strain was grown on different temperatures (15°C, 20°C, 30°C, 37°C, and 45°C) for days on PDA medium Based on the diameter of fungal 28 hyphae, as well as the filament density that could be obtained found that SM strain had the development of largest colony diameter at 30°C, then 20°C in PDA medium, the SM strain almost did not grow at 37°C, 45°C and weak growth was observed at 15°C Some other studies Bakr and Ahmed, 1992; Bakr et al., 1997; Ahmed et al., 2007) that found that 30°C was the optimum temperature for mycelial development of Phomopsis sp and the growth was completely inhibited at 5°C and 35°C respectively 4.6 Effect of different pH on the growth of SM strain The SM strain was grown on PDA with different pH from to 10 for days on PDA medium Based on the diameter of fungal hyphae, as well as the filament density that could be obtained found that the SM strain had the development of the largest colony diameter at pH= 5.0 – 8.0 in PDA medium, the SM strain weak grow at pH= and and did not grow at pH= 10 The result showed that the pH of the culture media affects the growth of microbes Any organism has an optimal pH at which it grows the best Alteration of this pH value leads to undesirable growth For most fungi, there is an orderly increase in growth rate while approaching the optimum “pH” value and a corresponding orderly decrease in growth rate while it starts to vary from the optimal point Each species of microbe is divided into three types based on its own characteristic range of pH values in which it grows and reproduces best The present findings are supported by earlier studies (Madigan MT et al., 2003) found that pH= 4-8 was sutable pH for mycelial development of Phomopsis sp 29 Figure 4.6 Growth of SM strain in different pH on the 5th day 4.7 Testing extracellular enzyme activity The ability of extracellular enzyme production of SM after 24 hours was tested by agar diffusion method, the results are summarized in Table 4.2 30 Table 4.2 The ability of extracellular enzyme production of SM Enzyme Ability of extracellular enzyme production of SM Amylase - Cellulase + Protease - Chitinase + Pectinase + Note: + Ability of extracellular enzyme production of SM; - Unability of extracellular enzyme production of SM Figure 4.7 Chitinase activity of the SM strain The ability to produce the Chitinase enzyme of the SM strain is similar to the previous results of Nir L Gil-ad et al (2000) Chitinase from Phomopsis sp has been successfully used and aids in the digestion of water waste that contains chitin Particularly those originating from sea-food processing facilities, causing significant environmental problems around the world 31 Figure 4.8 Cellulase activity of the SM strain The ability to produce cellulase enzyme of the SM strain is similar to the previous results of Rana and Kaur, 2012 The cellulases break down the cellulose of the cell wall The fungus continues to grow inside the tissues When the epidermis breaks, the fungus emerges Figure 4.9 Pectinase activity of the SM strain 32 Research results showed that SM strain could be biosynthesize pectinase enzyme, the resolution ring diameter is mm Thus, it can be seen that the SM strain has weak activity The ability to produce the Chitinase enzyme of the SM isolates is similar to the previous results of Clark and Lorbeer, (1976); Collmer and Keen, (1986); Cole et al., (1998) Phomopsis sp relies on cell wall degrading enzymes to infect and pectin is a major component of the plant cell wall Enzymes that attack pectic substances in the plant cell wall are thought to play a major role in pathogenicity 4.8 DNA extraction, PCR amplification and Sequencing and Phylogenetic analysis 4.8.1 DNA extraction, PCR amplification of SM strain Total DNA was extracted from the SM fungus strain, and then the ITS1 forward primer and ITS4 reverse primer sequence were used to receive the target DNA fragment The PCR product was then gel electrophoresis 1%(Figure 4.10) The results show that the PCR product gives a clear band, and is qualified for sequencing Figure 4.10 PCR product of SM strain on gel agarose 33 4.8.2 Phylogenetic analysis of SM strain The ITS sequence of SM strain isolate was the following: ATTGGTTCTACCTGATCCGAGGTCAAATTTTCAGAAGTTGGGGGTTTA ACGGCAGGGCACCGCCAGGGCCTTCCAGAACGAGATATAACTACTA CGCTCGGGGTCCTAGCGAGCTCGCCACTAGATTTCAGGGCCTGCCCT CGCTAGAAGGCAGTGCCCCATCACCAAGCCAGGCTTGAGGGTTGAA ATGACGCTCGAACAGGCATGCCCTCCGGAATACCAGAGGGCGCAAT GTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTAC TTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCC GTTGTTGAAAGTTTTGATTCATTTATGTTTTCACTCAGAGATTCACTA TAGAAACAAGAGTTTAGTTGGCCGCCGGCGGGCTGCTCCCTGTTTCC AGGGGGCCTCAGTGAAGAGGCCGGCCTGCGCCGAGGCAACAAATAG GTATAAGTTCACAAAGGGTTTCTGGGTGCGCCGAAGCGCGTTCCAGC AATGATCCCTCCGCAGGTTCACCTACGGAA The received sequence is compared with other sequences on the gene bank by the BLAST tool, and build a phylogenetic tree for SM using MEGA X software The results are shown in figure 4.11: Figure 4.11 Phylogenetic tree of SM strain 34 In BLASTn for the ITS sequences, SM showed 98,73% (543/550 bp), sequence identity values with Phomopsis viticola (GenBank accession No HM746665.1), and high bootstrap value (97%) This confirms that this result is highly reliable This result is consistent with the conclusions of the study of Anco, D J., Erincik, O., & Ellis, M A (2011), Phomopsis viticola strain causes grape leaf spot disease 35 V CONCLUSION AND SUGGESTION 5.1 Conclusion Two fungal strains (SM and HV) were isolated, but after re-infection, only one strain (SM) is capable of causing leaf spot disease on grape leaves, and then SM strains were studied the morphological characteristics, it can be seen that the mycelium of SM is initially white and gradually turns to a pale-yellow color on PDA with circular wavy growth SM showed branched-septate hyphae with colorless Sclerotia Studying the growth conditions of fungal strains proves that SM grows suitable on MEA and PDA, around 20-30°C with pH from 5.0 to 8.0 SM strain has the ability to produce chitinase, cellulase and pectinase The causal fungus strain ( SM) was identified as Phomopsis Viticola 5.2 Suggestion Continue to study SM strain to find out the pathogenic mechanism, as well as find out effective disease control measures on grapevines and other subjects 36 REFERENCES Anco, D J., Erincik, O., & Ellis, M A (2011) “Phomopsis cane and leaf spot of grape” Ohio State University Extension Fact Sheet: HYG303111 Anonymous (1960) “Index of Plant Diseases in the United States" U.S.D.A Agric Handb 165, 1-531 Abdel-Raheem, A., and C Shearer (2002) "Extracellular enzyme production byfreshwater ascomycetes." Fungal Diversity 11:1-19 Butler EJ, Kulkarni GS (1913) “Colocasia blight caused by P colocasiae Rac Memosis of the Deptt” of Agric in India 5:233-259 Cây trồng vật nuôi (2019) “Nghề trồng nho giới Việt Nam”.Cây trồng vật nuôi đồng hàng nông dân Việt Retrieved from https://caytrongvatnuoi.com/cay-trong/cay-an-qua/nghe-trong-nho-trenthe-gioi-va-o-viet-nam/ Chupp C (1953) “Monograph of the fungus genus Cercospora” Published by the Author, Ithaca, New York, 667 pages Crespan, M (2004) "Evidence on the evolution of polymorphism of microsatellite markers in varieties of Vitis vinifera L." Theoretical and Applied Genetics 108(2): 231-237 Ellis M.B (1971) “Dematiaceous Hyphomycetes” Kew, UK: Commonwealth Mycological Institute Erincik, O., Madden, L V., Ferree, D C., & Ellis, M A (2003) “Temperature and Wetness-Duration Requirements for Grape Leaf and Cane Infection by Phomopsis viticola” Plant Disease, 87, 832– 840 doi:10.1094/pdis.2003.87.7.832 10.FAO (2014) “faostat” Food and Agriculture Organization of the United Nations, Rome, Italy Web http:// www.fao.org/faostat/en/#data/QC 11.Farr D.F., Rossman A.Y.(2017) “Fungal Databases Syst Mycol Microbiol Lab.”, Online publication, ARS, USDA, Retrieved 16 February, 2017 37 12.Fatih Mehmet, T O K., and Sibel derviş "Occurrence of isariopsis leaf spot or blight of vitis rupestris caused by pseudocercospora vitis in turkey." 13.Fortes JF, Pecknold PC (1981) “Evaluation of media for sporangial production and radial growth of Phytopthora carctorum Pesq agropec bras Brasilia” 16(2):213-218 14.Gadre UA, Joshi MS (2003) “Influence of weather factors on theincidence of leaf blight of Colocasia” Annuals of PlantProtection Sciences 11(1):168-170 15.Gollifer DE, Brown JF (1974) “Phytophthora leaf blight of Colocasia esculenta in British Soloman Islands” Papua New Guinea Agriculture Journal 25:6-11 16.Gurung K (2001) “Management and yield loss assessment of Colocasia blight” M.Sc (Ag.) thesis submitted to CSKHPKV, Palampur, India 17.Harvey I.C., Wenham H.T, (1997) “ A Fungal Leaf Spot Disease of Grapes Cercosporavitis (Lév) Sacco” , New Zealand Journal of Botany, 10 (1), 87-96 18.Harvey, I C., and H T Wenham (1972) "A Fungal Leaf Spot Disease of Grapes Cercospora vitis (Lév) Sacco." New Zealand Journal of Botany 10.1: 87-96 19.Heuzé V., Thiollet H., Tran G (2017) “Grape leaves and vine shoots” Feedipedia, a programme by INRAE, CIRAD, AFZ and FAO https://www.feedipedia.org/node/512 Last updated on May 10, 2017, 17:17 20.Jackson, R S (2008) Wine science: principles and applications, Academic press 21.Jayawardena, Ruvishika S., et al (2016) "Neopestalotiopsis vitis sp nov causing grapevine leaf spot in China." Phytotaxa 258.1: 63-74 22 Li, W., Hu, M., Xue, Y., Li, Z., Zhang, Y., Zheng, D., Lu, G., Wang, J., & Zhou, J (2020) “Five fungal pathogens are responsible for bayberry twig 38 blight and fungicides were screened for disease control” Microorganisms, https://doi.org/10.3390/microorganisms8050689 23.Liang, C., et al (2016) "Two imide substances from a soil-isolated Streptomyces atratus strain provide effective biocontrol activity against grapevine downy mildew." Biocontrol Science and Technology 26(10): 1337-1351 24.Liang, Chunhao, et al (2016) "Identification and characterization of Pseudocercospora species causing grapevine leaf spot in China." Journal of Phytopathology 164.2: 75-85 25.Merrin, S J., Nair, N G., and Tarran, J (1995) “Variation in Phomopsis recorded in grapevine in Australia and its taxonomic and biological implications” Australas Plant Pathol 24:44-56 26.Merrin, S., et al (1995) "Variation in Phomopsis recorded on grapevine in Australia and its taxonomic and biological implications." Australasian Plant Pathology 24(1): 44-56 27.MIRZAEI S., GOLTAPEH E.M., SHAMS BAKHSH M (2007) “Taxonomical studies on the genus Botrytis in Iran” J Agric Tech 3, 6576 28.Munjal, r J And sethi, k K (1966) “Cercospora species causing leaf spot of grapes in India” Indian Phytopathology 19: 210-4 29.Padmaja G, Uma Devi G, Mahalakshmi B, Sridevi D (2015) “Evaluation of culture media for mycelial and sporangial production of Phytophthora colocasiae” International Journal of Applied Biology and Pharmaceutical Technology.;6:145-147 30.Pearson R., (1998) “Compendium of Grape Diseases” (A.C Goheen ed.) St Paul, Minnesota: American Phytopathological Society 39 31.Rossetto, M., et al (2002) "Evaluating the potential of SSR flanking regions for examining taxonomic relationships in the Vitaceae." Theoretical and Applied Genetics 104(1): 61-66 32.Sahu AK, Maheshwari SK, Sriram S, Misra RS (2000) “Effects of temperature and pH on the growth of Phytophthora colocasiae” Annals of Plant Protection Sciences 8:112 33.Schilder, A M C., Erincik, O., Castlebury, L., Rossman, A., & Ellis, M A (2005) “Characterization of Phomopsis spp Infecting Grapevines in the Great Lakes Region of North America” Plant Disease, 89, 755– 762 doi:10.1094/pd-89-0755 34.Schilder, A., et al (2005) "Characterization of Phomopsis spp infecting grapevines in the Great Lakes region of North America." Plant Disease 89(7): 755-762 35.Sefc, K M., et al (2003) "Evaluation of the genetic contribution of local wild vines to European grapevine cultivars." American Journal of Enology and Viticulture 54(1): 15-21 36.This, P., et al (2004) "Development of a common set of standard varieties and standardized method of scoring microsatellites markers for the analysis of grapevine genetic resources." Theoretical and Applied Genetics 109: 1448-1458 37.Vishnu SN, Muthukrishnan S, Vinaiyaka MH, Muthulekshmi LJ, Raj SM, Syamala SV et al (2012) “Genetic diversity of Phytophthora Colocasia isolates in India based on AFLP analysis” biotech DOI 10.1007/S 13205-012-0101-5 38 Vu Thanh Thuy (2022) “Ninh thuận targets sustainable grape production Vietnam television online newspaper” Retrieved from 40 http://vietnamnews.vn/society/570581/ninh-thuan-targets sustainable grape-production.html 39.Willison, R S., Chamberlain, G C., Townsend, J L., and de Ronde, J H (1965) “Epidemiology and control of dead-arm of grapes” Can J Bot 43:901-914 40.Willison, R., et al (1965) "Epidemiology and control of dead-arm of grapes." Canadian Journal of Botany 43(8): 901-914 41