Isolation and characterization of fungi associated with spolilage of post harvest mango fruits vended in markets of gia lam district (khóa luận tốt nghiệp)

VIETNAM NATIONAL UNIVERSITY OF AGRICULTURE FACULTY OF BIOTECHNOLOGY - - UNDERGRADUATED THESIS ISOLATION AND CHARACTERIZATION OF FUNGI ASSOCIATED WITH SPOILAGE OF POST-HARVEST MANGO FRUITS VENDED IN MARKETS OF GIA LAM DISTRICT Student’s name : Do Huyen Trang Student’s code : 610683 Major : Microbial biotechnology Supervisor : Nguyen Thanh Huyen, MSc HANOI, 2/2021 COMMITMENTS I hereby declare that all the data and results in this thesis are honest and have never been used in any report yet I also assure that the information cited in the thesis is indicated the origin and all the help is thankful Hanoi, 1st February, 2021 Student Do Huyen Trang i ACKNOWLEDGEMENTS First of all, I would like to express my appreciation to the directory of Vietnam National University of Agriculture, board of deans and lectures in the Faculty of Biotechnology for giving me a chance to study in a professional environment that provided me the sufficient knowledge throughout four and a half academic years In the process of doing my thesis, there are many people who help me bring this work to existence, but the most influential and inspiring person I would like to extend a special thanks is my supervisor, MSc Nguyen Thanh Huyen, who in the past months has helped me to accomplish more than I thought possible and inspired me to experience the research and patiently correct my writing I would like to express my deep gratitude to all teachers from the Department of Microbiology, Faculty of Biotechnology, who encouraged me to enhance knowledge and help me get orientation of my thesis I would like also thank all my friends, who were with me up until this point, simultaneously motivate me to accomplish more through their examples Last but not least, I’d like to thank my parents who encouraged me to try my best until the job is done, and who never ceased in providing me with the support I needed Hanoi, February 1st , 2021 Student Do Huyen Trang ii TABLE OF CONTENTS COMMITMENTS i ACKNOWLEDGEMENTS ii TABLE OF CONTENTS iii LIST OF ABBREVIATIONS vi LIST OF TABLES vii LIST OF FIGURES viii ABSTRACT x CHAPTER I: INTRODUCTION 1.1 Introduction 1.2 Objective 1.3 Requirement CHAPTER II: LITERATURE REVIEW 2.1 General introduction of mango 2.1.1 Origin and distribution 2.1.2 Description 2.1.3 Composition of mango cultivars 11 2.2 Common diseases of mango fruits in the world and in Vietnam 16 2.2.1 Anthracnose 16 2.2.2 Stem end rot 18 2.2.3 Transit rot 19 2.2.4 Aspergillus rot 20 2.3 Control of spoilage and ripening in mango fruits 22 2.3.1 Chemical control 22 2.3.2 Biological control 23 CHAPTER III: MATERIAL AND METHODS 27 3.1 Materials 27 3.1.1 Samples collection 27 3.1.2 Chemicals, instruments and equipment 27 3.1.3 Location and time studies 27 iii 3.1.4 Medium components 27 3.2 Research content 28 3.3 Methods 29 3.3.1 Method of isolation and purification of fungal pathogens from rotten mango fruit 29 3.3.2 Method of artificial infection 29 3.3.3 Method of studying biological characteristics 29 3.3.4 Optimal growth conditions of fungi 30 3.3.5 Method of testing enzymatic activity 30 3.3.6 Molecular identification of fungal species 31 CHAPTER IV: RESULTS AND DISCUSSION 33 4.1 Isolation of fungal pathogens causing spoil in post-harvest mango fruits 33 4.2 Artificial infection 34 4.3 Characterization of isolated fungal strains 37 4.3.1 M1 strain 37 4.3.2 M2 strain 38 4.3.3 M3 strain 40 4.4 Effect of different media on the growth of isolated fungal strains 41 4.5 Effect of different pH on the growth of isolated fungal strains 43 4.6 Effect of different temperatures on the growth of isolated fungal strains 45 4.7 Testing extracellular enzyme activity 47 4.7.1 Producing chitinase activity of isolated fungal strains 47 4.7.2 Producing cellulase activity of isolated fungal strains 48 4.7.3 Producing pectinase activity of isolated fungal strains 50 4.8 Phylogenetic analysis 51 4.8.1 DNA extraction of isolated fungal strains 51 4.8.2 PCR amplification of three isolated strains 51 4.8.3 Phylogenetic analysis of M1 strain 53 4.8.4 Phylogenetic analysis of M2 strain 54 4.8.5 Phylogenetic analysis of M3 strain 56 CHAPTER V: CONCLUSION AND SUGGESTION 58 iv 5.1 Conclusion 58 5.2 Suggestion 58 REFERENCE 59 v LIST OF ABBREVIATIONS Abbreviation Explanation PDA Potato Dextrose Agar SDA Sabouraud Dextrose Agar MEA Malt Extract Agar CDA Czapek Dox Agar ISP International Streptomyces Project et al et alia vi LIST OF TABLES Table 2.1: Acreage and yield of mango in different regions in Vietnam in 2017 Table 2.2: Nutritional value per 100g in Mango 12 Table 2.3: Nutritional value of seed kernel in Mango 15 Table 2.4: Nutritional value of leaves in Mango 16 Table 4.1: The presence of fungi strains in three chosen markets 33 Table 4.2: Morphological characterization of three isolated fungal strains 33 Table 4.3: Time to form hyphae, sclerotium, conidiophores, conidia and chlamydospore 40 vii LIST OF FIGURES Figure 2.1: Mango production worldwide from 2000 to 2018 (in million metric tons) Figure 2.2: World's top 25 largest mango producers in 2018 (tonnes) Figure 2.3: Map of mango in Vietnam Figure 2.4: Mango tree Figure 2.5: Mango fruits Figure 2.6: Mangoes with different colours 10 Figure 2.7: Unripe mango and ripe mango 11 Figure 2.8: Anthracnose on mango fruits 17 Figure 2.9: Colletotrichum gloeosporioides 17 Figure 2.10: Stem end rot of mango caused by Lasiodiplodia theobromae 18 Figure 2.11: Morphological characterization of Lasiodiplodia theobromae 18 Figure 2.12: Morphological characterization of Rhizopus stolonifer 19 Figure 2.13: Transit rot of mango caused by Rhizopus stolonifer 20 Figure 2.14: Spoilage mango caused by A.niger 21 Figure 2.15: Morphological characterization of Aspergillus niger 21 Figure 2.16: Products derived from prochloraz 23 Figure 2.17: Bio-polymer film for preserving fruits 26 Figure 4.1: Isolated fungal strain from the postharvest spoiled mangoes 33 Figure 4.2: Isolated samples of M1, M2 and M3 strain 36 Figure 4.3: Re-infection of isolated fungal strain (M1, M2, M3) in mangoes fruit and control sample on the 4th day 37 Figure 4.4: Microscopic observation of the isolated fungal strain-M1 37 Figure 4.5: Microscopic observation of the isolated fungal strain-M2 39 Figure 4.6: Microscopic observation of the isolated fungal strain-M3 40 Figure 4.7: Fungal strain-M1 in different media on the 5th day 41 Figure 4.8: Fungal strain-M2 in different media on the 5th day 42 viii Figure 4.9: Fungal strain-M3 in different media on the 2rd day 42 Figure 4.10: Fungal strain-M1 in different pH on the 5th day 43 Figure 4.11: Fungal strain-M2 in different pH on the 5th day 44 Figure 4.12: Fungal strain-M3 in different pH on the 2rd day 44 Figure 4.13: Fungal strain-M1 in different temperatures on the 5th day 45 Figure 4.14: Fungal strain-M2 in different temperatures on the 5th day 46 Figure 4.15: Fungal strain-M3 in different temperatures on the 2rd day 46 Figure 4.16: Chitinase activity of the isolated strains based on their clear zones around the wells after a day’s incubation 48 Figure 4.17: Cellulase activity of the isolated strains based on their clear zones around the wells after a day’s incubation 49 Figure 4.18: Pectinase activity of the isolated strains based on their clear zones around the wells after a day’s incubation 50 ix 4.8.3 Phylogenetic analysis of M1 strain Gene sequence of M1 strain ATTGTTCCTAACCTGATCCGAGGTCAACCTGGAAAAATGGTTGGAAAACGTCGGCAGGCGCCGGCCAATCCTACAGAGCATGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCCGGAGAGGGGGACGGCGACCCAACACACAAGCCGGGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCATTCAATCAACTCAGACTGCACGCTTTCAGACAGTGTTCGTGTTGGGGTCTCCGGCGGGCACGGGCCCGGGGGGCAAAGGCGCCCCCCCGGCGGCCGACAAGCGGCGGGCCCGCCGAAGCAACAGGGTATAATAGACACGGATGGGAGGTTGGGCCCAAAGGACCCGCACTCGGTAATGATCCTTCCGCAGGTTACCCTACGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTATACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTTTGCGCCCCGGGCCCGTGCCCGCCGGAGACCGCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGNNNATGANCGAGTCTGTGAACGCACATTGCGCCCCCTGGTATT 16s rRNA sequencing of M1 strain The 16s rRNA sequence of M1 strain was compared with nucleotide database of Genebank by using BLAST tool The tree generated MEGA-X software The result showed that M1 had the highest homology (98%) with Aspergillus niger and identified as Aspergillus niger Asp-7205 53 98 54 M1 Aspergillus niger isolate Asp-7205 69 Aspergillus sp isolate FPZSP374 Aspergillus tubingensis strain AM2 Aspergillus niger isolate RIZ9-2 Aspergillus niger isolate RIZ9-1 69 Aspergillus niger isolate RIZ5-1 73 75 Aspergillus niger isolate RIZ3-6 Aspergillus tubingensis strain USMI03 Figure 4.22: Phylogenetic tree of M1 strain 4.8.4 Phylogenetic analysis of M2 strain Gene sequence of M2 strain AAATTGTTTCTAACCTGATCCGAGGTCAATTTTCAGAAGTTGGGGGTTTAACGGCAGGGCACCGCCAGGGCCTTCCAGAGCGAGGGTTTAACTACTGCGCTCGGGGTCCTGGCGAGCTCGCCACTAGATTTCAGGGCCTGCTTCGTTAAAAAGCAGTGCCCCAACACCAAGCAATGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCTCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTGTTTTTTCTCAGAGTTTCAGTGTAAAAACAGAGTTGACTTGGCCGCCGGCGTGCCGTCTCTTTGCTGTGAAGCAAAGGGCCTACTAGAGACCAGCAAGCGCCGAGGCAACAAAAGGTATAAGT TCACAAAGGGTTTCTGGGTGCGCCTGGGGCGCGTTCCAGCAATGATCCCTCCGCAGGTTCACCCTACGGAAGGATCATTGCTGGAACGCGCCCCAGGCGCACCCAGAAACCCTTTGTGAACTTATACCTTTTGTTGCCTCGGCGCTTGCTGGTCTCTAGTAGGCCCTTTGCTTCACAGCAAAGAGACGGCACGCCGGCGGCCAAGTCAACTCTGTTTTTACACTGAAACTCTGAGAAAAAACACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGG- 54 CATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTGGGACGCACATTGCGCCCNCTGGTATTGCGGAGGGGCATGGCGGATGTGTCGTAATACCCCCCGCGATACTTTGCGGGGAGTGCGGGGGCCCCGAA 16s rRNA sequencing of M2 strain The 16s rRNA sequence of M2 strain was compared with nucleotide database of Genebank by using BLAST tool The tree generated by MEGA-X software The result showed that M2 had the highest homology (94%) with Phomopsis sp Figure 4.23: Phylogenetic tree of of M2 strain 55 4.8.5 Phylogenetic analysis of M3 strain Gene sequence of M3 strain AAATTGTTCCTAACCTGATCCGAGGTCAACCTTGAGAAAAGTTCAGAAGGTTCGTCCGGCGGGCGACGCCAACCGCTCCAAAGCGAGGTGTATTCTACTACGCTTGAGGGCTGAACAGCCACCGCCGAGGTCTTTGAGGCGCGTCCGCAGTGAGGACGGTGCCCAATTCCAAGCAGAGCTTGAGGGTTGTAATGACGCTCGAACAGGCATGCCCCCCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAGTTTATTAACTTGTTTATCAGACGTCTGCGTTTACTGACTGGAGTTTGAAGGTCCTTTGGCGGCCGGAGCCGCCAAAGCAACAGAGGTACGTTCACAAAGGGTGGGAGAGTCGAGCCGGAGCTCGAAAACTCGGTAATGATCCTTCCGCAGGTTCACCCTACGGAAGGATCATTACCGAGTTTTCGAGCTCCGGCTCGACTCTCCCACCCTTTGTGAACGTACCTCTGTTGCTTTGGCGGCTCCGGCCGCCAAAGGACCTTCAAACTCCAGTCAGTAAACGCAGACGTCTGATAAACAAGTTAATAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGTGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCTGCTTGGAATTTACCACGGTCCNNACTGCGCACGCGCATCAAAGACCTCGGCCNTGACCGCTTCAGAACTTTTNCGTGGTACACTCCAAAAGGCTTGGGAGCNCCCTA 16s rRNA sequencing of M3 strain The 16s rRNA sequence of M3 strain was compared with nucleotide database of Genebank by using BLAST tool The tree generated by MEGA-X software The result showed that M3 had the highest homology (100%) with Lasiodiplodia theobromae and identified as Lasiodiplodia theobromae PaP-2 56 100 100 Lasiodiplodia hormozganensis strain CMM39 Lasiodiplodia brasiliensis CMM 4015 100 Lasiodiplodia sp CMM4011 100 Lasiodiplodia brasiliense strain CMM 0354 18 Lasiodiplodia theobromae isolate 18-00584 Lasiodiplodia theobromae isolate PBBG186 M3 100 100 Lasiodiplodia theobromae strain PaP-2 Lasiodiplodia theobromae isolate PBBG179 Figure 4.24: Phylogenetic tree of M3 strain 57 CHAPTER V: CONCLUSION AND SUGGESTION 5.1 Conclusion ­ Three fungal strains were isolated from spoiled mango fruits ­ The mycelium of M1 is initially white but this strain change to black after a few days producing conidial spore M1 has smooth colored conidiophores and conidia Conidial heads are large, globose, dark brown, becoming radiate and tending to split into several loose columns with age Conidiophore stipes are smooth-walled, hyaline or turning dark towards the vesicle Conidia are globose to subglobose, dark brown to black and rough-walled ­ The mycelium of M2 is initially white and gradually turns to a pale yellow color on potato-dextrose agar (PDA) with circular wavy growth M2 showed a branchedseptate hyphae with colorless Sclerotia are sub-ovoid, light-yellow, becoming pale brown as they mature Conidiophores produce both alpha-conidia and beta-conidia ­ The mycelium of M3 is initially white and turns to a brown color after a few days M3 isolated showed septate, branched hyphae Not produce spores ­ Experiment on the effect of culture medium, temperature and pH on growth and development of fungal strains showed that M1 grows well on SDA and PDA, at pH 5.0 with temperature around 30-37°C M2 has good growth of mycelium on PDA and MEA at pH 7.0, 8.0 and 10.0 with temperature of 30°C M3 grows well on PDA and MEA at pH 4.0, 6.0 and 10.0 with temperature around 30-37°C ­ In terms of extracellular enzyme activity, M1, M2 and M3 can produce pectinase; M1 and M2 have the ability to produce chitinase whereas only M1 can produce cellulase among three isolated strains ­ Through molecular identification, the isolated fungal strains were identified as A Niger (M1), Phomopsis sp (M2) and L Theobromae (M3) with approximately 98%, 94% and 100% identity, respectively 5.2 Suggestion ­ Find the biological measures to prevent, control and eradicate disease caused by fungi in mango fruits 58 REFERENCE Bandyopadhyaya, C and Gholap, A.S (1973) Changes in fatty-acids in ripening mango pulp (variety Alphonso) Journal of Agricultural and Food Chemistry 21, 496-497 Berardini, N., Fezer, R., Conrad, J., Beifuss, U., Carle, R and Schieber, A (2005) Screening of mango (Mangifera indica L.) cultivars for their contents of flavonol o- and xanthone c-glycosides, anthocyanins, and pectin Journal of Agricultural and Food Chemistry 53, 1563–1570 Bernardes-Silva, A.P.F., Nascimento, J.R.O., Lajolo, F.M and Cordenunsi, B.R (2008) Starch mobilization and sucrose accumulation in the pulp of Keitt mangoes during postharvest ripening Journal of Food Biochemistry 32, 384–395 D.H Larone (1995) Medically Important Fungi: A Guide to Identification, ASM Press D.Liu (2011) Molecular Detection of Human Fungal Pathogens, CRC Press Dasgupta, S.N and R.S Bhat (1946) Studies in diseases of mangifera indica Linn Latent infection in the mango fruit J Ind Bot Soc 25: 187-203 Department of Horticulture, Ministry of Agriculture and Rural Development Accessed 2018 Acreage and yield of mango in different regions in Vietnam in 2017 Diedhiou P, Mbaye N, Drame A and Samb P (2007) Alteration of post harvest diseases of mango Mangifera indica through production practices and climatic factors African Journal of Biotechnology; 6(9) Ediriweera MK, Tennekoon KH and Samarakoon SR (2017) A review on ethnopharmacological applications, pharmacological activities and bioactive compounds of Mangifera indica (Mango) Evidence-Based Complementary and Alternative Medicine 10 Gholap, A.S and Bandyopadhyay, C (1975) Contribution of lipid to aroma of ripening mango (Mangifera indica L.) Journal of the American Oil Chemists Society 52, 514–516 11 Gomez-Lim, M.A (1997) Postharvest physiology In: Litz, R.E (Ed.), The Mango: Botany, Production and Uses CAB International, Wallingford, UK and New York, USA, pp 425–445 59 12 H Siamak, R A Khosravi, M Rostamibashman, N Ali Masoudi, S Soltani and M Soltani (2008) Molecular Typing of Iranian Cladosporium Isolates Using RAPD-PCR, Biotech., 7,7 13 J.I Pitt and A.D Hocking (2009) Fungi and Food Spoilage, SpringerLink 14 K S Chukwuka, I O Okonko, and A A Adekunle (2010) Microbial Ecology of Organisms Causing Pawpaw (Carica papaya L.) Fruit Decay In Oyo State, Nigeria Am Eur J Toxic Sci 2,1 15 Kalra, S.K and Tandon, D.K (1983) Ripening-behaviour of Dashehari mango in relation to harvest period Scientia Horticulturae 19, 263–269 16 Kantikar, U.K and Uppal, B.N (1939) Twig blight and fruit rot of mango Curr Sci; 8: 470 17 Laxminarayan, P and S.M Reddy (1975) A new post- harvest disease of mango Indian phytopath 28: 529-530 18 Litz, R (Ed.) (2009) The Mango: Botany, Production and Uses, second ed CABI, Wallingford UK and Cambridge, Mass USA 19 Lizada, M.C (1991) Postharvest physiology of the mango a review Acta Horticulturae 291, 437–453 20 M Barth, T R Hankinson, H Zhuang, and F Breidt (2013) Isolation and identification of fungi associated with the spoilage of sweet orange (Citrus sinensis) Fruits In Sokoto State Nigerian J Basic App Sci 21,3 21 Masibo, M and Qian, H (2008) Major mango polyphenols and their potential significance to human health 22 Comprehensive Reviews in Food Science and Food Safety 7, 309–319 23 Medlicott, A.P., Bhogal, M and Reynolds, S.B (1986) Changes in peel pigmentation during ripening of mango fruit (Mangifera indica var tommy atkins) Annals of Applied Biology 109, 651–656 24 Morton, Julia Frances (1987) Mango In: Fruits of Warm Climates NewCROP, New Crop Resource Online Program, Center for New Crops & Plant Products, Purdue University pp 221–239 25 National Mango Board NMB Crop Reports Accessed 2019-11-24 Average per year of combined values 60 26 Nour, A.A.M., Khalid, K.S.M and Osman, G.A.M (2011) Suitability of some Sudanese mango varieties for jam making American Journal of Scientific and Industrial Research 2, 17–23 27 Othman, O.C and Mbogo, G.P (2009) Physico-chemical characteristics of storage-ripened mango (Mangifera indica L.) fruits varieties of eastern Tanzania Tanzania Journal of Science 35, 57–66 28 Pathak, S.R and Sarada, R (1974) Lipids of mango (Mangifera indica) Current Science 43, 716–717 29 Perry, E.O.V and Zilva, S.S (1932) Preliminary Report on Vitamin Content of the Mango H.M Stationery Office, London 30 Prasanna, V., Prabha, T.N and Tharanathan, R.N (2004) Pectic polysaccharides of mango (Mangifera indica L.): structural studies Journal of the Science of Food and Agriculture 84, 1731–1735 31 R R Al-Hindi, A R Al-Najada, and S A Mohamed (2011) Isolation and identification of some fruit spoilage fungi: Screening of plant cell wall degrading enzymes Afr J Microbiol Res 5,4 32 S Rawat (2015) Food spoilage : Microorganisms and their prevention Asian J Plant Sci Res., 5,4 33 Sangchote,S ( 1987 ) Post – harvest disease of mango and their losses Kasetsart J 21: 81-85 34 Thakur, D.P (1972) Factors influencing storage rot of certain fruit and vegetables caused by three species of Rhizopus Indian Phytopath, 25: 354-358 35 Tharanathan, R., Yashoda, H.M and Prabha, T.N (2006) Mango (Mangifera indica L.), “The King of Fruits”—an overview Food Reviews International 22, 95– 123 36 U N Bhale (2011) Survey of market storage diseases of some important fruits of Osmanabad District (M.S.) India Sci Res Report 1,2 37 Vietmeyer ND (1986) Lesser-known plants of potential use in agriculture and forestry Science;232:1379-85 61 38 A.F Nogueira Júnior, R.F Santos, A.C.V Pagenotto and M.B Spósito (2017) First report of Lasiodiplodia pseudotheobromae causing fruit rot of persimmon in Brazil, New Disease Reports 36,1 39 Milind S Ladaniya (2008) Preharvest factors affecting fruit quality and postharvest life, sciencedirect, Pages 79-101, VI-VII 40 N Krishnapillai and R.S Wilson Wijeratnam (2013): Aspergillus rot of ripe mangoes ( Mangifera indica L.) var Ambalavi, Willard and Karuthakolumban J.Natn.Sci.Foundation Sri Lanka 41 (1): 69-70 41 Xu SO, Yuan SZ, Chen XC (1984) Studies on pathogenic fungus (Alternaria tennuis Nees) of poplar leaf blight J North East For Inst., 12: 56-64 42 Maheshwari SK, Singh DV, Sahu AK (1999) Effect of several nutrient media, pH and carbon sources on growth and sporulation of Alternaria alternata J Mycopathol Res 37: 21-23 43 Saha A, Mandal P, Dasgupta S, Saha D (2008) Influence of culture media and environmental factors on mycelial growth and sporulation of Lasiodiplodia theobromae (Pat.) Griffon and Maubl J Environ Biol., 29(3): 407-410 44 Feofilova, E.P., Tereshina, V.M., and Memorskaya, A.S., Mikrobiologiya (1995), vol 64, no 1, pp 27–31 45 El Ghaouth, A., Arul, J., Asselin, A., Benhamou, N., (1992c).Antifungal activity of chitosan on post-harvest pathogens: induction of morphological and cytological alterations in Rhizopus stolonifer Mycol Res 96, 769–779 46 Mukherjee, S.K., & Litz, R.E (1997) The mango: Botany, production and uses CABI International 47 Immanual, G.; Dhanusha, R.; Prema, P.; Palavesan (2006) Effect of different growth parameters on endoglucanase enzyme activity by bacteria isolated from coir retting effluents of estuarine environment Int J Environ Sci.Tech., 3(1), 2534 48 Peij, N.; Gielkens, M.M.C.; Verles, R.P.; Visser, K.; Graff, L.H (1998) The transcriptional activator X in R regulates bothxylanolytic endoglucanase gene expression in Aspergillus niger Appl Environ Microbial, 64, 3615-3617 62 49 Sarao, L.K.; Arora, M.; Sehgal, V.K (2010) Use of scopulariopsisacremonium for the production of cellulose andxylanase through submerged fermentation Afr J Microbiol Res., 4(14), 1506-1510 50 Anita, S.; Namita, S.; Narsi, R.; Bishnoi (2009) Production of cellulases by Aspergillus heteromorphus from wheat strawunder submerged fermentation Int J Environ Sci Eng.,23-26 51 Feofilova, E.P., Nemtsev, D.V., Tereshina, V.M., and Kozlov, V.P., Prikl Biokhim Mikrobiol., (1996), vol 32, no 5, pp 483–492 52 Chigaleichik, A.G., Pirieva, D.A., and Rylkin, S.S., Prikl Biokhim Mikrobiol., (1976), vol 12, no 4, pp 581–586 53 Lonsdale, J.H (1992) In search of an effective postharvest treatment for the control of post-harvest diseases of mangoes S Afr Mango Grower’s Assoc Yearb 12:32-36 54 Lonsdale, J.H (1993) Strategies for the control of postharvest diseases of mango S Afr Mango Grws Assoc Yearb 13:109-116 55 Lonsdale, J.H., Lonsdale, J.M., Greef, H and Brooks, W (1991) The efficacy of prochloraz, chloramizol-sulphate and quazatine on post-harvest diseases of mango S Afr Mango Grws Assoc Yearb 11:35-38 56 Pelser, P.du T (1985) Control of post-harvest decay in mangoes S Afr Mango Grws Assoc Yearb 5:47-54 57 Pelser, P.du T and Lesar, K.H (1990) Post-harvest decay control in mangoes under South African conditions S Afr Mango Grws Assoc Yearb 10:11-17 58 Pelser, P.du T (1985) Control of post-harvest decay in mangoes S Afr Mango Grws Assoc Yearb 5:47-54 Pelser, P.du T and Lesar, K.H 1990 Post-harvest decay control in mangoes under South African conditions S Afr Mango Grws Assoc Yearb 10:11-17 59 Nel, A., Krause, M and Khelawanlall, N (2003) A guide for control of plant diseases Directorate Agricultural Production Inputs, National Department of Agriculture, RSA 60 Johnson, G.I., Muirhead, I., Mayers, P and Cook, T (1989) Diseases p.1-9 In: Mango pests and disorders Dept Primary Industries, Queensland 44 p 63 61 Johnson, G.I (1994) Stem-end rot Pages 39-41 In: Compendium of tropical fruit diseases American Phytopathological Society, St Paul, Minnesota 62 Ingham SC, Schoeller EL, Engel RA (2006) Pathogen reduction in unpasteurized apple cider: adding cranberry juice to enhance the lethality of warm hold and freeze-thaw steps J Food Prot 69:293–8 63 Mosqueda-Melgar J, Raybaudi-Massilia RM, Martin-Belloso O (2008a) Nonthermal pasteurization of fruit juices by combining high-intensity pulsed electric fields with natural antimicrobials Innovat Food Sci Emerg Technol 9:328–40 64 Mosqueda-Melgar J, Raybaudi-Massilia RM, Martin-Belloso O (2008b) Inactivation of Salmonella enterica ser Enteritidis in tomato juice by combining of highintensity pulsed electric fields with natural antimicrobials J Food Sci 73:M47-53 65 Mosqueda-Melgar J, Raybaudi-Massilia RM, Martin-Belloso O (2008c) Combination of high-intensity pulsed electric fields with natural antimicrobials to inactivate pathogenic microorganisms and extend the shelf life of melon and watermelon juices Food Microbiol 25:479–91 66 Hosseinnejad M, Jafari S M, (2016) Evaluation of different factors affecting antimicrobial properties of chitosan International Journal of Biological Macromolecules, 85: 467–475 DOI: 10.1016/j.ijbiomac.2016.01.022 67 Khan A, Salmieri S, Fraschini C, et al., (2014) Genipin cross-linked nanocomposite films for the immobilization of antimicrobial agent ACS Applied Materials & In 68 Arbia W, Arbia L, Adour L, et al., (2013) Chitin extraction from crustacean shells using biological methods: a review Food Technology & Biotechnology, 51(1): 12–25 69 Mosqueda-Melgar J, Raybaudi-Massilia RM, Martin-Belloso O (2008c) Combination of high-intensity pulsed electric fields with natural antimicrobials to inactivate pathogenic microorganisms and extend the shelf life of melon and watermelon juices Food Microbiol 25:479–91 70 Chien PJ, Sheu F, Yang FH (2007) Effects of edible chitosan coating on quality and shelf life of sliced mango fruit J Food Eng 78:225–9 64 Website Dhaka (2010) Mango tree, national tree, bdnews24.com, retrieved January 2021 from http://bdnews24.com/bangladesh/2010/11/15/mango-tree-national-tree Amber Pariona (2018) The Top Mango Producing Countries In The World, Economics, retrieved January 2021 from https://www.worldatlas.com/articles/thetop-mango-producing-countries-in-the-world.html M Shahbandeh (2020) Mango production worldwide from 2000 to 2018, Statista.com, retrieved January 2021 from https://www.statista.com/statistics/577951/world-mango-production/ Anonymous (2016) Tổng quan tình hình xuất nhập xồi Việt Nam, vntrade, retrieved January 2021 from http://vietnamtradeoffice.net/tong-quan-va-tinhhinh-xuat-khau-xoai-viet-nam/ Jasmine Le (2020) Vietnam’s mangoes export volumnes to US doubles, Vietnamtimes, retrieved January 2021 from https://vietnamtimes.org.vn/vietnamsmangoes-export-volumnes-to-us-doubles-25849.html IEG Vu (2020) Special Report: The world is looking beyond India for supplies of mango purée, IHS Markit, retrieved January 2021 from https://ihsmarkit.com/research-analysis/special-report-the-world-is-lookingbeyond-india.html Dinh Van Chung (2018) Chế tạo màng Polymer sinh học Chitosan để bảo quản hoa quả, Liên hiệp hội khoa học kỹ thuật thừa thiên huế, retrieved from 20th January 2021 from https://husta.org/tin-tuc/cuoc-thi-sang-tao-thanh-thieu-nien-nhidong/che-tao-mang-polymer-sinh-hoc-chitosan-de-bao-quan-hoa-qua-2264 Khuyết danh (2016) Bảo quản nông sản màng sinh học chitin/chitosan sau thu hoạch giải pháp an toàn, Foodsafety, retrieved from 20th January from http://www.foodsafety.gov.vn/vn/nghien-cuu-khoa-hoc/bao-cao-khoa-hoc-trongnuoc/bao-quan-nong-san-bang-mang-sinh-ho%CC%A3c-chitin-chitosan-sau-thuhoa%CC%A3ch-giai-phap-an-toan 65 HỌC VIỆN NƠNG NGHIỆP VIỆT NAM CỘNG HỊA XÃ HỘI CHỦ NGHĨA VIỆT NAM Độc lập – Tự – Hạnh phúc KHOA CÔNG NGHỆ SINH HỌC BẢN NHẬN XÉT SINH VIÊN LÀM KHÓA LUẬN TỐT NGHIỆP Họ tên sinh viên: …………………………………………… Lớp: ……………………… Chuyên ngành: ………………………………………………………………………………… Tên đề tài Khóa luận tốt nghiệp: ………………………………………………… …………………………………………………………………………………………… …… ……………………………………………………………………………………… ………… ………………………………………………………………………………… Thời gian địa điểm thực tập: Thời gian thực tập: ………………………………………………………………………… Địa điểm thực tập: ………………………………………………………………………… Ý KIẾN NHẬN XÉT CỦA GIÁO VIÊN HƯỚNG DẪN Tinh thần, thái độ học tập thực Khóa luận tốt nghiệp: ………………………………………………………………………………………… ……… … ………………………………………………………………………………………… … ……….………………………………………………………………………………… …… Mức độ hoàn thành Khóa luận tốt nghiệp giao:  Hồn thành tốt:   Hoàn thành:   Chưa hoàn thành:  Năng lực sáng tạo nghiên cứu viết Khóa luận tốt nghiệp: ………………………………………………………………………………………… ……… …………………………………………………………………………………… …………… ……………………………………………………………………………… ………………… Kết luận:   Sinh viên đủ điều kiện nộp Khóa luận tốt nghiệp: Sinh viên khơng đủ điều kiện nộp Khóa luận tốt nghiệp: Hà Nội, ngày   tháng Giáo viên hướng dẫn 66 năm 20 67