Study on psba trnh dna barcoding characteristics in some species of polyscias genus (khóa luận tốt nghiệp)

VIETNAM NATIONAL UNIVERSITY OF AGRICULTURE FACULTY OF BIOTECHNOLOGY -oOo - GRADUATION THESIS “STUDY ON psbA-trnH DNA BARCODING CHARACTERISTICS IN SOME SPECIES OF POLYSCIAS GENUS” Student Nguyen Le Tra My Department Biotechnology Supervisor Huynh Thi Thu Hue, PhD Institue of Genome Research, VAST Tran Thi Hong Hanh, MSc Vietnam National University of Agriculture HANOI, 2021 COMMITMENT I hereby declare that the work contained in this thesis has not been previously submitted to meet requirements for an award at this or any other education institution To the best of my knowledge and belief, the thesis contains no material previously published or written by another person except where due reference is made Signature: Date: i ACKNOWLEDGEMENTS This thesis, as any other, would be impossible to complete without kind support from various people First and foremost, I wish to express my greatest thanks to my university, Vietnam National University of Agriculture (VNUA), and particularly Biotechnology department To overcome the those challenging years, I cannot forget the advice and encouragements from all teachers in Microbiology department, especially Ms Tran Thi Hong Hanh Without them, I wouldn't be able to get the opportunity to begin my thesis Besides, I cannot help but mention the Institute of Genome Research (IGR), Vietnam Academy of Science and Technology, where I carry out this research The sincerely thanks and regards goes to my principal supervisor, Ms Huynh Thi Thu Hue, for her relentless mentoring and encouragement Her knowledge, as well as hugely passion in science have enlighted me into the world of science, bring me valuable guidances which enabled me to be the best version of myself It is really my pleasure to finish my work under her supervision Moreover, I would humbly extend my thanks to my friends and colleagues in VNUA, as well as others in IGR laboratory which I cannot mention all of you All the never-ending arguments, enthusiasm cooperation, interesting questions and advice taught me new lessons Last but not the least, I also acknowledge with a deep sense of gratitude for my beloved family, for doubtless assistance both physically and mentally, so that I have remained unwavering in my own path throughout the years Any omission in this brief acknowledgement does not mean lack of gratitude Once again, it is impossible to finish the work without your support, directly or indirectly Hanoi, March 31, 2021 Student Nguyen Le Tra My ii TABLE OF CONTENTS COMMITMENT i ACKNOWLEDGEMENTS ii LIST OF TABLES v LIST OF FIGURES vi LIST OF ABBREVIATIONS vii ABSTRACT ix CHAPTER 1: INTRODUCTION 1.1 DNA barcoding 1.2 Polyscias genus 1.3 Objectives 1.4 Requirements CHAPTER 2: LITERATURE REVIEW 2.1 DNA barcode 2.1.1 Basic features 2.1.2 Nuclear genome sequences 2.1.3 Mitochondrial genome sequences 2.1.4 Chloroplast genome sequences 2.2 Related studies to DNA barcode 2.2.1 Application DNA barcoding in plant 2.2.2 psbA-trnH region – Chloroplast DNA barcode 2.2 Related studies to Polyscias genus 2.3.1 Phytochemical 2.3.2 Biological activity 10 2.3.3 DNA barcode in Polyscias genus 14 CHAPTER 3: MATERIALS AND METHODS 14 3.1 Time and location 15 3.1.1 Time 15 3.1.2 Location 15 iii 3.2 Materials 15 3.3 Methods 15 3.3.1 DNA extraction 15 3.3.2 PCR amplification 16 3.3.3 Purification 18 3.3.4 DNA sequencing 19 CHAPTER 4: RESULTS AND DISCUSSION 19 4.1 DNA extraction 20 4.2 PCR amplification of psbA-trnH fragment 21 4.3 DNA sequencing 23 4.4 Genetic distance and phylogenetic tree 30 4.1.1 Genetic distance 30 4.1.2 Phylogenetic tree 31 CHAPTER 5: CONCLUSION AND SUGGESTION 32 5.1 Conclusion 33 5.2 Suggestion 33 REFERENCES 34 Vietnamese references 34 English references 35 iv LIST OF TABLES Table 2.1: Most relevant reports in pharmacological activities of Polyscias species 13 Table 3.1: Information about studied samples 17 Table 3.2: The psbA-trnH primer 18 Table 3.3: Components of PCR reaction 19 Table 4.1: OD values of five Polyscias samples 23 Table 4.2: Reference sequences list 26 Table 4.3: The polymorphism sites of gene psbA-trnH of 11 Polyscias species 30 Table 4.4: Percentage identities among species 32 Table 4.5: Genetic distances (Pairwise method) 33 v LIST OF FIGURES Figure 2.1: The matrix of genetic information and taxonomic diversity, with DNA barcoding and genomics Figure 2.2: Procedure of DNA barcoding Figure 2.3: General structure organization of the chloroplast psbA-trnH intergenic spacer Figure 2.4: Polyscias balfouriana 12 Figure 2.5 a: Dinh lang la tron: P balfouriana (LT) 15 Figure 2.5 b: Dinh lang la to: P filicifolia (LTO) 15 Figure 2.5 c: Dinh lang la nho: P fruticosa (LN) 15 Figure 2.5 d: Dinh lang la dia: P scutellaria (LD) 15 Figure 2.5 e: Dinh lang la rang: P serrate Balf (LR) 15 Figure 4.1: Total DNA of five leaf samples of Polyscias genus 23 Figure 4.2: Results of purification of five leaf samples of Polyscias genus 25 Figure 4.3: Graphic view alignment of psbA-trnH from Polyscias 26 Figure 4.4: Maximum Likelihood tree of Polyscias based on psbA-trnH sequences 34 vi LIST OF ABBREVIATIONS Abbreviation Meaning BS Bootstrap value BLAST Basic Local Alignment Search Tool Bp Base pair COI Cytochrome C oxidase CpDNA Chloroplast DNA CTAB Cetyl trimethyl ammonium bromide DNA Deoxyribonucleic acid EDTA Ethylenediamine tetracetic acid IC50 The concentration that reduces growth by 50% ITS Internal transcribed spacer ITS1 Internal transcribed spacer ITS2 Internal transcribed spacer Kb Kilo base M Mol concentration MCL Maximum Composite Likelihood matK maturase K minute ml milliliter mtDNA Mitochondrial DNA NCBI National Center for Biotechnology Information nuDNA Nuclear DNA OD Optical Density PCR Polymerase Chain Reaction pH Power of hydrogen/potential of hydrogen psbA-trnH tRNA Phenylanalinephotosystem II protein D1-tRNA Leucine PVP Polyvinylpyrrolidone rbcL ribulose 1,5-bisphosphate carboxylase large subunit rDNA Ribosomal DNA vii RNA Ribonucleic acid rpoB beta subunit of RNA polymerase rpoC1 RNA polymerase subunit C1 rpm Round per minute TAE Tris – Acetate – EDTA Tm Melting temperature of an oligonucleotide trnL-trnF tRNA Leucine - tRNA Phenylanaline µg/ml Microgram/milliliter µl microlitre viii ABSTRACT Polyscias is a flowering genus that belongs to the Araliaceae family, which is commonly used for medical purposes and widely distributed over the world for its economic value due to rich contents of phytochemical DNA barcode is a robust method to identify species and evaluate phylogenetic relationships In this study, the psbA-trnH region was used to investigate the relationship of five species of Polyscias genus The sequencing results showed that the psbA-trnH sequence has about 500 nucleotides as expected length Raw data has been analyzed and these sequences were compared to six reference sequences from NCBI The phylogenetic tree of Polyscias genus based psbA-trnH sequences with Tetraplasandra hawaiensis as out-group species was conducted by bioinformatic tools The combination between the genetic distance method and Maximum-likelihood proposed high confidence results All five studied samples: P balfouriana (LT), P serrata Balf (LR), P fruticosa (LN), P scutellaria (LD), P filicifolia (LTO) were grouped into same clade, which had close relationship with P sp Wen 10765 and P austranliana with reliable bootstrap supported (BS: 72) The psbA-trnH region has been proposed as suitable for DNA barcoding studies Thus, it would be considered widely used in further classification studies ix 250 260 270 280 290 300 | | | | | | | | | | | | Polyscias balfouriana (LT) AATTTAGCTATTTCTTCCCAATCTTTTGGGAAGTTTTTTTTTT-AAAAAAAAGATGAAAA Polyscias filicifolia (LTO) .- Polyscias fruticosa (LN) .- G Polyscias scutellaria (LD) .- G Polyscias serrata Balf (LR) G Polyscias australiana .- G Polyscias sp Wen 10765 G Polyscias macrocarpa - .C . G A.GA Polyscias nodosa - T G TGA Polyscias schultzei C - .C . T A.GA Polyscias spectabilis .AAGA G - G .A 310 320 330 340 350 360 | | | | | | | | | | | | Polyscias balfouriana (LT) TGTTGGACTTTTTACTTAGTTAAGTTAATACTTAATATTTTTATCTCGAAAAAAAAA - Polyscias filicifolia (LTO) G - Polyscias fruticosa (LN) - Polyscias scutellaria (LD) - Polyscias serrata Balf (LR) - Polyscias australiana G - Polyscias sp Wen 10765 G Polyscias macrocarpa . - .G. - Polyscias nodosa . - .AAA Polyscias schultzei . - G G. - Polyscias spectabilis . - .G. - 370 380 390 400 410 420 | | | | | | | | | | | | Polyscias balfouriana (LT) -AAAGATAAGAAAGAAATAATGATGATATGGTAAAAATTTAATCTTTTGAAACGTAAGGA Polyscias filicifolia (LTO) - A Polyscias fruticosa (LN) - Polyscias scutellaria (LD) - Polyscias serrata Balf (LR) - A Polyscias australiana - A Polyscias sp Wen 10765 - Polyscias macrocarpa - . - Polyscias nodosa G .- C T - Polyscias schultzei - . - Polyscias spectabilis - GG 26 430 440 450 460 | | | | | | | | Polyscias balfouriana (LT) AAAAAATAATAAGGGGGCGGATGTAGCCAAGGGGATCAGGGCAG Polyscias filicifolia (LTO) .G .T A Polyscias fruticosa (LN) .G A Polyscias scutellaria (LD) .G T T A Polyscias serrata Balf (LR) C A Polyscias australiana T A Polyscias sp Wen 10765 .G T A Polyscias macrocarpa .G .G T A Polyscias nodosa GAA .T A Polyscias schultzei .G .G T A Polyscias spectabilis .G .G T A Figure 4.3: Graphic view alignment of psbA-trnH from Polyscias The short intergenic region which are non-coding found within genes In Polyscias genus, non-coding psbA-trnH intergenic spacer is located from nucleotides 19 to 429 This spacer is located between the psbA gene and the gene of histidine transfer RNA (trnH), which plays an important role in the regulation of the expression of these genes Degtjareva et al (2012) has been proposed psbA-trnH region as suitable for DNA barcoding studies The polymorphism sites of 11 sequences were observed in figure 4.5 in table 4.3, the results showed that psbA-trnH regions of five studied sequences from our samples were the most similar to P australiana, followed by P sp Wen 10765 Studied sequences had the greatest difference with P nodosa 27 Table 4.3: The polymorphism sites of gene psbA-trnH of 11 Polyscias species Species Polymorphism sites 52 53 54 55 56 136 138 139 140 141 143 144 147 148 T C T T - - A G T T C T A A P filicifolia (LTO) T - T T G - A G T T C T A A P fruticosa (LN) T T T G - - A G T T C T A A P scutellaria (LD) - - T T G - A G T T C T A A P serrata Balf T T T T G - A G T T C T A A P australiana T - T - G - A G T T C T A A P sp Wen 10765 T - T T G - A G T T C T A A P macrocarpa T - - - G C T A C C A G T C P nodosa G - - - A C T A C C A G T C P schultzei T - - - G C T A C C A G T C P spectabilis G - - A A C T A C C A G T C P balfouriana (LT) (LR) 28 Table 4.3: The polymorphism sites of gene psbA-trnH of 11 Polyscias species (continued) Species Polymorphism sites 149 150 156 157 158 169 287 295 296 356 424 432 452 459 P balfouriana (LT) A C T T A G A T G A A A G G P filicifolia (LTO) A C T T A G A T G A A A T A P fruticosa (LN) A C T T A G G T G A G A G A P scutellaria (LD) A C T T A G G T G A G A T A P serrata Balf (LR) A C T T A G G T G A A A T A P australiana A C T T A G G T G A A A T A P sp Wen 10765 A C T T A G G T G A G A T A P macrocarpa T T A A G C G G A G G G T A P nodosa T T A A G C G G A A - G T A P schultzei T T A A G C T G A G G G T A P spectabilis T T A A G C G T A G G G T T We used BLAST tool to calculate percentage identity among species Particularly, one studied sequence was respectively aligned with one reference sequence and then percentage identity was calculated The results indicated that the five studied sequences were the most similar to P australiana and difference with P nodosa The highest similarity was 99.12% between P filicifolia (LTO) and P australiana Pecentage identity was 98.90% found in P cutellaria (LD) and P australiana The lowest similarity was 81.00% between P serrata Balf (LR) and P nodosa Examined samples also had relatively high similarity to P sp Wen 10765 (Table 4.4) 29 Table 4.4: Percentage identity among species Reference species Studied species P balfouriana (LT) P filicifolia (LTO) P fruticosa (LN) P scutellaria (LD) P P sp P P nodosa P schultzei P Australiana Wen 10765 macrocarpa 98.25% 97.82% 88.15% 85.89% 87.50% 88.12% 99.12% 98.04% 88.36% 85.89% 87.72% 88.39% 98.69% 98.69% 88.77% 86.31% 87.90% 88.82% 98.90% 98.47% 88.96% 86.67% 88.10% 89.22% 98.69% 98.25% 88.12% 81.00% 87.26% 87.98% spectabilis P serrata Balf (LR) 4.4 Genetic distance and phylogenetic tree 4.1.1 Genetic distance Genetic distance is a measure of genetic difference between interspecies or intraspecies Genetic distances were calculated automatically by the pairwise distance method in MEGAX software The pairwise distance method is an evaluation of the differences between pairs of sequences and then these differences transform into a distance These distances were used to estimate a tree The results compared the differences between the pairs of sequences according to Kimura model Parameter (Kimura, 1980) indicated that the ranges of genetic difference were from 0.00661 to 0.08506 in which the lowest genetic difference was 0.00661 of P filicifolia (LTO) and P australiana Therefore, two species could have a close relationship 0.00663 was the difference between P australiana and P sp Wen 10765 The genetic difference was 0.00883 found in P fruticosa (LN) and P scutellaria (LD); P fruticosa (LN) and P serrate Balf (LR); P fruticosa (LN) and P sp Wen 10765 (Table 4.5) Thus, P fruticosa (LN) could be grouped into a group with P scutellaria (LD), P serrate Balf (LR) and P sp Wen 10765 The difference between P nodosa and P balfouriana (LT) was 0.08506 showed the highest 30 difference Table 4.5: Genetic distances (pairwise method) 1 Polyscias balfouriana (LT) Polyscias filicifolia (LTO) Polyscias fruticosa (LN) Polyscias scutellaria (LD) Polyscias serrata Balf (LR) Polyscias australiana Polyscias sp Wen 10765 Polyscias macrocarpa Polyscias nodosa 10 Polyscias schultzei 11 Polyscias spectabilis 12 Tetraplasandra hawaiensis 10 11 0.01997 0.01553 0.01773 0.02004 0.01777 0.00883 0.01552 0.01775 0.00883 0.01330 0.01779 0.00661 0.01107 0.01107 0.01107 0.02004 0.01328 0.00883 0.00884 0.01325 0.00663 0.05147 0.04382 0.03631 0.03882 0.04378 0.03635 0.03382 0.08506 0.07656 0.07101 0.07106 0.07672 0.06827 0.06823 0.06306 0.05656 0.04885 0.04382 0.04636 0.05136 0.04387 0.04129 0.01647 0.06300 0.05793 0.05040 0.04544 0.04544 0.05050 0.04299 0.04062 0.03183 0.05243 0.03939 0.05049 0.04301 0.03810 0.03810 0.04309 0.03568 0.03329 0.03465 0.05563 0.04232 0.00692 4.1.2 Phylogenetic tree A phylogenetic tree of 12 sequences was constructed using the MaximumLikelihood (ML) methods based on the Hasegawa-Kishiho-Yano model in MEGAX ML method is one of the most widely used for phylogenetic tree reconstruction Bootstrap Support (BS) values for individual clades were computed by running 1000 bootstrap replicates of the data These values indicate how many times out of 100 the same branch was observed when repeating the phylogenetic reconstruction on a resampled set of data In our study, the tree diagram constructed with psbA-trnH data using the Maximum-Likelihood method indicated that there were two classifications All five examined species: P balfouriana (LT), P serrata Balf (LR), P fruticosa (LN), P scutellaria (LD), P filicifolia (LTO) were grouped in Clade I, which had close relationship with P sp Wen 10765 and P australiana with well supported (BS:76) Clade II included two reference species (P macrocarpa and P schultzei) with strongly supported (BS:96) P nodasa and P spectabilis had a quite distant relationship with studied species In Clade I, P balfouriana (LT) and P serrata Balf (LR) were sister groups- two descends that split from the same node with weak supported (BS:32), P filicifolia (LTO) and P australiana were sister groups (BS=65) (Figure 4.4) 31 Clade I Clade II Figure 4.4: Maximum Likelihood tree of Polyscias based psbA-trnH sequences Note: Branch lengths are to scale Major clades at psbA-trnH tree were indicated Numbers on nodes are bootstrap support values Thus, chloroplast intergenic psbA-trnH spacer has recently become a popular tool for plant identification and phylogenetic analyses This region has been proposed as suitable for DNA barcoding studies Since the psbA-trnH is one of the most rapidly evolving spacers in chloroplast DNA with 75 bp conserved fragments at the ends Besides, it demonstrated good universality and high amplification success (Degtjareva et al., 2012) Therefore, psbA-trnH gene should be widely used for further plant phylogenetic analyses in the world in general, and Vietnam in particular 32 CHAPTER 5: CONCLUSION AND SUGGESTION 5.1 Conclusion - We extracted total DNA from five leaf samples of Polyscias genus: Dinh lang la nho (P fruticosa), Dinh lang la dia (P scutellaria), Dinh lang la to (P balfouriana), Dinh lang la rang (P serrata Balf), Dinh lang la to (P filicifolia) Pu_psbA-trnH primers were specifically designed and successfully amplified the psbA-trnH fragments - The five psbA-trnH fragments were determined in the nucleotide sequence It is about 500 nucleotides in length The raw sequences were edited to remove noise signal at the beginning and the end Finally, we obtained sequences of 457 nucleotides - Bioedit, BLAST, and MEGAX software were used to analysis and construct phylogenetic tree of Polyscias species based on psbA-trnH fragment In the study, five psbA-trnH sequences of the five species were grouped in Clade I and shown the relationship among the five Polyscias with six reference sequences 5.2 Suggestion - Applying other DNA barcoding to exactly evaluate the diversity of these species 33 REFERENCES Vietnamese references Đỗ Văn Mai, Thiều Văn Đường, Vũ Thị Bình, Trần Cơng Luận (2019) Xác Định Tên Khoa Học Của Cây Đinh Lăng Lá Tròn Bằng Phương Pháp GiảiTrình Tự Gen rbcL Tạp chí Nghiên cứu khoa học Phát triển kinh tế Trường Đại học Tây Đơ, tập 7: 148-156 Hà Văn Hn, Hồng Minh Trang, Bùi Thị Mai Hương (2020) Nghiên Cứu Xác Định Đoạn DNA Barcode Cho Loài Hoàng Đàn (Cupressus tonkinensis) Phục Vụ Giám Định Lồi Tạp chí khoa học công nghệ lâm nghiệp, tập 1: 3-10 Le Thanh Huong, Nguyen Nhat Linh, Bui Manh Minh, Ha Hong Hanh, Huynh Thi Thu Hue, Nong Van Hai, Ha Van Huan, and Le Thu Hien (2017) Application of DNA barcodes in identification of ginseng samples in the genus Panax L Vietnam Journal of Biotechnology 15(1): 63-72 Nguyễn Thượng Dong, Trần Công Luận, Nguyễn Thị Thu Hương, 2007 Sâm Việt Nam số thuốc họ Nhân sâm NXB khoa học kỹ thuật Hà Nội, tr 293 Nguyen, T A T., and Nguyen, K P (2007) Chemical examination of Polyscias serrate Balf Family Araliaceae Tap Chi Khoa Hoc, 45: 102-105 Nguyễn Văn Việt, Nguyễn Thị Huyền, Đào Thị Thúy Hằng (2019) Nghiên Cứu Xác Định Đoạn AND Mã Vạch Cho Dây Thìa Canh (Gymnema sylvestre (Retz.) R.Br) Phục Vụ Giám Định Lồi Tạp chí khoa học công nghệ lâm nghiệp, tập 1: 25-33 34 English references Ajmal Ali, M., Gyulai, G., Hidvégi, N., Kerti, B., Al Hemaid, F M A., Pandey, A K., and Lee, J (2014) The changing epitome of species identification – DNA barcoding Saudi Journal of Biological Sciences, 21(3): 204–231 Aldrich, J., Cherney, B W., and Merlin, E (1988) The role of insertions/deletions in the evolution of the intergenic region between psbA and trnH in the chloroplast genome Current Genetics, 14(2): 137–146 Ashmawy, N S., Gad, H A., Ashour, M L., El-Ahmady, S H., and Singab, A N B (2020) The genus Polyscias (Araliaceae): A phytochemical and biological review Journal of Herbal Medicine, 23, 100377 Asumeng, K.G., Ofori-Amoah, J., Asumeng, K.G., Boye, A., Acheampong, J., Amegashie, E., Kumi, A.A., Kyei, S., Akomanin, A.E., and Barku, A (2016) Anti-asthmatic property and possible mode of activity of an ethanol leaf extract of Polyscias fruticosa Pharm.Biol, 54(8): 1354–1363 Bedir, E., Toyang, N J., Khan, I A., Walker, L A., and Clark, A M (2001) A New Dammarane-Type Triterpene Glycoside from Polyscias fulva Journal of Natural Products, 64(1): 95–97 Bensita, M.B., Nilani, P., and Sandhya, S.M (1999) Studies on the adaptogenic and antibacterial properties of Polyscias fructicosa (L) harms Anc Sci Life, 18: 231–246 Bolson M., Smidt EdC., Brotto ML., and Silva-Pereira V (2015) ITS and trnH-psbA as Efficient DNA Barcodes to Identify Threatened Commercial Woody Angiosperms from Southern Brazilian Atlantic Rainforests PLoS ONE 10(12): e0143049 Buchanan, M S., Carroll, A R., Edser, A., Parisot, J., Addepalli, R., and Quinn, R J (2005) Tyrosine kinase inhibitors from the rainforest tree Polyscias murrayi Phytochemistry, 66(4), 481–485 Chaturvedula, V S P., Schilling, I K., Miller, J S., Andriantsiferana, R., Rasamison, V.E., and Kingston, D G L (2003) New cytotoxic oleanane saponins from the infructescences of Polyscias amplifolia from Madagascar rainforest Planta Med, 69: 440-444 Gao, T., Ma, X., and Zhu, X (2013) Use of the psbA-trnH Region to Authenticate Medicinal Species of Fabaceae Biological and Pharmaceutical Bulletin, 36(12): 1975–1979 10 Cho, Y., Mower, J P., Qiu, Y L., Palmer, J D (2004) Mitochondrial substitution rates are extraordinarily elevated and variable in a genus of flowering plants Proc Natl Acad Sci USA, 101:17741–17746 35 11 Chowdhury, A B (2020) Taxonomy: DNA barcoding Retrieved from https://plantlet.org/taxonomy-dna-barcoding/ 12 Degtjareva, G V., Logacheva, M D., Samigullin, T H., Terentieva, E I., and ValiejoRoman, C M (2012) Organization of chloroplast psbA-trnH intergenic spacer in dicotyledonous angiosperms of the family umbelliferae Biochemistry (Moscow), 77(9): 1056–1064 13 Divarka, M C., Devi, S L., Kumar, P S., and Rao, S B (2001) Indian J Nat.Prod Resour Studies on Wound healing property of Polyscias scutellaria leaf saponins Indian J Nat Prod Resour, 17: 37-42 14 Divakar, M C., Pillai, N R., and Rao, S B (2005) Isolation and biological activity studies of two triterpene glycosides from leaves and roots of Polyscias fruticosa India J.Nat.Prod.Resour, 21: 7-14 15 Divakar, M.C., Sheela, S., Sandhya, S., Vinod, K.r., Pillai, N.R., and Rao, S.B (2010) Antiimflammatory and antioxidant activities of Polyscias filicifolia saponins Pharm Lett, 2: 41-47 16 Feng, S., Jiang, M., Shi, Y., Jiao, K., Shen, C., Lu, J., Ying, Q., and Wang, H (2016) Application of the Ribosomal DNA ITS2 Region of Physalis (Solanaceae): DNA Barcoding and Phylogenetic Study Frontiers in Plant Science, 17 Furmanowa, M., Nosov, A M., Oreshnikov, A V., Klushin, A G., Kotin, M., Starosciak, B., Sliwinska, A., Guzewaska, J., and Bloch, R (2002) Antimicrobial activity of Polyscias filicifolia cell biomass extracts Pharmazie, 57: 424-426 18 Gogoi, B., and Bhau, B S (2018) DNA barcoding of the genus Nepenthes (Pitcher plant): a preliminary assessment towards its identification BMC Plant Biology, 18: 153 19 Gopalsamy, N., Gueho, J., Julien, H R., Owadally, A W., and Hostettmann, K (1990) Molluscicidal saponins of Polyscias dichroostachya Phytochemistry, 29(3): 793–795 20 Hajibabaei, M., Janzen, D H., Burns, J M., Hallwachs, W., and Hebert, P D (2006) DNA barcodes distinguish species of tropical Lepidoptera Proceedings of the National Academy of Sciences of the United States of America, 103(4): 968–971 21 Heather, J M., and Chain, B (2016) The sequence of sequencers: The history of sequencing DNA Genomics, 107(1): 1–8 36 22 Hebert, P D N., Cywinska, A., Ball, S L., and deWaard, J R (2003) Biological identifications through DNA barcodes Proceedings of the Royal Society B: Biological Sciences, 270(1512): 313–321 23 Kang, Y., Deng, Z., Zang, R., and Long, W (2017) DNA barcoding analysis and phylogenetic relationships of tree species in tropical cloud forests Scientific Reports, 7, 12564 24 Kaur, S (2015) DNA Barcoding and Its Applications International Journal of Engineering Research and General Science, 3(2): 602-604 25 Kress, W J., and Erickson, D L (2007) A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region PLoS One 2: e508 26 Kress, W J., and Erickson, D L (2008) DNA barcodes: Genes, genomics, and bioinformatics Proceedings of the National Academy of Sciences, 105(8): 2761–2762 27 Kress, W J., Wurdack, K J., Zimmer, E A., Weigt, L A., and Janzen, D H (2005) Use of DNA barcodes to identify flowering plants Proc Natl Acad Sci USA, 102: 83698374 28 Lahaye, R., van der Bank, M., Bogarin, D., Warner, J., Pupulin, F., Gigot, G., Maurin, O., Duthoit, S., Baraclough, T G., and Savolainen, V (2008) DNA barcoding the floras of biodiversity hotspots Proceedings of the National Academy of Sciences, 105(8): 2923–2928 29 Liu, G., Ning, H., Ayidaerhan, N., and Aisa, H A (2016) Evaluation of DNA barcode candidates for the discrimination of Artemisia L Mitochondrial DNA Part A, 28(6): 956–964 30 Liu, Z., Zeng, X., Yang, D., Chu, G., Yuan, Z., and Chen, S (2012) Applying DNA barcodes for identification of plant species in the family Araliaceae Gene, 499(1): 76–80 31 Lutomski, J., Luan, T.C., and Hoa, T T (1992) Polyacetylenes in the Araliaceae family Part IV The antibacterial and antifungal activities of two main polyacetylenes from Panax vietnamensis Ha et Grushv And Polyscias fruticosa (L.) Harms Herba Pol, 38: 137– 140 32 Luyen, N T., Dang, N H, Binh, P T X., Hai, N T., and Dat, N T (2018) Hypoglycemic property of triterpenoid saponin PFS isolated from Polyscias fruticosa leaves An Acad Bras Scienc, 90(3): 2881-2886 33 Ma, X Y., Xie, C X., Liu, C., Song, J Y., Yao, H., Luo, K., Zhu, Y J., Gao, T., Pang, X H, Qian, J., and Chen, S L (2010) Species Identification of Medicinal 37 Pteridophytes by a DNA Barcode Marker, the Chloroplast psbA-trnH Intergenic Region Biological & Pharmaceutical Bulletin, 33(11): 1919–1924 34 Manh Minh Bui, Anh Tuan Vu, Phuong Nhung Vu, Quang Cu Pham, Dang Ton Nguyen, and Thi Thu Hue Huynh (2018) DNA barcoding, an approach for molecular identification of Huyen-sam (Scrophularia L.) samples collected in Northern Vietnam Pharmocology, Biotechnology, 60(2): 56-64 35 Marczewska, J., Karwicka, E., Drozd, J., Anuewska, E., Sliwinska, A., Nosov, A., and Olszowska, O (2011) Assessment of cytotoxic and genotoxic activity of alcohol extract of Polyscias filicifolia shoot, leaf, cell biomass of suspension culture and saponin fraction Acta Pol Pharma, 68: 703-710 36 Nithaniyal, S., and Parani, M (2016) Evaluation of chloroplast and nuclear DNA barcodes for species identification in Terminalia L Biochemical Systematics and Ecology 68: 223-229 37 Palmer, J D (1992) Mitochondrial DNA in plant systematics In: Soltis P S., Soltis D.E., Doyle J.J., editors Molecular Systematics of Plants Chapman & Hall; New York: pP 36–49 38 Palmer, J D., Adams, K L., Cho Y., Parkinson, C L., Qiu, Y L., and Song, K (2000) Dynamic evolution of plant mitochondrial genomes: mobile genes and introns and highly variable mutation rates Proc Natl Acad Sci USA, 97: 6960–6966 39 Perceva, T P., Miriuta, A I., Moisa, L N , Mozhilevskaia, L P., and Kunkh, V A (2010) Interaction of Ungernia victoris, Rhodiola rosea and Polyscias filicifolia plant extracts with bacterial cells Tsitol Gene, 44: 34-40 40 Plunkett, G M., Lowry II, P P , and Vu, N V (2004) Phylogenetic Relationships among Polyscias (Araliaceae) and Close Relatives from the Western Indian Ocean Basin International Journal of Plant Sciences, 165(5): 861–873 41 Quattrocchi, U (2012) CRC World Dictionary of Medical and Poisonous Plants: Common Names, Scientific Names, Eponyms, Synonyms, and Etymology (5 volume Set) CRC Press, 3960p 42 Song, J., Yao, H., Li, Y., Li, X., Lin, Y., Liu, C., Hang, J., Xie, C., and Chen, S (2009) Authentication of the family Polygonaceae in Chinese pharmacopoeia by DNA barcoding technique Journal of Ethnopharmacology, 124(3): 434–439 38 43 Sugimoto, S., Yamano, Y., Khalil, H E., Otsuka, H., Kamel, M S and Matsunami, K (2017) Chemical structures of constituents from leaves of Polyscias balfouriana Journal of Natural Medicines, 71: 558–563 44 Tai-Wai Lau, D., Shaw, P C., Wang, J., and But, P H (2001) Authentication of Medicinal Dendrobium Species by the Internal Transcribed Spacer of Ribosomal DNA Planta Medica, 67(5): 456–460 45 Thuy Linh Nguyen, Thi Hang Pham, Van Truong Do, and Thi Thu Hue Huynh (2017) Evaluating the systematic position of Ehretia asperula Zoll And Moritzi based on ITS1, matK, trnL-trnF DNA sequences Biotechnology, 59(4): 61-65 46 Tran, P T., Dang, N H., Kim, O., Van Cuong, P , Dat, N T., Hwangbo, C., Van Minh, C., and Lee, J H (2019) Ethanol extract of Polyscias fruticosa leaves suppresses RANKL-mediated osteoclastogenesis in vitro and LPS-induced bone loss in vivo Phytomedicine, 152908 47 Vijayan, K., and Tsou, C.-H (2010) DNA barcoding in plants: taxonomy in a new perspective Current Science, 99(11): 1530-1541 48 Vo, D H., Yamamura, S., Ohtani, K., Kasai, R., Yamasaki, K., Nham, N T., and Chau, H M (1998) Oleanane saponins from Polyscias fruticosa Phytochemistry, 47(3), 451–457 49 Ward, R D., Zemlak, T S., Innes, B H., Last, P R., and Hebert, P D (2005) DNA barcoding Australia's fish species Philosophical Transactions of the Royal Society of London Series B, Biological Sciences, 360(1462): 1847–1857 50 Wu, F., Li, M., Liao, B., Shi, X., and Xu, Y (2019) DNA Barcoding Analysis and Phylogenetic Relation of Mangroves in Guangdong Province, China Forests, 10(1): 56 51 Xiaohui Pang., Chang Liu., Linchun Shi., Rui Liu., Dong Liang., Huan Li., Stacey S., Cherny., and Shilin Chen (2012) Utility of the trnH–psbA Intergenic Spacer Region and Its Combinations as Plant DNA Barcodes: A Meta-Analysis PLoS ONE 7(11): e48833 52 Yassin, A., Markow, T A., Narechania, A., O’Grady, P M., and DeSalle, R (2010) The genus Drosophila as a model for testing tree- and character-based methods of species identification using DNA barcoding Molecular Phylogenetics and Evolution, 57(2): 509–517 53 Yao, H., Song, J Y., Ma, X Y., Liu, C., Li, Y., Xu, H X., Hang, J P., Duan L H., and Chen, S L (2009) Identification of Dendrobium Species by a Candidate DNA Barcode Sequence: The Chloroplast psbA-trnH Intergenic Region Planta Medica, 75(06): 667–669 39 54 Young, M K., McKelvey, K S., Pilgrim, K L., and Schwartz, M K (2013) DNA barcoding at riverscape scales: assessing biodiversity among fishes of the genus Cottus (Teleostei) in northern Rocky Mountain streams Molecular Ecology Resources, 13(4): 583– 595 55 Yoo, H S., Eah, J Y., Kim, J S., Kim, Y J., Min, M S., Paek, W K., Lee, H., and Kim, C B (2013) Retraction note: DNA barcoding Korean birds Molecules & Cells, 35(4): 357–357 56 Zhang, Z., Cheng, Q., and Ge, Y (2019) The complete mitochondrial genome of Rhynchocypris oxycephalus (Teleostei: Cyprinidae) and its phylogenetic implications Ecology and Evolution, 9(13): 7819-7837 57 Zuo, Y., Chen, Z., Kondo, K., Funamoto, T., Wen, J., and Zhou, S (2010) DNA Barcoding of Panax Species Planta Medica, 77(02): 182–187 40