differential display methods and protocols

1 Differential Display A General Protocol Peng Liang and Arthur B Pardee Introduction One of the greatest unsolved mysteries of life 1show the hundreds of thousands of genes embedded in the genome of an organism are selectively expressed mto the mRNA and protems m a temporally and spatially regulated manner that gives rise to different tissues and organs The abnormality m this intricate regulatory cn-cuitry IS beheved to be one of the underlmmg causes of a variety of pathological alterations or disease states.The rsolation and characterization of differentially expressed genes becomes one of the first steps toward the understanding of these important biological questions Differential display (1) and a related RAP-PCR method (2) were developed to more efficiently Identify and isolate these genes The general strategy for differential display (Fig 1) IS based on a combmatton of three techniques brought together by a concept: Reverse transcrlptlon of mRNA from anchored primers (see Note l), Choice of arbitrary primers for setting lengths of cDNAs to be amplified by the polymerase chain reaction (PCR), each corresponding to part of a mRNA (tags), Sequencmg gels for high resolution of amplified cDNA The objective IS to obtain a tag of a few hundred bases,which 1ssufficiently long to uniquely identify a mRNA and yet short enough to be separated from others by size Given the fact that primers of nearly any length, with or without anchors, can generate cDNA fingerprints sufticrently reproducible to allow differentially expressed genes to be identified, it may be hard to define what should be a standard protocol for differential display The followmg protocol using one-base anchored primer m combmatron with arbitrary 13-mers (3) IS given as an example to illustrate the methodology From Methods m Molecular Bology, Vol 8.5 D/fferenf/a/ Edlted by P Llang and A B Pardee Humana Dsplay Methods and Protocols Press Inc , Totowa, NJ Liang and Pardee L Reverse banswiption 5’.AAGC3’ dNTPs MMLV reverse tfanscnptase WAA-A~ GVGAA JI (H-TUG) PcRamplificatloll AAGCTTGATECC I 5’-AAGCTTGAITGCC-3’ (H-AP-1 Ptimer) 5’44GC3 (H-TIIG) dNTPs a-(‘“S-dATP] Ampli’lhq DNA poiymelase GWGAA A4GCiTGA’lTGCC G-GU IIL Denaturing polyacrylamide gel Fig Schemattc representation of one-base anchored differentral display Materials 5X RT buffer: 125 mA4TrwC1, pH 3,188 mMKCl,7.5 dithrothretol MMLV reverse transcrrptase (100 cl/@,) dNTP (250 @I) 5’-AAGCTTTTTTTTTTTG-3’ (2 /.&I) 5’-AAGCTTTTTTTTTTTA-3’ (2 pA4) 5’-AAGCTTTTTTTTTTTC-3’ (2 /&I) Arbitrary 13-mers (2 pM) 10X PCR buffer mMMgC12, and 25 ti Differential 10 Il 12 13 14 15 16 17 18 19 20 Display dNTP (25 pJ4) Glycogen (10 mg/mL) Distilled water (dH,O) DEPC-treated H,O Loading dye AmphTaq DNA polymerase, Perkin-Elmer Corporation (Norwalk, CT) a-[33P]dATP (>2000 Wrnmole) or a-[35S]dATP (>l,OOO Ci/mmole) (see Note 2) RNase-free DNase I (10 U/pL) QIAEXrM DNA extraction kit (Qiagen, Chatsworth, CA) pCR-TRAPTM clonmg system (GenHunter Corporation, Nashville, TN) Thermocycler 6% denaturmg polyacrylamide gel DNA sequencing apparatus Although individual components may be purchased separately from varrous suppliers, most of them can be obtained in kit forms from GenHunter Corporation Methods 3.1 DNase I Treatment of Total RNA Purification polyadenylated RNAs is neither necessary nor helpful for differential display The major pitfalls of using the polyadenylated mRNAs are the frequent contammation of the oligo-dT primers, that give high background smearing in the display and the difficulty m assessing the integrity of the mRNAs templates (4) Total cellular RNAs can be easily purified with one-step acid-phenol extraction method (5) However, no matter what methods are used for the total RNA purification, a trace amount of chromosomal DNA contamination m the RNA sample could be amplified along with mRNAs thereby comphcating the pattern of displayed bands Therefore removal of all contaminating chromosomal DNA from RNA samples is essential before carrying out differential display Incubate 10-100 pg of total cellular RNA with 10 U of DNase I (RNase free) in 10 mMTris-Cl, pH 8.3, 50 mMKC1, 1.5 mMMgC& for 30 mm at 37°C Inactivate DNase I by adding an equal volume of phenolchloroform (3: 1) to the sample Mix by vortexing and leave the sample on ice for 10 mm Centrifuge the samplefor at 4’C m an Eppendorf centrifuge Save the supernatant, and ethanol precipitate the RNA by adding vol of ethanol in the presence of 0.3MNaOAC, and incubate at -80°C for 30 mm Pellet the RNA by centrifuging at 4°C for 10 Rinse the RNA pellet with 0.5 mL of 70% ethanol (made with DEPC-H20) and redissolve the RNA in 20 pL of DEPC-treated HzO Measure the RNA concentration at ODS6s with a spectrophotometer by diluting pL of the RNA sample in mL of HzO Llang and Pardee Check the integrity of the RNA samples before and after cleanmg wtth DNase I by runnmg 1-3 ~18of each RNA on a 7% formaldehyde agarose gel 10 Store the RNA sample at a concentratton htgher then pg/$ at -80°C before using for differential dtsplay 3.2 Reverse Transcription of mRNA Set up three reverse transcription reactions for each RNA sample in three microfuge tubes (0 5-mL), each contammg one of the three dtfferent anchored ohgo-dT prrmers as follows For 20 pL final volume p.L of dH,O, pI of 5X RT buffer, 1.6 pL of dNTP (250 I.&‘), pL of DNA-free total RNA (freshly diluted to pg/pL wtth DEPC-treated H,O), and pL of AAGCT, ,M (2 $4) (M can be either G, A, or C) Program your thermocycler to* 65°C for mm, 37°C for 60 min, 75’C for mm, 4°C (see Note 3) pL MMLV reverse transcrlptase 1s added to each tube 10 mm after at 37°C and mix well quickly by finger tipping Continue mcubation and at the end of the reverse transcription reaction, spm the tube briefly to collect condensation Set tubes on ice for PCR or store at -80°C for later use 3.3 PCR Amplification Set up PCR reacttons at room temperature as follow* 20 p.L final volume for each primer set combmation 10 pL of dH,O, $ of 10X PCR buffer, 1.6 l.iL of dNTP (25 pA4), pL of arbitrary 13-mer (2 CUM),2 pL of AAGCT, ,M (2 CIM), pL of RT-mix from step , pL of a-[33P]-dATP (see Note 2), p.L of AmpliTaq Mix well by pipetmg up and down (see Note 4) Add 25 pI mineral oil if needed PCR as follows 94°C for 30 s, 40°C for mm, 72°C for 30 s for 40 cycles, 72°C for mm, 4“C (For Perkm-Elmer’s 9600 thermocycler it is recommend that the denaturanon temperature be shortened to 15 s and the rest of parameters kept the same ) 3.4 6% Denaturing Polyacrylamide Gel Electrophoresis Prepare a 6% denaturmg polyacrylamide gel m TBE buffer Let it polymertze at least for more than h before usmg Prerun the gel for 30 mm Mix 3.5 pL of each sample with p.L of loading dye and incubate at 80°C for mm immediately before loading onto a 6% DNA sequencmg gel (see Note 5) Electrophorese for about h at 60 W constant power (with voltage not to exceed 1700 V) until the xylene dye (the slower movmg dye) reaches the bottom Turn off the power supply and blot the gel onto a piece of 3M Paper Cover the gel with a plastic wrap and dry tt at 80°C for h Do not fix the gel with methanol/ acetic acid (see Note 6) Orient the autoradiogram and dried gel wtth radioacttve mk or needle punches before exposing to a X-ray film Figure shows a representative differential dts- Differential Display H-T110 H-T110 H-TIIA H-WA H-TIIA H-TIIC H-TllC H-AP3 H-APB H-API H-AP3 H-AP3 H-APl H-AP3 Fig Differential display using one-base anchored oligo-dT primers (7) Four RNA samples from non-transformed cell line Rat and H-ras transformed cell lines rat (ras), T101-4 and Al-5 (lanes from left to right, respectively) were compared by differential display using three one-base anchored oligo-dT primers, AAGCT, ,G, AAGCT, ,A and AAGCT, ,C in combinations with three arbitrary 13-mers, H-API (AAGCTTGATTGCC), HAP2 (AAGCTTCGACTGT) and HAP3 (AAGC’l’l’l’GGTCAG) The mob-l (ZO) and mob-7 cDNA fragments were marked by the right and let? arrowheads, respectively play obtained with three one-base anchored oligo-dT primers in combinations with three arbitrary 13-mers (3) 3.5 Reamplification of cDNA Probe After developing the film (overnight to 72-h exposure), orient the autoradiogram with the gel Locate bands of interest (see Note 7) either by marking with a clean pencil from underneath the film or punching through the film with a needle at the four corners Liang and Pardee 10 11 12 13 14 15 of each band of interest (Handle the dried gel with gloves and save it between two sheets of clean paper) Cut out the located band with a clean razor blade Soak the gel slice along with the 3M paper in 100 pL dH,O for 10 mm Boil the tube with tightly closed cap (e.g., with parefilm) for 15 Spm for mm to collect condensatron and pellet the gel and paper debris Transfer the supernatant to a new micromge tube Add 10 pL of 3MNaOAC, pL of glycogen (10 mg/mL) and 450 p.L of 100% EtOH Let sit for 30 mm on dry ice or in a -8O’C freezer Spm for 10 mm at 4°C to pellet DNA Remove supernatant and rinse the pellet with 200 pL we-cold 85% EtOH (you will lose your DNA if less concentrated EtOH is used!) Spm briefly and remove the resrdual ethanol Dissolve the pellet m 10 pL of PCR H,O and use pL for reamplificatron Save the rest at -20°C in case of mishaps Reamplification should be done using the same primer set and PCR conditions except the dNTP concentrations are at 20 piV (use 250 @4 dNTP stock) instead of 2-4 pA4 and no rsotopes added A 40-pL reaction is recommended for each reactron: 20.4 of pL dH,O, pL of 10X PCR buffer, 3.2 pL of dNTP (250 @4), & of arbitrary 13-mer (2 @?), $ AAGCT, ,M (2 @4) (M can be either G, C, or A), pL of cDNA template from step 3.2 and 0.4 pL of AmphTaq (5 U/pL) Run 30 pL of the PCR sample on a 1.5% agarose gel stained with ethidmm bromide (More than 90% probes should be visible on the agarose gel ) Save the remaining PCR samples at -2O’C for subclomng Check to see rf the size of your reamplified PCR products are consistent with their size on the denaturing polyacrylamide gel 3.6 Confirmation of Differential Gene Expression Extract the reamplified cDNA probe from the agarose gel using QIAEX kit Use the extracted cDNA as a probe for Northern blot confirmation following the standard protocol (ref 5; see Note 8; Fig 3) Clone the cDNA probe using the pCR-TR4PTM cloning system (see Note 9) Confirmation of differentially expressed cDNA probes can be also carried out more efficiently by “Reverse Northern” dot blot or differential screening of cloned cDNA probes by colony hybrtdization (ref 6; Chapter by H Zhang et al m this book) Clone the full-length cDNA by screening a cDNA library followmg the standard procedure (5) Notes The initial choice of usmg two-base anchored ohgo-dT primers (1) instead of one-base anchored primers (3) were owing to a historical rather than scienttfic reason The cloned marine thymidine kmase (TK) cDNA originally used as a Differential Display Mob-l A H-AP2 + AAgc~~CTGTACAAAGG~~C~~T~A~~AC~~~~~ ATATGTAAGAACGTATGTATCAATGGGTAGITAAAGTlTACATAGG CAAATGClTl-GAATGCTACATAlTACAAGATGTGlTGGATGGlllTCAMATAMAT GTACTGTATTGAATGTAGTATGAGACCAAAAAA GTAATAAAGTAATAATAACTGAC ATGAAAAAAAAAAAGC-IT H-T1 I C Mob-7 B H-AP2 * AAgcttcGAcTGTAcAAA~GcGGAAcTccfGAATGTATTTT ATAT~AAGAAClTGTGTGGTAAGTATGTATGTAfCAATGGGTAGlTAAA~ACATAGG CAAATGCllTGAATGCTACATATTACAAGATGElTGGATGGlllTCAAAATAAAAT GTACCCAAAAAAGTAATAAAGTAATAATAACTGAC ATGAAATGCAAAAAAAAAAAGCTT H-T1 I G C 1234 Mob-7 rRNA Fig Nucleotide sequences of mob-l (A) and mob-7 (B) cDNA fragments cloned by differential display The flanking primers are marked by arrow bars and the polyadenylation site is underlined Mob-7 differs from mob-l only by base addition at the 3’ end of the cDNA (see Note 10) Northern blot analysis with mob-7 cDNA probe (C) The 253 bp mob-7 cDNA was used as a probe to confirm the differential expression of the gene using 20 pg of total RNA from Rat and three transformed derivatives Rat @as), T101-4 and Al-5 cells (lanes to 4, respectively) The lower panel is ethidium bromide staining of ribosomal RNAs as a control for equal sample loading 10 Lang and Pardee control cDNA template had only 11 As m its poly(A) tall It was found that onebase anchored prrmer Tl 1C fatled to amplify the TK 3’ termmus m combmatton wtth an upstream primer specific to TK Extension of one more base from the 3’ end instead of the 5’ end of the anchored primer was a logical Interestingly, Tl 1CA started to work successfully m PCR to amplify the expected TK cDNA template (1) Later, longer one-base anchored primers that had mismatches at the 5’ ends of the prtmers were shown to be much more efficient for differential display m subdividing the mRNA populations mto three groups (3) One-base anchored primers have significant advantage over the two-base anchored primers m that the former cuts down the redundancy of priming, elimmates the high background smearing problem for two-base anchored pnmers ending with the 3’ “T” and reduce the number of reverse transcription reactions from 12 to per RNA sample It has been observed that 35S labeled nucleottde origmally used for differential display would leak through PCR reaction tubes (espectally when thin-walled tubes are used) and 33P labeled nucleotide was recommended as the best alternative (9) 33P is not only safer to use but also gives better sensmvtty compared to 35S For the reverse transcrtption reaction, the mmal 65°C incubation is intended to denature the RNA secondary structure The final incubation at 75°C for minis to inactivate the reverse transcrlptase without denaturing the cDNA/mRNA duplexes Therefore “hot start “PCR is neither necessary, nor helpful for the subsequent PCR reactions using cDNAs as templates Make core mixes as much as possible to avoid ptpetmg errors (e g , aliquot RT-mix and AP-primer mdrvidually) Otherwise it would be difficult to pipet 0.2 pL of AmpliTaq Mix well by pipetmg up and down It is crucial that the urea in the wells be completely flushed right before loading your samples For best resolution, flush every 4-6 wells each time during sample loading while trying not to disturb the samples that have been already loaded DNA is acid labile, especially at high temperature when the gel is dried This will affect the subsequent PCR during the reamplificatton of the cDNA fragments to be analyzed further First tentatively identify those bands that appear to be differentially expressed on the initial display gel Then repeat the RT step and the PCR reactions for these lanes and see if these differences are reproducible before pursumg further It 1s recommended that bands bigger than 100 bp be selected It has been generally observed that shorter cDNA probes have higher probability of failing to detect any signals on the Northern blot It IS recommended that the standard prehybrrdrzatron and hybridrzation condttton at 42°C be used Wash with 1X SSC, 0.1% SDS at room temperature for 15 twice followed by washing with 0.25X SSC, 1% SDS at 55-6O”C for 15-30 mm Do not go over 60°C Expose with intensifying screen at -80°C for overnight to wk pCR-TRAP cloning system is by far the most efficient cloning method for PCR products that we have tested The pCR-TRAP clonmg system utilizes the third generation cloning vector that features postttve-selection for DNA mserts Only Different/al Display II the recombinant plasmtds confer the antibiotic resistance The prmclple of thts unique clonmg system 1sbased on that the phage Lambda repressor gene c1 cloned on the pCR-TRAP vector codes for a repressor protein The repressor protein binds to the Lambda right operators Or1 to Or3 of the cro gene, thereby turning off the promoter that drives the TetR gene on the plasmtd Therefore, cloning of the PCR products dtrectly, without any post-PCR purification, into the c1 gene leads to the inactivation of the repressor gene, thus turnmg on the TetR gene The cloned PCR insert can then be readily sequenced or retrieved as a probe by PCR using primers flanking the cloning site of the vector 10 It 1sknown that the poly(A) tail of a rnRNA is not always added at a fixed position downstream of the AATAAA polyadenylatton signal This 1s why both mob-l and mob-7 correspondmg to the same mRNA were detected by the same arbitrary primer m combmatton with different anchored primers Acknowledgment We thank GenHunter Corporation for the permtsslon of adapting its protocols for Message CleanTMkit and RNAlmage TMkit for differential display The work was supported m part by a Natlonal Institute of Health grant CA61232 awarded to Arthur B Pardee and Peng Llang References Liang, P and Pardee, A B (1992) Dtfferentlal display of eukaryotic messenger RNA by means of the polymerase cham reaction Science 257, 967-97 Welsh, J , Chada, K , Dalal, S S , Cheng, R , Ralph, D., and McClelland, M (1992) Arbitrarily primed PCR fingerprmtmg of RNA Nuclezc Aczds Res 20, 4965-4970 Liang, P Zhu, W , Zhang, X., Guo, Z , O’Connell, R P., Averboukh, L , Wang, F , and Pardee A B (1994) Differenttal display usmg one-base anchored ohgo dT primers Nucleic Acids Res 22, 5763,5764 Ltang, P Averboukh, L., and Pardee, A B (1993) Dtstrlbutton and cloning of eukaryottc mRNAs by means of differential display* refinements and optimization Nuclezc Acids Res 21, 3269-3275 Ausubel, F , Brent, R , Kingston, R E , Moore, D D., Seidman, J G , Smith, J A, and Struhl, K (1988) Current Protocols In Molecular Biology, Greene and Wiley-Interscience, New York Zhang, H , Zhang, R., and Ltang, P (1996) Differential screening of gene expression difference enriched by differential display Nuclezc Acids Res 24,2454-2456 Trentmann, S M , Knaap, E., Kende, H., Ltang, P., and Pardee A B (1995) Alternatives to 35S as a label for the differential display of eukaryottc messenger RNA Sczence 267,1186,1187 290 Babity et al reproduclblllty IS obtained when fresh materials are used and the time m between cDNA synthesis and differential display 1skept to a mmlmum 3.1 RNA Isolation Tissues used for RNA lsolatlon should be quickly dlssected,snap frozen and stored in liquid nitrogen until used (seeNote 4) Frozen tissue may be transferred du-ectly into a dounce homogemzer contammg TRIzol Reagent (see Note 5) As the frozen tissue thaws, homogenize until the sample IS umformly lysed Rapld homogemzatlon ensures mmlmal RNA degradation Add 2/l vol of chloroform directly to the homogenate, shake vigorously for 15 s and place on ice for mm Centrifuge the suspension at 12,OOOgfor 15 mm at 4°C After centnfugatlon, recover the colorless upper aqueous phase taking care to avoid material at the interface Add mL of lsopropanol per mL of homogenate, mix and store for 15 mm at 4°C Centrifuge at 12,000g for 15 mm at 4°C Wash the RNA pellet once with 75% ethanol, adding mL 75% ethanol per mL of TRIzo Reagent used for the mltlal Isolation Vortex the sample and centrifuge at 7500g for mm at 4°C Air dry the RNA pellet for 15 mm on the benchtop Overdrying the pellet can result m a pellet that 1s dlfflcult to resuspend Resuspend the pellet m RNase-free dH,O In order to further purify the total RNA, add l/10 vol of 2MNaCl to the resuspended RNA and precipitate with two volumes of 100% ethanol for h at -20°C Wash the precipitate with 75% ethanol, air-dry, and resuspend m RNase-free dH,O Treat the RNA sample with an RNase-free DNase to remove any possible DNA contammatlon from the sample Extract with an equal volume of phenol.chloroform Extract with an equal volume of chloroform Ethanol preclpltate to recover the RNA (see Note 6) 3.1.1 Use of Differential Display to Discover Genes in Small Brain Nuclei As differential display is based on the polymerase cham reactlon, it is mherently capable of analysis of very small samples Because we are also interested in the role of gene expression m the regulation of circadian rhythmlclty m mammals, we are forced to work with the very small amount of tissue available from the rat suprachiasmatic nucleus (SCN) (9) For the SCN (or any other small brain region), animals are killed by rapid decapitation and the brain rapIdly removed on Ice, dissected to remove a block containing the hypothalamus and frozen on dry ice The frozen hypothalamus 1smounted on a cryostat and a 660~w-thick brain section cut at a cryostat temperature of-12 to -14°C The tissue sample 1spunched out usmg a 16-gage needle that has been flattened and bevelled to produce a punch For differential display and Northern analysis, SCN tissue 1scollected from 15-20 animals A tissue punch can be constructed 297 Application of Differential Display from an appropriate size needle and thus this procedure almost any brain region, 3.2 cDNA Synthesis can be adapted to (see Notes and 8) Heat-denature pg of DNA-free total RNA m pL of RNase-free dHzO at 65°C for mm, and then chill on ice Prepare a master mix that contains the followmg components per each reverse transcription reaction performed pL reverse transcription buffer, pL 1M DTT, @ RNasin, pL 250 w dNTPs, pL 10 Cul/iTitMN, pL dH,O Add 17 pL of the master mix to the denatured RNA, incubate 10 at 37°C then add pL MMLV reverse transcriptase and incubate for a further 50 mm At the end of the reverse transcription reaction, heat mactrvate the reverse transcrtptase by denaturing at 95’C for mm Briefly spin the tubes to collect condensatron Set the tubes on Ice for PCR or store at -2O’C for later use 3.3 Differential Display Reaction (see Notes 9-l I) Prepare reactions in duplicate, on ice, in 500 pL micro test-tubes Prepare a master mrx that contains the following components for each differential display reaction: pL 10X PCR reaction buffer, 10 $ dH20, p.L 25 @4 dNTP mix, 0.2 pL a[33P]dATP, and PI of AmpliTaq DNA polymerase For each dtfferential display reaction combme pL cDNA synthesis reaction, pL anchored 3’ primer (10 ClM) and pL arbitrary 5’ primer (10 CLM) Add 14 pL of master mix to each differential display reaction tube and mix well by plpetmg up and down Begin PCR cycling using the following cycling parameters 94°C for mm; followed by forty cycles each of 94°C for 30 s, 40°C for mm, and 72°C for 30 s, followed by 72°C incubation for min, and then a 4°C soak The differential display reactions may be stored at -2O’C until ready to analyze 3.4 Gel Electrophoresis Gel electrophoresis methodology varies greatly depending on the particular electrophoresis apparatus used For this reason, specific mstructions relating to the pouring and running of polyacrylamide gels will not be discussed in detail Instead instructrons specific to the differential display technique will be addressed Pour a 6% polyacrylamlde/SM urea sequencmg gel Mix pL of the differential display reaction with pL of loading buffer and heat denature at 80°C for Place samples on Ice unttl ready to load Remove any excess urea or acrylamide debris by flushing the top of the gel with a Pasteur pipet Position the sharkstooth comb between the glass plates to create sample wells Load pL of each sample onto a prewarmed gel to ensure denatunng conditions 292 Babity et al Electrophorese the samples until the xylene cyan01 dye has Just run off of the gel Dismantle the sequencing gel apparatus, separate the glass plate from the gel, and blot the gel onto 3MM Whatman filter paper and cover wrth plasttc wrap Dry the gel at 80°C under vacuum for 1.5-2 h Tape the X-ray film onto the drred gel and align the film to the gel by using an 1s-gage needle to poke holes through the film and gel 10 Usually an overnight exposure IS sufficient to vtsuahze the differential display banding patterns 3.5 Reamplification and Subcloning Once a candidate fragment has been identified, use a clean razor blade to cut the differentially displayed fragment from the gel Place the excised gel fragment mto a tube containing 40 pL of dHzO and boll for 15 rn order to elute DNA from the gel The remainder of the eluted gel fragment can be stored at -20°C Centrifuge the tube at 12,000g for to spin down paper and gel fragments Reamphfy the fragment of interest by combmmg the followmg reagents pL eluted DNA, pL of 10X PCR buffer, pL 250 w dNTP, pL 10 @4 anchored 3’ primer, pL 10 ~.IIVS’ arbitrary primer, 0.5 pL of AmpliTaq DNA polymerase and 23 pL dH20 PCR cycling was performed using the same cyclmg parameters employed m the ortgmal PCR generation of the fragment (see Note 12) Analyze 10 pL of the amplified reaction on a 1% TBE agarose gel The reamphfied cDNA fragment should be the same size as the fragment eluted from the original polyacrylamide gel For subclonmg, Qtaqutck gel-purified cDNA bands from fresh PCR reactions were prepared (see Note 13) and molar ratio of cDNA to TA vector used for ligation overnight at 15°C Following transformatton of competent cells and blue/ white color selection on amprcrllin plates (100 pg/mL) overlaid with X-GAL, posrttve colonies were grown overnight m LB-amptctllm, and plasmtd DNA ISOlated Those plasmrd preparations possessing an appropriate size Insert, as determined by restriction digestion and agarose gel electrophoresrs, were sequenced using a T7SequencmgTM kit (Pharmacra Brotech) Generally subclonmg was only performed once the cDNA fragment had been confirmed by Northern analysts to be dtfferenttally expressed 3.6 Southern Blot Analysis Southern hybridization provides a postttve control for probe quality m the absence of a signal on a Northern blot and also allows confirmatron that a particular clone isolated from a PCR product is responsible for the differential banding pattern on the gel Cut a region of the dried gel contammg the band of interest usmg a razor blade Prepare a piece of nylon membrane slightly larger than the gel area of mterest and six pieces of filter paper the same size Application of Differential Display 293 Cut a piece of filter paper and place on a glass plate such that rt overhangs mto a dish contammg 10X SSC Soak three sheets of precut filter paper and the dried gel with 3M NaCl, 0.5M Tris-HCl, pH 7.4, and lay, gel uppermost, on the glass plate and flood surface of gel with buffer Place membrane (previously soaked in H,O then 10X SSC), on top of gel, followed by two pieces of filter paper soaked m 10X SSC and then a dry piece Stack paper towels such that transfer is through the gel, cover with a plate and a weight (approx 500 g) and leave overnight Wash membrane with 6X SSC and irradiate face up with a UV crosslmker Dry membrane and obtain an autoradiographtc image to ascertain pattern obtamed m the absence of probe 3.7 Northern Blot Analysis Confirmation of drfferential expression was generally performed on Poly(A)+ RNA blots containing approx ~18of mRNA/lane The eluted cDNA fragment or clone can be used as a template for random primed probe synthesis Use Qiaquick gel purification to purify the cDNA fragment Label approx 30 ng of denatured cDNA with a[32P]dATP by random prrming Following h prehybridization, hybridize blots with approx x lo6 cpm/mL in a standard hybridization buffer containmg 50% formamide and 10% dextran sulfate Notes dHzO and all solutions (not including Tris, nucleotides, or other ammes) used in RNA preparation were treated for h with 0.1% diethylpyrocarbonate (DEPC) then autoclaved All glassware were treated with 0.5NNaOH for 30 min, rinsed with DEPC-treated HZ0 and then baked at 18O’C for at least h I dH20 corresponds to NANOpure deionized water (Type I Reagent Grade Water) In our hands, the dye-stabilized radionucleotides not perform reproducibly under PCR cycling conditions All RNA samples should be prepared by the same isolation procedure in order to ensure reproducibility of the banding pattern In our hands, using minimal quantities of TRIzol to extract RNA results in low AZ6s/A2s0 ratios and can often lead to poor reproducibility between RT-PCR reactions Make sure that the RNA is of high quality Pure RNA should have an A&AZsO ratio between 1.8 and 2.0 We usually examine the DNase-treated total RNA samples on an ethidium bromide stained formaldehyde agarose gel The ratio of 28s to 18s ribosomal RNA should be roughly two to one RNA degradation is evident if the 18s ribosomal RNA appears to be more abundant than the 28s ribosomal RNA Further purification is necessary if the A26s/A2s0ratio is less than 1.8 to 2.0 We have also successfully performed differential display using a single oligo(dT) primer (pd[T],,,s, Pharmacia), rather than one of the 12 anchored primers The 294 10 11 12 13 Babity et al resultant cDNA can be used for any primer combmation and provides sufficient template for 100 PCR reactions 2.0 pg of DNA-free total RNA is combmed with pL of @4ohgo(dT) primer and RNase-free dH,O added to a total volume of pL The mixture is heat-denatured at 65°C for mm and chilled on ice, & of a master mix are added that contam (per reaction) l.tL reverse transcription buffer, p.L mM dNTPs, and pL MMLV reverse transcriptase Followmg incubation for h at 42”C, the reverse transcriptase is heat inactivated (75’C, 10 mm) and the cDNA samples stored at -70°C The best differential display results are obtained using high quality RNA and fresh cDNA products The differential display pattern obtained from older cDNA products is noticeably degraded in comparison to fresh products We normally use a thermal cycler with a heated hd that allows for oil-free PCR amplification Without a heated hd, a drop of mineral oil is necessary to prevent condensation on the side of the PCR tubes Later work m our laboratory showed that the use of an N-terminal deletion of Taq, such as the AmpliTaq Stoffel fragment, in conjunction with a proofreading enzyme such as Vent produces longer PCR products, m agreement with published reports (8) In addition, the proofreading properties of this enzyme results m a lower error rate m comparison to the native AmphTaq enzyme This long-distance PCR mixture was used together with longer primers: 30-mer anchored primers and 25-mer arbitrary primers (8) In PCR with extended primers, low stringency annealing at 40°C occurs m the first three cycles of amplification while subsequent cycles occur at 60°C annealing Therefore randomly primed products generated m the first rounds of PCR are accurately replicated in subsequent cycles and many of the artefacts generated by contmuous low temperature annealing are avoided The use of extended primers also facilitates their use in the direct sequencing of reampltfied cDNA bands In addition, the use of an anchored primer m reamplification that mcorporated an RNA polymerase binding site allowed for the generation of antisense riboprobes Owmg to their single-stranded nature, such probes offer greater sensitivtty than random-primed cDNA probes and hence facilitate the detection of rare messages m Northerns, RNase protection assays and in zn situ hybridization Typically, differential display reactions utthzmg long-distance PCR conditions yields cDNA fragments that range up to 1.5-kb m length In order to resolve the higher molecular-weight fragments produced by this protocol, we have used a Genomyx LRTM sequencing apparatus This unit IS a temperature-controlled system that allows better resolution of high-molecular-weight fragments m comparison to a conventional sequencing and therefore reduces the possibihty of multiple band isolation during differential display band excision A high number of PCR cycles during reamplification leads to greater complexity of the final reaction products The use of gel-purified bands for ligation resulted m a much greater proportion of plasmids from posittve colonies containing inserts of the correct size Apphca t/on of Differen t/al D/splay 295 References Milner, R J and Sutchffe, J G (1983) Gene expression m the bram Nuclezc Aced Res 11,5497-5520 Liang, P and Pardee, A B (1992) Differential display of eukarvotic messenger RNA by means of the polymerase chain reaction Science 257, 967-97 Nedivi, E , Hevroni, D , Naot, D , Israeli, D , and Curl, Y (1993) Numerous candidate plasticity-related genes revealed by differential cDNA clonmg Nature 363, 18-722 Sperk, G (1993) Kamic acid seizures m the rat Prog Neurobzol 32, l-32 Armstrong, J N , Plumier, J -C , Robertson, H A., and Currie, R W (1996) The inducible 70-kDa keat shock protein is expressed m the degenerating dentate hilus and piriform cortex after systemic admnnstration of kamic acid m the rat Neuroscience 74,685%693 Robertson, H A (1992) Immediate early genes, neuronal plastictty and memory Blochem Cell Btol 70,729-737 Dtachenko, L B., Ledesma, J., Chenchtk, A A , and Stebert, P D (1996) Combmmg the technique of RNA fingerprintmg and differential display to obtain differentially expressed mRNA Blochem Bzophys Res Comm 219,824-828 Guide, M E , Rusak, B., and Robertson, H A (1996) Spontaneous circadian and light-induced expression OfJunB mRNA in the hamster suprachiasmatic nucleus Bram Res 732,2 15-222 24 Analysis of Gene Expression in Hypothalamus in Obese and Normal Mice Using Differential Display Eleftheria Maratos-Flier, Daqing Qu, and Steen Gammeltoft Introduction Obesity may result from increased caloric consumptton, decreased energy expenditure, or both (I) These processes are controlled, at least in part, by the hypothalamus Hypothalamic dysfunction IS important in the development of obesity and it has long been known that lesions m the ventromedial hypothalamus lead to hyperphagia (2) and obesity, while lesions in the lateral hypothalamus Impair the appetite response and lead to death by starvation Neuropeptrdes that stimulate appetite such as NPY (3) and galamn, as well as neuropeptides that suppress appetite such as CRF (4), CCK (5), and GLP-1 (6) have been identified However, understanding of the control of appetite remains incomplete A key signal from the periphery, leptm, a hormone made m fat that regulates hypothalamic function, was only recently identified (7) While NPY is a potent stimulator of eating behavior, the NPY knockout mouse (8) exhibits a normal feeding phenotype, indicating that other factors are involved in the strmulatron of hunger One approach to the elucidation of the molecular mechanisms that contribute to hypothalamic dysfunction m obesity is to identify mRNAs that are abnormally regulated Such studies are difficult because hypothalamic tissue is scarce (a mouse hypothalamus weighs 8-10 mg and yields 8-10 pg of total RNA) We utilized the reverse transcription (RT) polymerase chain reaction (PCR) differential display to attempt to identify abnormally regulated mRNAs We examined differential expression in the Mob mouse model These mice are markedly obese as the result of a spontaneous mutation in the leptm gene, which leads to the msertron of a stop codon in the coding sequence Leptm IS a From Methock m Molecular Bfology, Vol 85 DffferenM Edited by P Llang and A B Pardee Humana 297 Dfsplay Methods and Protocols Press Inc , Totowa, NJ Maratos-Flier, 298 Qu, and Gammeltoft hormone made and secreted by fat Homozygous mice make no leptm and, m addition to obesity, have impaired nonshivering thermogenesis, decreased motor activity, and are infertile Whereas the identification of leptm identified the precise mutation responsible for the ob/ob syndrome, all the physiologic consequences of leptm absence are still not understood In addttion, the complete spectrum of hypothalamic dysregulation that results from leptm de% ciency is unknown Recent studies suggest that leptm has a range of actions on the hypothalamus that are important m the neuroendocrme response to starvation (9) Hence identification of differentially expressed transcripts in the obese mice might provide insight into the pathogenesis of the obese state Materials 2.1 Preparation of Hypothalamic Total RNA Preparatton of the mice a Obtain from Jackson laboratortes (Bar Harbor, ME) and house for d after arrtval b Keep on a normal day-night cycle and use m the morning shortly after the start of the light cycle c Anesthetize with 200 mg/kg sodmm amytal and decapitate Preparation of hypothalamtc RNA a Remove the brain and excise the hypothalamus b Pool hypothalami from 10 ob/ob and 10 ob/+ mice (weight of each pool -100 mg) c Extract total RNA using RNAzol (Cinna/Btotex Laboratories, Houston, TX) d Assess quality of RNA by agarose gel electrophorests and ethydmm bromide staining 2.2 Primers Obtain primers from a commercial vendor (e g , Ohgos) Perform all reactions with one unique anchored and one unique downstream primer, i.e , degenerate groups of prtmers were not utihzed Utilize arbitrary primers, 1.e , CAGGCCCTTC, TGCCGACTCTG, AGTCACTCCAC, AATCGGGCTG, GGTCCCTGAC, GAAACGGGTG, GTGACGTAGG,GGGTAACGCC,GTGATCGCCAG,CAATCGCCGT, TCGGCGATAG, CAGCACCCAC, TCTGTGCTGG, TTCCGAACCC, AGCCAGCGAA, GACCGCTTGT, AGGTGACCGT, CAAACGTCGG, GTTGCGATCC (Dr George Kmg suggested the sequence for these primers ) 2.3 cDNA Synthesis Synthesize cDNA using M-MLV reverse transcrtptase (Superscript RNAase H reverse Transcrtptase, Gibco-BRL, Grand Island, NY) and one of nme anchored primers Gene Expression Analysis 299 in Mice Utilize anchored primers T,,VV where V 1s A, C, or G Generate each set of cDNAs m differential display with 20 upstream arbitrary decamers, for a total of 180 reactlons Perform reactions in the followmg mixture: 1.O w T,,VV, 20.0 w each dNTP, OIMDTT, 50 mMTrls PH 8.3,75 mA4KC1, mMMgCl* Methods PCR reactions were performed, with few modifications, as previously described (IO,ll) 3.1 DNAase Digestion of RNA DNAase digestion mixture (final concentration m 50 J.IL): 0.2 U/pL RNase Inhibitor, 10 mA4Trls pH 3,50 mMKC1, 1.5 mMMgCl,, 001% gelatin (w/v), 0.48 U/pL DNase (Boehringer-Mannheim, Chlcago, IL) I diluted m 0.1X TE Add 42 5-pg ahquots of total RNA to the DNase I digestion mixture Incubate the mixture at 37°C for 30 mm Followmg the digestlon, extract the mixture with phenollCHC13 and precipitate the RNA from the aqueous phase by the addition of vol of absolute ethanol and l/10 vol of sodium acetate Chill the mixture for 30 mm at -20°C and then centrifuge for mm in a refngerated microfuge at maximum speed 3.2 cDNA Synthesis Synthesize cDNA by RT by adding total mRNA obtained from the DNAase digestion to the cDNA synthesis mixture at a final concentration of 0.01 pg/p.L RNA Incubate the samples for mm at 65°C and then for 10 mm at 37°C Add 10 U/pL RT to each reaction and samples and incubate for another 60 mm at 37°C followed by a 5-mm incubation at 95°C 3.3 PCR Amplification Amplify the cDNAs generated from the RT reactlon using an AmpliTaq DNA Polymerase (Perkm Elmer, Foster City, CA) or similar equipment Perform 25 cycles consisting of 30 s at 94”C, at 40°C, and 30 s at 72°C 10 Label PCR products using 35S-dATP (NEN, Boston, MA) 11 PCR reaction (25 $) 10 mA4 Tris pH 8.3, 50 mA4 KCl, mA4 MgC&, 0.001% gelatin (weight for volume, Sigma), w dNTP, 0.2 @4 upstream primer, pA4 T,,VV, 10 % v/v Reverse transcrlptase mix, 0.50 pCl/& S35-dATP, 0.05 U/pL AmphTaq (1 25 U Total) 3.4 Evaluation and Selection of Differentially 12 Separate resulting DNAs (from the PCR amplification) denaturmg condltlons Expressed Bands on sequencing gels under Mara tos- Flier, Qu, and Gammeltoft 300 13 Dry gels and expose to Kodak X-OMAT AR film (Eastman Kodak) for to d Compare DNA fragments from ob/ob and ob/+ mice 14 When a primer pan yields bands umque to either mouse, reperform the reacttons and reanalyze using fresh cDNA dertved from a second RT reaction If the unique band appears on the second reaction, excise it from the dried gel and extract the DNA by botlmg m TE buffer and precipitating with ethanol using mussel glycogen (Boehrmger-Mannhelm) as a carrier 15 Reamplify the DNA from each band using the same set of primers and the same thermal cycling conditions Run the resulting reaction products on an agarose gel, stam with ethydium bromide, and elute from the gel 16 Ligate the DNA mto the PCR- plasmid (InVnrogen) and sequence the reactions using both Ml 3R and -2 lM13F This determines both sequence and orientation of the insert 3.5 Confirmation of Differential Expression 17 Use Sp6 or T7 promoter to generate a riboprobe (dependmg on nature of band) 18 Confirm altered expression of the band of interest usmg either Northern blot analysts or rtbonuclease protectton assay 19 Subject 20 pg of total RNA from either ob/+ or ob/ob hypothalamus to agarose gel electrophoresis and transfer to nylon 20 Prehybridize blots for h at 58’C After addition of probe filters, continue hybrtdization at the same temperature overnight Wash filters with 2X SSC, 0.1% SDS at room temperature for 10 mm and then wash once with 1X SSC, 0.1% SDS at 60°C for 10 mm 22 Repeat the sequence of washes for a total of three times An-dry the blots and expose either to Kodak X-OMAT film or analysis using a Molecular Dynamics Phosphorimager 3.6 Examples of Use Display reactions with 180 primer pairs yielded 52 DNA bands that appeared to be differentially expressed on at least two separate reactions Of these, 35 were further evaluated by either Northern blot analysis or rrbonuclease protection assay Differential expression was confirmed m only SIX bands, while no difference in expression was seen with 20 bands No signal could be detected in nine bands Of the six bands that were differentially expressed, one represented a 453-base fragment of Melanin Concentratmg Hormone (MCH) (Fig l), which contained the coding region of MCH and two other expressed neuropeptides, N-E1 and N-GE Thrs fragment was used to confirm altered expression in ob/ob, ob/+, and wild-type +/+ animals (Fig 2); in addition, differences in expression m fasted and fed animals were examined Expression of melanin-concentrating hormone was increased twofold in ob/ob ammals when compared to control animals Expression of MCH mRNA increased approximately threefold after fasting, m Gene Expression Analysis in Mice 301 Fig PCR differential display on RNA from the hypothalamus of ob/+ and ob/ob mice YT,*AC-3’ as the arbitrary primer and S-AATCGGGCTG-3’ as the arbitrary primer Candidate band, which proved to have the sequence of melanin-concentrating hormone is indicated by the arrow (reprinted with permission from ref 15) both normal and obese animals This difference was similar to differences in the expression of another neuropeptide, NPY This neuropeptide is known to play an important role in feeding behavior To confirm that MCH was involved in feeding behavior, we injected peptide (purchased from Bachem, Switzerland) into the lateral ventricles of LongEvans rats Rats injected with a single bolus of pg of MCH acutely consumed two- to threefold more food than rats injected with artificial CSF only (Fig 3) Melanin-concentrating hormone was originally isolated from chum salmon pituitaries in 1983 (12) and was found to be a hormone of 17 amino acids that induced aggregation of melanosomes in fish melanophores Mammalian MCH was identified in 1989 using traditional peptide isolation techniques Rat MCH was purified by affinity chromatography using anti-salmon-MCH antibodies (13) Rat MCH is a 19 amino acid peptide that is highly homologous to fish 302 Maratos-Flier, Qu, and Gammeltoft Fig Northern blot of hypothalamic RNA from +/+, ob/+ and ob/ob animals in the fed and fasted state 20 pg of total RNA was loaded onto each band and blots were probed with a riboprobe made against either MCH or NPY mRNA (reprinted with permission from ref 15) MCI-I Subsequently, it was shown that mouse MCH and human MCH are identical to rat MCH In mammals, MCH is expressed in the lateral hypothalamus and the zona incerta, and does not circulate Expression outside the CNS, if it occurs, occurs at very low levels MCH neurons project to the median eminence and directly to frontal cortex The distribution of neurons projecting to frontal cortex is interesting and suggested that MCH was involved in the regulation of goal-oriented behaviors such as food intake or possibly general arousal (14) The role of MCH in mammalian physiology remained obscure until our observation of increased expression of MCH mRNA in the ob/ob mouse (15) This finding, coupled with the finding of increased expression following fasting in both normal and ob/ob mice, led to the speculation that MCH might be involved in the regulation of eating behavior This hypothesis was confirmed in experiments in which it was shown that MCH injected into the lateral ventricles of rats induced increased eating The identification of MCH as a potential regulator of neuroendocrine aspects of obesity resulted from differential display screening Current experiments are focused on defining other actions relevant to nutritional homeostasis as well as the interaction of MCH and other central regulators of energy balance Gene Expression Analysis in Mice 303 y!/r,,#, 0123456 Time (Hours) on Fig Effect of ug of MCH (gray diamond) given mtracerebroventrtcularly chow consumptton in rats Control rats (black squares) recetved an inJection of artificial cerebrospinal fluid *p = 0077, **p = 012 Notes For PCR amplrfication the reaction vials were kept on ice at 4°C while reactants were added This was important for obtammg reproducible display gels In addition, the upstream primer was always added next to last, after the addition of the AmpliTaq and prtor to the addition of the S35-dATP References Flier, J S (1995) The adrpocyte* Storage depot or node on the energy mformatton superhighway Cell 8, 15-18 Brobeck, J R (1946) Mechanisms of development of obestty in animals with hypothalamic lesions Physzol Rev 256,54 Stanley, B G., Anderson, K C , Grayson, M H , and Lerbowttz, S F (1989) Repeated hypothalamic stimulation with neuropeptrde Y increases dally carbohydrate and fat intake and body weight gain in female rats Physzol Behav 46, 173-177 Hemrrchs, S C , Manzaghr, F , Ptch, E M., Hauger, R L., and Koob, G F (1993) Cortrcotropin releasing factor m the paraventrtcular nucleus modulates feeding induced by neuropepttde Y Brain Res 611, 18-24 304 Maratos- Flier, Qu, and Gammeltoft Baile, C A , McLaughlin, C L., and Della-Ferra, M A (1986) Role of cholecystokinm and oprod peptide m control of food Intake Physrol Rev 66, 172-234 Turton, M D , O’Shea, D., Gunn, I., Beak, S A , Edwards, C M B , Meeran, K., Chow, S J , Taylor, G M., Heath, M M , Lambert, P D , Wilding, J P H., Smith, D M., Ghatel, M A., Herbert, J M., and Bloom, S R (1996) A role for glucagon-like pepttde-l m the central regulation of feeding Nature 379, 69-72 Zhang, Y ,, Proenca, R , Maffer, M , Barone, M , Leopold, L , and Frredman, J M (1994) Posmonal clonmg of the mouse obese gene and its human homologue Nature 372,425-432 Errckson, J C., Clegg, K E , and Palmrter, R D (1996) Sensmvrty to leptin and susceptrbllny to seizures of mice lacking neuropeptrde Y Nature 381,4 15-4 18 Ahrma, R S., Prabakaran, D., Mantzoros, C S., Qu, D , Lowell, B B , Maratos-Flier, E , and Flier, J S (1996) Role of leptm m the neuroendocnne response to fastmg Nature 382,250-252 10 Lrang, P and Pardee, A B (1992) Differential display of eukaryottc messenger RNA by means of the polymerase chain reactton Sczence 257,967-97 11 Atello, L P , Robmson G S., Lm, Y W , Ntshto, Y., and King, G L (1994) Identificatton of multiple genes m bovine retinal pertcytes altered by exposure to elevated levels of glucose by using mRNA differential display Proc Nutl Acad Scl USA 91,623 l-6235 12 Kawauchi, H , Kawazoe, I., Tsubokawa, M , Klshida, M , and Baker, B I (1983) Charactertzatron of melanin-concentratmg hormone m chum salmon prtuitartes Nature 305,321-323 13 Vaughan, J M , Fisher, W H , Hogar, C., Rtvrer, J., and Vale, W (1989) Characterization of melanin concentrating hormone from rat hypothalamus Endocnnology 125, 1660-1665 14 Nahon, J L (1994) The melanm concentratmg hormone: From the peptide to the gene Cut Rev Neurobzol 864,221-262 15 Qu, D., Ludwig, D S , Gammeltoft, S , Piper, M., Pelleymounter, M A , Cullen, M J , Mathes, W F , Przypek, J., Kanarek, R , and Maratos-Flier, E (1996) A role for melanm-concentrating hormone in the central regulatton of feeding behavior Nature 380,243-247 ... to be sampled, From Methods m Molecular Bfology, Vol 85 D/fferent/a/ Edited by P Llang and A B Pardee Humana 13 Display Methods and Protocols Press Inc , Totowa, NJ 14 McClelland et al including... Education, Science, Sports and Culture of Japan and those from Science and Technology Agency of Japan /to and Sakaki 44 References Ltang, P and Pardee, A B (1992) Differential display of eukaryottc... , and McClelland, M (1992) Arbitrarily primed PCR fingerprintmg of RNA Nuclezc Acid Res 20, 4965-4970 McClelland M , Mathteu-Daude F , and Welsh, J (1995) RNA fingerprintmg and differential display