cytokines and colony stimulating factors

HUMANA PRESS Methods in Molecular Biology TM Edited by Dieter Körholz Wieland Kiess Cytokines and Colony Stimulating Factors Methods and Protocols HUMANA PRESS Methods in Molecular Biology TM Cytokines and Colony Stimulating Factors Methods and Protocols Edited by Dieter Körholz Wieland Kiess VOLUME 215 Immunodefi ciencies and Cytokines 3 3 From: Methods in Molecular Biology, vol. 215: Cytokines and Colony Stimulating Factors: Methods and Protocols Edited by: D. Körholz and W. Kiess © Humana Press Inc., Totowa, NJ 1 Primary Immunodeficiencies Caused by Defects of Cytokines and Cytokine Receptors Volker Wahn 1. Introduction The immune system responds to antigenic stimulation with a complex array of molecular events involving antigen-presenting cells, B-cells, T-cells, and phagocytes. Cytokines and their respective receptors are intimately involved in regulating such immune responses. Their pivotal role can be illustrated in animal models for which certain cytokines or their receptors have been deleted. It is beyond the scope of this review to discuss our knowledge on growth factor or receptor deficiencies derived from animal models. I would rather like to focus on observations in children with selective molecular defects. For example, pulmonary alveolar proteinosis in some patients has been found to be associated with mutations in the genes for granulocyte macrophage–colony- stimulating factor (GM-CSF) receptor `-chain, which is shared with receptors for interleukin (IL)-3 and IL-5. Certainly, in the future we should be aware of further pathogenic mutations in humans that, to date, have been demonstrated in experimental animals only. The majority of mutations in cytokine or cytokine receptor genes result in inherited immunodeficiencies. Our current knowledge on such disorders, therefore, will be summarized. 2. Interleukin-1 There is one report on defective IL-1 production associated with immuno- deficiency with some evidence of familiality (1). The siblings described 4 Wahn suffered from fungal infections similar to patients with chronic mucocutaneous candidiasis and from bacterial infections. Monocytes of the two patients once stimulated in culture with either lipopolysaccharide (LPS) or silica produced <1% of IL-1 compared with either normal cells or cells from patients with other immunodeficiencies. Appropriate studies on the DNA level were not performed to date and the molecular basis of this deficiency remains to be elucidated. 2.1. IL-1 Receptor The first report on a possible abnormality of the IL-1 receptor probably comes from Chu et al. (2). A 10-yr-old boy with recurrent infections had a normal B- and T-cell phenotype and normal immunoglobulins. His cells in vitro had a diminished response to mitogens and an absent response to antigens. IL-1 production was normal. T-Cell blasts from the patient were unable to absorb out IL-1 activity from an IL-1 preparation that may possibly be explained by the absence of the receptor or a molecular alteration within the receptor. Another report in the literature describes a 15-yr-old girl with recurrent bacterial infections whose cells did not produce tumor necrosis factor (TNF) upon stimulation with several stimuli including IL-1 (3). The molecular defect was assumed to be localized early in the signal transduction pathway, not necessarily in the receptor; however, appropriate studies to identify the defect on the molecular level were not performed. So, to date, information on IL-1 receptor deficiencies are restricted to those derived from IL-1 receptor knockout mice and have no real correlate in humans yet. 2.2. Interleukin-2 Two types of primary IL-2 deficiency should be distinguished: selective IL-2 deficiency and IL-2 deficiency as part of multiple cytokine deficiency. Both will be discussed separately. 2.2.1. Selective IL-2 Defi ciency Weinberg and Parkman (4) reported on a male infant with T+B+ SCID. IL-2 production was markedly deficient. mRNA encoding interferon (IFN)-a was present at normal amounts, whereas that encoding IL-2 was completely absent. On the DNA level, no defects related to structural genes or the promotor or enhancer region could be identified. Bone marrow transplantation (BMT) was attempted, but the child died as a result of hemorrhagic pancreatitis. A similar case has been published with mainly similar findings (5). Further cases with analogous findings have been published thereafter. Remarkable may be the case of Sorensen et al. (6) because the boy they Immunodefi ciencies and Cytokines 5 described was 15 yr of age at diagnosis. The molecular basis for absent IL-2 synthesis in all these cases is still unclear. 2.2.2. Multiple Lymphokine Defi ciency Pahwa et al. (7) described a with T+B+ SCID whose cells were unable to secrete appropriate amounts of IL-2 in response to cellular stimulation. Other cytokines were initially not measured. Two attempts to correct SCID by bone marrow transplantation failed, but the child responded well to in vivo administration of recombinant IL-2. This child was further studied by Chatila et al. (8). The authors found that in addition to IL-2, the synthesis of IL-3, IL-4, and IL-5 was grossly deficient, and IFN-a was secreted at moderately decreased amounts. GM-CSF was produced at normal levels. In 1993, the same group presented the molecular basis of this defect (9): Nuclear factor of activated T-cells (NF-AT) did not appropriately bind to both its response element in the IL-2 enhancer and an NF-AT-like response element in the IL-4 enhancer. To date, however, no mutation has been reported explaining this phenomenon. 2.3. IL-2 Receptor The structure and function of the receptor is briefly summarized in Fig. 1. It is composed of an _-chain (CD25), a `-chain (CD122), and a a-chain Fig. 1. After binding of IL-2 to IL-2R JAK1 associates with the `-chain and JAK3 is constitutively associated with ac. Next, tyrosine phosphorylation occurs in both JAKs and IL-2R` before STAT5 is activated (phosphorylated), dimerized, and transferred to the nucleus, where it can bind to DNA at the appropriate site. 6 Wahn (CD132) shared by many interleukin receptors (IL-4, IL-7, IL-9, IL-15) and is thus called common a-chain. Deficiencies of all three receptor chains have been identified in humans. 2.3.1. IL-2 Receptor _-Chain Defi ciency This disorder was first reported by Sharfe et al. (10). The affected patient presented with cytomegalovirus (CMV) pneumonitis, oral thrush and candida esophagitis. He had low normal numbers of T-cells but normal B-cell function. Mitogen stimulation was low and could not be increased by the addition of IL-2. There was an excessive T-cell infiltration of several organs accompanied by tissue atrophy and inflammation. The child was successfully treated by BMT. The molecular basis was a truncation mutation of CD25. As a consequence of this mutation, apoptosis in the thymus was decreased, which might impair negative selection (11). Autoreactive T-cell clones may leave the thymus and infiltrate tissues as a sort of an autoimmune process. 2.3.2. IL-2 Receptor/IL-15 Receptor `-Chain Defi ciency Interleukin-15 is essential for natural killer (NK) cell development. Gilmour et al. (12) reported a male infant born to nonconsanguinous parents with a typi- cal history for SCID. Surface marker analysis revealed the phenotype: T low, B+, and NK–. ac and JAK3 were normal, indicating a new molecular defect. Almost no JAK3 phosphorylation could be observed upon IL-2 stimulation. The explanation came from studies of the `-chain because almost no expression of `-chain mRNA and protein could be found. Familiality of the defect, however, was not established. 2.3.3. IL-2 Receptor a-Chain Defi ciency (X-Linked SCID) The disease must be suspected in all boys with T–B+ SCID (13). In the meantime, far more than 100 children have been analyzed on the molecular level. As a result, a large database is now available that gives an overview of the type and frequency of known mutations (14). The disease is of special interest because it is the first human disease that seems to have been cured by gene therapy (see Chapter 19). 2.3.4. Combined IL-2 and IL-2 Receptor Defi ciency So far, there is only one report on this deficiency, that by Doi et al. (15). The authors described a child with combined immunodeficiency (ID) whose cells in vitro did not respond to T-cell mitogens, did not produce IL-2, and did not express the IL-2R. The brother of the child seemed to have died of the same disease, giving some evidence of familiality. DNA coding regions for IL-2 Immunodefi ciencies and Cytokines 7 and IL-2R were found to be normal but no mRNA could be found, indicating a transcriptional problem. 2.4. IL-4 Receptor Mutations within genes encoding this receptor have been associated with hyper-IgE syndrome in some patients. However, because these observations are still a matter of controversial debate, they will not be discussed here. 2.5. IL-7 Receptor The receptor is composed of two chains, one of which is the ac chain mentioned earlier, the other is the IL-7R_ chain. Like the IL-2R, they are linked to JAK3 and JAK1, respectively, and transmit signals to the nucleus using STAT5 and other pathways (16). Signals contribute to recombination events of T-cell receptor genes. Once Puel et al. studied the IL-7 receptor in Epstein–Barr-virus (EBV)- transformed cell lines of children with T–B+NK+ SCID (17), they identified two subjects with specific mutations: One had a splice-junction acceptor mutation on one strand (intron 4) and the other strand had a nonsense mutation with a premature stop codon (exon 5). Acting in concert these mutations prevented production of a functional IL-7R_ protein. The second patient had a two-amino-acid change in the extracellular domain of the IL-7R_ chain, both of which turned out to be a common polymorphism. A further splice mutation, however, was responsible for absence of the IL-7R_ chain. Treatment consisted of BMT. 2.6. Interleukin-12 Interleukin-12 is one of the major cytokines stimulating production of IFN-a. It is produced by antigen-presenting cells upon activation and stimulates NK cells and T-cells (Fig. 2). Absence of IL-12 results in diminished or absent production of IFN-a, which, in turn, is responsible for increased susceptibility to mycobacterial and other infections. The first report on defective IL-12 production in familial disseminated mycobacterial infection (Myobacterium avium) comes from Frucht and Hol- land (18). The authors showed in three affected family members that patient monocytes did not appropriately produce IL-12, which uses responsible for defi cient production of IFN-a synthesis. In vitro IFN-a synthesis could be initiated by addition of exogenous IL-12, indicating integrity of the IL-12 receptor. In vivo patients were successfully treated with IFN-a. The genetic basis of abnormal IL-12 synthesis in this family has not been studied so far. 8 Wahn Such studies were accomplished by Altare et al. (19) in a child with Bacille–Calmette–Guérin (BCG) and Salmonella enteritidis-disseminated infection. The authors found a large homocygous deletion within the p40- subunit gene precluding expression of functional IL-12 p70 cytokine expres- sion. In vitro complementation of the cells with a wild-type IL-12 p40 gene restored IL-12 and, in turn, IFN-a production. 2.6.1. IL-12 Receptor The receptor is a heterodimer consisting of a `1-chain and a `2-chain. In 1998, complete IL-12R`1 deficiency was described by two groups in several children with disseminated other mycobacterial (BCG, non-tuberculous [NTM]) and Salmonella infections. All patients were homocygous for recessive mutations (20). As the receptor is expressed on the cell surface, the diagnosis can be established by flow cytometry. Treatment may consist of parenteral administration of IFN-a. An international registry was established to collect all information on the spectrum of these abnormalities. 2.7. Interferon-a There are some reports in the literature on cases and families with impaired production of IFN-a (21) in association with atypical mycobacterial infections or cryptosporidiosis. Unfortunately, no data on the IL-12 system were presented and it seems likely that these cases, upon reinvestigation, will turn out as being IL-12 or IL-12R deficient. Fig. 2. Induction of IFN-a by mycobacteria. (From ref. 20.) Immunodefi ciencies and Cytokines 9 2.7.1. Interferon-a Receptor Interferon-a can exert its effects only if its receptor is functional. This receptor is a heterodimer that is tetramerized following binding of IFN-a. In patients with inappropriate receptor function, the most impressive clinical finding is the increased susceptibility to mainly mycobacterial (BCG, NTM) and, to a lesser extent, Salmonella infections. With regard to congenital immunodeficiencies, five subtypes must be differentiated (22). 2.7.2. Complete Recessive IFN-aR1 Defi ciency This disease must be suspected in very young children with severe BCG or NTM infections, especially if the granulomas formed are lepromatous rather than tuberculous. The diagnosis can be suspected by flow cytometry (absence of CD119 on monocytes). Definitive diagnosis is established on the genetic level by studies of the IFNGR1 gene. Treatment consists of bone marrow transplantation in the absence of active mycobacterial disease. 2.7.3. Complete Recessive IFN-aR2 Defi ciency Clinical aspects in the only decribed patient did not differ from those in other deficiencies. The disease must be suspected if patients cells in vitro do not respond to high concentrations of IFN-a. A reliable diagnosis can only be made if the IFNGR2 exons and flanking intron regions are sequenced. 2.7.4. Partial Recessive IFN-aR1 Defi ciency There are no specific clinical aspects in this disease. In vitro cells from children do respond in vitro, in contrast to complete deficiency, to high concentrations of IFN-a, and the authors suspected that the missense mutation found in the IFNGR1 gene reduces the affinity of the encoded receptor to its ligand. IFN-a binds to the R1 chain. Another finding specific for this variant was mature granulomas, in contrast to the complete deficiency, where mature granulomas are never observed. Definitive diagnosis can only be established by sequencing of the gene. High doses of IFN-a in vivo may provide improved control of mycobacteria. 2.7.5. Partial Recessive IFN-aR2 Defi ciency In the single described 20-yr-old patient, the receptor seemed to be weakly expressed on the cell surface by flow-cytometric studies. A missense mutation was responsible for the functional receptor defect. In vitro STAT1 translocation and HLA-DR expression following stimulation was impaired but could be detected. In vivo, the patient seemed to benefit from IFN-a therapy. 10 Wahn 2.7.6. Partial Dominant IFN-aR1 Defi ciency The basis for this disease, which has been found in currently 18 patients, is a heterozygous frame-shift small deletion in exon 6. The mutant alleles encode a truncated receptor with no more than five intracellular amino acids. The receptor can bind IFN-a normally and dimerize normally, but it is unable to transduce intracellular signals. The diagnosis is made by appropriate genetic studies. In vitro, high doses of IFN-a can trigger cellular responses. In vivo, some patients respond to administration of IFN-a. 3. Notes Inherited deficiencies of cytokines and their respective receptors are the human equivalent to corresponding knockout mice. Several such deficiencies have already been found and experiments of nature improved our understanding of molecular events. With now 23 interleukins and many other cytokines already defined we have to expect that more disorders can be found where genetic disturbances of these systems are involved. 4. Note Added in Proof Updated information may be relevant and should be mentioned. First, a second cause for multiple cytokine deficiency could be identified in two siblings (23). Its molecular basis seems to be defective nuclear NF-AT translocation, leading to the same biological effect as did defective NF-AT binding to its enhancer. Second, more molecular variants leading to increased susceptibility to mycobacterial infections have been described (24). For those interested in this field, reading these two publications is highly recommended. References 1. Komiyama, A., Ichikawa, M., Kanda, H., Aoyama K., Yasui, K., Yamazaki, M., Kawai, H., et al. (1988) Defective interleukin-1 production in a familial monocyte disorder with acombined abnormality of mobility and phagocytosis-killing. Clin. Exp. Immunol. 73, 500–504. 2. Chu, E. T., Rosenwasser, L. J., Dinarello, C. A., Rosen, F. S., and Geha, R. S. (1984) Immunodeficiency with defective T-cell response to interleukin 1. Proc. Natl. Acad. Sci. USA 81, 4945–4949. 3. Kuhns, D. B., Long Priel, D. A., and Gallin, J. I. (1997) Endotoxin and IL-1 hyporesponsiveness in a patient with recurrent bacterial infections. J. Immunol. 158, 3959–3964. 4. Weinberg, K. and Parkman, R. (1990) Severe combined immunodeficeincy due to a specific defect in the production of interleukin-2. N. Engl. J. Med. 322, 1718–1723. Immunodefi ciencies and Cytokines 11 5. Disanto, J. P., Keever, C. A., Small, T. N., Nichols, G. L., O’Reilly, R. J., and Flomenberg, N. (1990) Absence of interleukin 2 production in a severe combined immunodeficiency disease syndrome with T cells. J. Exp. Med. 171, 1697–1704. 6. Sorensen, R. U., Boehm, K. D., Kaplan, D., and Berger, M. (1992) Cryptococcal osteomyelitis and cellular immunodeficiency associated with interleukin-2 defi - ciency. J. Pediatr. 121, 873–879. 7. Pahwa, R., Chatila, T., Pahwa, S., Paradise, C., Day, N. K., Geha, R., et al. (1989) Recombinant interleukin 2 therapy in severe combined immunodeficiency disease. Proc. Natl. Acad. Sci. USA 86, 5069–5073. 8. Chatila, T., Castigli, E., Pahwa, R., Pahwa, S., Chirmule, N., Oyaizu, N., et al. (1990) Primary combined immunodeficiency resulting from defective tran- scription of multiple T-cell lymphokine genes. Proc. Natl. Acad. Sci. USA 87, 10,033–10,037. 9. Castigli, E., Pahwa, R., Good, R. A., Geha, R. S., and Chatila, T. A. (1993) Molecular basis of a multiple lymphokine deficiency in a patient with severe combined immunodeficiency. Proc. Natl. Acad. Sci. USA 90, 4728–4732. 10. Sharfe, N., Dadi, H. K., Shahar, M., and Roifman, C. M. (1997) Human disorder arising from mutation of the alpha chain of the interleukin-2 receptor. Proc. Natl. Acad. Sci. USA 94, 3168–3171. 11. Roifman, C. M. (2000) Human IL-2 receptor _ chain deficiency. Pediat. Res. 48, 6–11. 12. Gilmour, K. C., Fujii, H., Cranston, T., Davies, E. G., Kinnon, C., and Gaspar, H. B. (2001) Defective expression of the interleukin-2/interleukin-15 receptor beta subunit leads to a natural killer cell-deficient form of severe combined immunodeficiency. Blood 98, 877–879. 13. Uribe, L. and Weinberg, K. I. (1998) X-linked SCID and other defects of cytokine pathways. Semin. Hematol. 35, 299–309. 14. Puck, J. M. (1996) IL2Rgbase: a database of ac-chain defects causing human X-SCID. Immunol. Today 17, 507–511. 15. Doi, S., Saiki, O., Tanaka, T., Ha-Kawa, K., Igarashi, T., Fujita, T., et al. (1988) Cellular and genetic analyses of IL-2 production and IL-2 receptor expression in a patient with familial T-cell-dominant immunodefi ciency. Clin. Immunol. Immunopathol. 46, 24–36. 16. Puel, A. and Leonard, W. J. (2000) Interleukin-7 receptor _ chain-dependent signalling is required for T-cell development. Immunol. Allergy Clin. North Am. 20, 51–63. 17. Puel, A., Ziegler, S. F., Buckley, R. H., and Leonard, W. J. (1998) Defective IL-7R expression in T–B+NK+ severe combined immunodeficiency. Nat. Genet. 20, 394–397. 18. Frucht, D. M. and Holland, S. M. (1996) Defective monocyte costimulation for IFN-a production in familial disseminated Mycobacterium avium complex infection. J. Immunol. 157, 411–416. 19. Altare, F., Lamms, D., Revy, P., Jouanguy, E., Döffinger, R., Lamhamedi, S., et al. (1998) Inherited interleukin 12 deficiency in a child with Bacille–Calmette– [...]... vol 215: Cytokines and Colony Stimulating Factors: Methods and Protocols Edited by: D Körholz and W Kiess © Humana Press Inc., Totowa, NJ 15 16 Banning and Körholz stimulated cells have to be treated with Monensin or Brefeldin A to prevent the secretion of the produced proteins (13–15) T-cells play an important role in the immune system (16) T-cell-derived cytokines control pro-inflammatory and anti-inflammatory... Biology, vol 215: Cytokines and Colony Stimulating Factors: Methods and Protocols Edited by: D Körholz and W Kiess © Humana Press Inc., Totowa, NJ 23 24 Krutmann, Mang, and Grether-Beck be used to analyze or determine the presence of specific DNA targets or, after a reverse transcription step, to amplifying RNA sequences as DNA copies (RT-PCR) RT-PCR is a sensitive analytical method and is a suitable... Contreras, M., and Navarrete, C (1998) Intracellular cytokine profile of cord and adult blood lymphocytes Blood 92, 11 Mosmann, T R and Sad, S (1996) The expanding universe of T-cell subsets: Th1, Th2 and more Immunol Today 17, 138–145 Jung, T., Lack, G., Schauer, U., Uberruck, W., Renz, H., and Gelfand, E W (1995) Allergens, IgE, mediators, inflammatory mechanisms Decreased frequency of interferon and interleukin-2-producing... Cytokine Handbook, 3rd ed Academic, New York 11 Schroff, R W., Bucana, C D., Klein, R A., Farrell, M M., and Morgan, A C., Jr (1984) Detection of intracytoplasmic antigens by flow cytometry J Immunol Methods 70, 167 12 Jacob, M C., Favre, M., and Bensa, J C (1991) Membrane cell permeabilization with saponin and multiparametric analysis by flow cytometry Cytometry 12, 550 13 Sander, B., Andersson, J., and Andersson,... B., Andersson, J., and Andersson, U (1993) Assessment of cytokines by immunofluorescence and the paraformaldehyde-saponin procedure Immunol Rev 119, 65–93 3 Schauer, U., Jung, T., Krug, N., and Frew, A (1996) Measurement of intracellular cytokines Immunol Today 17, 305–306 4 Tartakoff, A M (1983) Perturbation of vesicular traffic with the carboxylic ionophore monensin Cell 32, 1026–1028 5 Prussin, C and. .. cytokine- and chemokinespecific as well as surface antigen-specific fluorochrome-conjugated antibodies that allow cytokine detection directly at the single-cell level by flow cytometry (see Note 1) Up to now, studies investigating intracytoplasmic cytokines focused primarily on T-lymphocytes The method introduced allows the From: Methods in Molecular Biology, vol 215: Cytokines and Colony Stimulating Factors: ... Williams, N A (2001) Cell identification and isolation on the basis of cytokine secretion: a novel tool for investigating immune responses Nat Med 7, 373–376 13 Sander, B., Höiden, I., Andersson, U., Möller, E., and Abrams, J S (1993) Similar frequencies and kinetics of cytokine producing cells in murine peripheral blood and spleen Cytokine detection by immunoassay and intracellular immunostaining J Immunol... Gynkotek, Germering, Germany) consisting of a pump (M-480), an injector (GINA 50), an UV detector (UV-160S), and a reservoir of mobile phases (buffer A: 1 M NaCl and 25 mM Tris-HCl [pH 9.0]; buffer B: 25 mM Tris/HCl [pH 9.0]) Cytokines in the Skin 25 Table 1 Primer Pairs Specific for Cytokines and -Actin (Cytokinesequence 5 –3 ) Cytokine primer Primer sequence Interferon- AGTTATATCTTGGCTTTTCA ACCGAATAATTAGTCAGCTT... U (1991) Assessment of cytokines by immunofluorescence and paraformaldehyde-saponin procedure Immunol Rev 119, 65 14 Verheyen, J., Bönig, H., Kim, Y M., Banning, U., Mauz-Körholz, C., Kramm, C., et al (2000) Regulation of interleukin-2 induced interleukin-5 and interleukin-13 22 15 16 17 18 19 20 21 Banning and Körholz production in human peripheral blood mononuclear cells Scand J Immunol 51, 45 Chalmers,... parameters, including cell size and granularity, as well as the coexpressed levels of surface and intracellular markers defined by fluorescent antibodies After stimulation of cells in whole-blood culture, cells are stabilized and permeabilized to allow monoclonal antibodies penetrating through cell membranes, the cytosol, and the membranes of the endoplasmatic reticulum and Golgi complex Paraformaldehyde . Körholz Wieland Kiess Cytokines and Colony Stimulating Factors Methods and Protocols HUMANA PRESS Methods in Molecular Biology TM Cytokines and Colony Stimulating Factors Methods and Protocols Edited. Körholz Wieland Kiess VOLUME 215 Immunodefi ciencies and Cytokines 3 3 From: Methods in Molecular Biology, vol. 215: Cytokines and Colony Stimulating Factors: Methods and Protocols Edited by: D. Körholz and. 581–620. Intracellular Detection of T-Cell Cytokines 15 15 From: Methods in Molecular Biology, vol. 215: Cytokines and Colony Stimulating Factors: Methods and Protocols Edited by: D. Körholz and W. Kiess © Humana