cdna library protocols

1 cDNA Library Construction from Small Amounts of RNA Using Paramagnetic Beads and PCR Kris N. Lambert and Valerie M. Williamson 1. Introduction In the study of biological systems, often the amount of starting material available for molecular analysis is limiting. In some situations, Only d few Cek in a tissue are expressing genes of interest or the tissue is m limited supply. A cDNA library from the targeted cells is preferable to a library constructed from the entire tissue containing these cells, because in the latter case, genes expressed in the targeted cells may be too rare to be detected. cDNA clones of genes expressed in small amounts of material are often hard to obtain because the construction of conventional cDNA libraries requires microgram amounts of polyA+ RNA (I). The polymerase chain reactton (PCR) is commonly used to amplify tiny amounts of DNA (2,3). This technique also has been adapted to facilitate clon- mg of 3’- and 5’-ends of specific cDNAs from low amounts of RNA (45). The strategies used to clone specific cDNAs were extended to allow the construc- tion of cDNA libraries from small quantities of polyA+ RNA (6-9). For PCR amplification, cDNAs must possess a known DNA sequence (-20 bp) at each end. These end sequences can be generated by homopolymer tailing with ter- minal transferase (IO), by ligating adapters/linkers to the cDNAs (II), or by using primers that anneal by means of random hexamers at their 3’-ends (12). Most cDNA library construction methods require multiple purification or precipitation steps to remove primers and change buffers. These steps result in significant loss of material and compromise the quality of the final library. It is especially important when working with small amounts of RNA and cDNA to minimize such steps. The cDNA amplification methods presented here elimi- From Methods m Molecular Biology, Vol 69’ cDNA Ltbrary Protocols Edrted by I G Cowell and C A Austm Humana Press Inc , Totowa, NJ 7 2 Lambert and Williamson nate all preciprtation and chromatography steps so that all cDNA synthesis and modification reactions can be conducted m a single tube. The polyA+ RNA is purified using oligo dT paramagnetrc beads, and the synthesis of the first-strand cDNA is primed with the oligo dT that is covalently attached to the beads (13,14). This results m first-strand cDNA covalently attached to the beads, mmimizing cDNA loss in subsequent enzymatic manipulations (14). The attraction of the beads to magnets allows rapid solution change by placing the sample tube in a magnetic stand to hold the beads against the side of the tube as the solutton 1s pipeted off. Two methods for amphficatton of the first-strand cDNA are presented. In one method, an adapter is ligated to the S-end of the cDNA to generate the priming site. The second procedure uses terminal transferase to generate polyA tails for primer annealing sites (15). Using either of these methods, microgram amounts of amplified cDNA can be generated m l-2 d from 5-200 ng of polyA+ RNA. Advantages of the adapter method are the ease of dtstmguish- mg the S- and 3’-ends of the cDNA and the capability to alter the procedure for production of directional libraries. However, the terminal transferase method is simpler to carry out, and, in our hands resulted m a comparable, if not better library. PCR-amplified DNAs are sometimes difficult to clone, because restriction enzymes may cut unreliably m terminal linkers (I 6) and because the 3’-ends of the PCR product can be A-tailed by the termmal transferase activity of Taq polymerase (17). A library constructton procedure is presented that overcomes these problems. This cDNA library construction approach should be suitable for generating plasmid or phage vector cDNA libraries in systems where RNA is limiting. 2. Materials 2.1. Generation of First-Strand cDNA Covalent/y Linked to Paramagnetic Beads 1. Drethyl pyrocarbonate (DEPC) H,O. Stir distilled water with 0.1% DEPC for 12 h or longer, and then autoclave. 2. Dynabeadso mRNA purification kit (product no. 610.05; Dynal, Great Neck, NY) The kit contains oligo (dT),, Dynabeads, 2X binding buffer, wash buffer, and the magnetic microcentrifuge tube stand Store at 4°C. 3. Superscript RNaseH-reverse transcriptase (200 U/pL; Gibco BRL, Grand Island, NY) and 5X first-strand buffer (Gibco BRL). 4. Reverse transcriptase mix. 4 pL 5X first-strand buffer, 10 $ DEPC-treated H,O, 2 uL O.lM dithiothreitol (DTT), 1 pL 10 mM dNTP mix (10 mM each dATP, dGTP, dCTP, and dTTP), 1 pL RNasin (10 U/pL; Gibco BRL), prepare Just before use Paramagnetic Beads and PCR Table 1 Primers and Adapter Used in cDNA Library Construction Name Sequence AL adaptef L-primep T-primef 5’-TTGCATTGACGTCGACTATCCAGG-3’b 3’-GCTGATAGGTCC-5’ 5’-TTGCATTGACGTCGACTATCCAGG-3’ 5’-TTGCATTGACGTCGACTATCCAGGT- TTTTTTTTTTTTTT-3’ “The 24-mer strand of the adapter 1s identical to the L-primer Our L-primer was phosphorylated at the 5’-end, but this 1s probably not necessary bUnderlme Indicates Sal1 endonuclease cleavage site ‘By destgnmg a different T-primer that does not share homology with L-primer, one could make a directtonal library with the ohgnucleottde adapter protocol 2.2. cDNA Amplification Using Oligonucleotide Adapters 1. 5X Second-strand cDNA synthesis buffer 94 mA4 Tris-HCl, pH 6 9, 453 mM KCI, 23 mMMgC12, 750 nut4 P-NAD, 50 rmt4 (NH&S04, prepare fresh. 2. Second-strand cDNA reaction mix: 91.6 l.tL distilled HzO, 32 pL 5X second- strand cDNA synthesis buffer, 3 l.tL of 10 mM dNTP mix, 6 & 0. 1M DTT, 1.4 & Escherzchla coli RNase H (1 U/l&; Boehringer Mannheim, Indianapolis, IN); 4 pL ofE. coli DNA polymerase I (10 U/l.&; New England Btolabs, Beverly, MA), 2 & (20 U) of E. colr DNA ligase (10 I-l/$; Gibco BRL); prepare Just before use. 3. T4 DNA polymerase reaction mix I: 42.4 pL HzO, 5 pL 10X T4 DNA poly- merase reaction buffer (Eptcentre Technologies, Madison, WI), 2.5 pL 10 mM dNTP mix, 0.1 pL T4 DNA polymerase (10 U/l&; Epicentre Technologies); prepare Just before use 4. Polynucleotide kinase reaction: mix 42.4 pL of distilled water, 5 l.tL of 10X T4 DNA polymerase buffer, 2.5 pL of 10 mM adenosme triphosphate (ATP), and 0.1 l.tL polynucleotide kinase (10 U/pL; New England Biolabs); prepare Just before use 5. AL-adapter, 34 pmol/pL; T-primer, 0.5 pmol/pL; L-primer 50 pmol/pL. Adapter and primer sequences are shown in Table 1. 6. 10X Blunt-end ligation buffer: 660 mM Trrs-HCl, pH 7.6, 50 mM MgC12, 50 mM DTT, 1 mg/mL bovine serum albumm (BSA). 7. Adapter ligation mix: 6.5 + H20, 1 ),tL AL adapter, 7.5 pL 40% polyethylene glycol (average mol wt 8000; Sigma, St. Lotus, MO), 2.5 l.tL 10 mMATP, 2 pL 10X blunt-end ligation buffer, 0.5 pL T4 DNA hgase (400 U/I.& New England Biolabs); prepare lust before use. 8. 10X PCR reaction buffer 200 mM Tris-HCl, pH 8 3, 25 mM MgCl*, 250 mM KCI, 0.5% Tween-20, 1 mg/mL autoclaved gelatin. 4 Lambert and Williamson 9 PCR reaction mix 0 5 pL Tuq polymerase (5 U/pL; Promega, Madison, WI), 0 4 uL IA4 tetramethylammomum chloride (TMAC) (Note l), 5 pL 10X PCR reaction buffer, 1 pL 10 mA4 dNTP mix, 1 pL (50 pmol) of L-primer. 10. Perkm-Elmer Cetus DNA thermocycler 480 2.3. cDNA Amplification Using Terminal Transferase 1. T4 DNA polymerase reaction mix II* 41 5 pL H,O, 5 pL of 10X T4 DNA polymerase reaction buffer, 2 5 pL 10 mM dNTP mix, 1 uL (10 U) of T4 DNA polymerase. 2 RNaseH buffer: 20 mM Trts-HCl, pH 8.0, 50 r&4 KCl, 10 mM MgCl,, 1 mh4 DTT; prepare fresh. 3 RNaseH reaction mix: 20 pL of RNaseH buffer, 0 5 pL (0 5 U) of RNaseH, prepare Just before use. 4. 500 mMEDTA, pH 7.5, sterile stock. 5 Terminal transferase mix: 14 & H,O, 2 pL of 10X One-Phor-All PLUS buffer (Pharmacia, Uppsala, Sweden), 3 pL of 1 5 mM dATP, 1 pL terminal deoxy- nucleottdyl transferase (22 U/pL, Pharmacta), prepare just before use 2.4. Cloning Amplified cDNA 1, pBluescript II SK-plasmid, 1 mg/mL (Stratagene, La Jolla, CA), and competent E coZi (Strain SURE, Stratagene). 2. Chromaspin-100 spin column (Clontech, Palo Alto, CA) 3. GeneClean@ (BIO 101, La Jolla, CA) 4. Ligation mix: 5 pL distilled water, 2.5 pL 10 mM ATP, 2 pL 10X blunt-end ligation buffer, 0.5 pL (200 U) T4 DNA ligase, prepare Just before use 3. Methods 3.1. Generation of First-Strand cDNA Covalent/y Linked to Superparamagnetic Beads The starting material is dried total nucleic acid prepared by an appropriate method (Note 2). PolyA+ RNA is isolated using oligo dT Dynabeads, but is not eluted from the beads. The first-strand cDNA 1s synthesized using the oligo dT covalently attached to the bead as a primer (14). 1. PolyA+ RNA tsolatton: Resuspend dried total nucleic acid m 25 pL of DEPC- treated water, heat to 65°C for 2 mm, and then cool on ice. Add 20 pL (100 I-18) of Dynabeads to a OS-mL microcentrifuge tube and place the tube m the magnettc stand. The beads will bmd to the side of the tube adJacent to the magnet. Remove the supernatant with a mlcropipet without disturbing the beads. Remove the tube from the stand and resuspend the beads m 25 pL of 2X binding buffer. Remove the buffer, and add a fresh 25 pL of 2X binding buffer to the beads. Add 25 pL of the resuspended nucleic acids to the beads and allow the polyA+ RNA to hybridize to the ohgo dT beads for 15 min at 22’C. Remove the binding buffer Paramagnetlc Beads and PCR 5 and unhybridized nucleic acids from the beads. Wash the beads twice with 50 & of wash buffer, and then remove wash buffer. 2 First-strand cDNA syntheses: Wash the beads in 50 pL of 2X first-strand buffer to remove residual wash buffer. Remove buffer, and add 19 pL of reverse tran- scriptase mix, and heat to 37*C for 2 mm. Add 1 @. reverse transcrrptase and mix. Continue to mcubate the reaction at 37°C for 15 min to allow extension from the 3’-end of the oligo dT primer, and then increase the temperature to 42°C for 4.5 min to help disrupt secondary structure m the RNA. Mix the tube every 15 mm to keep the beads suspended. The first-strand cDNAs are now covalently linked to the beads The RNA is still attached noncovalently to the cDNA and beads. 3.2. cDNA Amplification Using Oligonucleo tide Adapters In this method (outlined in Fig. l), the second-strand cDNA is synthesized on the beads, and an adapter (Note 3) is ligated to the free end of the cDNA (18,19). The intact second-strand cDNA is removed and amplified using PCR. 1. Second-strand synthesis: Add 140 pL of second-strand cDNA reaction mix to the first-strand cDNAs, which are attached to the beads and m 20 & reverse transcriptase mix. Incubate the reaction at 16’C for 2 h, resuspending the beads every 15 min. Remove the buffer. 2. Blunt-end the cDNA: Add 50 pL of T4 DNA polymerase reaction mix to the beads, and incubate at 16OC for 15 mm. Inactivate the enzyme by heating the reaction at 74°C for 10 mm. Remove the buffer. 3. To ensure the cDNA has a 5’-phosphate, add 50 & polynucleottde kinase reac- tion mix to the beads, and incubate at 37°C for 15 min. Remove the buffer. This step may not be necessary (see Note 4). 4. Adapter ligation: Add 20 & of adapter ligation mix, and incubate at 16’C over- night. Add 50 pL TE to the ligation mix, bind the beads, and remove the buffer. 5. Extend the 3’-end of the first-strand cDNA: Add 50 p.L PCR reaction mix, and heat the reaction at 74°C for 10 min to melt off the 12-mer strand of AL adapter (Table 1) and to extend the 3’-end of the cDNA. Heat at 95’C for 2 min to dena- ture the double-stranded cDNA. Remove and discard the supernatant contaimng the second-strand cDNA. 6. Resynthesis of second-strand cDNA (see Note 5): Add 50 $ of PCR reaction mix containing 50 pmol L-primer to the beads, and heat at 72OC for 5 min. Incu- bate the tube at 95°C for 2 mm to denature the cDNA. Bind the beads, and trans- fer the reaction mix containmg the second-strand cDNA to a new tube. Save the beads (Note 6). 7. Amplification of cDNA: Add overlay with 50 pL mmeral oil (0.5 pmol) of T-primer to the reaction mrx with the second-strand cDNA, and incubate at 30°C for 3 min, 40°C for 3 mm, and 72°C for 5 min to resynthesize the antisense strand (see Note 7). Both ends of the cDNA now carry the L-primer sequence. Amphfy for 15 cycles (95’C for 1 mm and 72°C for 5 min), and then incubate at 72°C for 30 min. Lambert and Wilhamson Pal',' A+ RNA FSC@ TTTTT 1 Syntheszze first-strand CDNA CEC@-TTTTT 1 Synthesize second-strand cDNA TTTT a- TTTTT 1 Ligate AL adapter *,/,,,/, ,,,,, 1 RemOve '/xl, Extend 3'end of CDNA Remove second strand Resynthesize usmg fmu,, +,///,, ‘M,,,,, ' ,,,,,,, ,,/,,, ,,,,,,, a TTTT TTTTT 1 Release second strand AAAAA 1 ?mpl~.fy 1~1th "jJ'Ntl#TTTTT and * ,,,,,,,,, ~N/////I TTTTT WHn// ‘////I u /,,,,,, /,/,,/ TTTTT N/“‘/. t,,,,, AAAAA’///,/// V//M, TT pTT I/,,,/,, Fig. 1. cDNA amplification using olrgonucleotide primers. The thin line repre- sents RNA, the thick line represents DNA, and the crosshatched lmes represent primer and adapter sequences. 8. Assessing amplification: Remove 5 & of amplified cDNA and fractionate on a 2% agarose gel. If the cDNA is not visible after staining with ethtdmm bromide, reamplify 5 pL of PCR product for 15 additional cycles using 50 pmol of L-primer. The size range of the PCR products is likely to be slightly smaller than Paramagnetic Beads and PCR 7 Polv A+ RNA synthesue first strand cDNA %a TTTTT 1 Remove unhybridlzed ollgo dT Remove poly A+ RNA Add poly A tall to cDNA TTTTT -* 1 Release second strand Fig. 2. cDNA amplificatron using terminal transferase tailing. This figure is adapted from Lambert and Williamson (IS) by permisston of Oxford University Press. the average size of the starting polyA+ RNA, reflecting selective amplification of smaller cDNAs. The representation of control genes in the cDNA can be deter- mined by Southern hybridlzatron or PCR amplification of the cDNA with appro- priate primers. Control genes that differ m abundance and transcript size are most useful to test for bias for abundantly expressed cDNAs or short transcripts. 3.3. cDNA Amplification by Terminal Transferase Method In this protocol (outlined in Fig. 2), the first-strand cDNA is A-tailed usmg terminal transferase, and a T-tailed primer is used to initiate the second-strand cDNA. The second-strand is amplified for the first few rounds with T-primer and then with the more stringent L-primer. 8 Lambert and Williamson 1 Removal of the unhybridized ohgo (dT) from the beads that contain covalently linked cDNA* This step is Important because unbound oligo (dT) can be talled and amplified. Heat the reactlon mixture at 65°C for 10 mm to inactivate the reverse transcnptase. Remove the buffer, and add 20 & of T4 DNA polymerase reactlon mix, and incubate at 16“C for 1 h The oligo dT IS removed by the exo- nuclease actlvtty of the T4 DNA polymerase. Inactivate the enzyme by heating at 74°C for 10 min Remove the buffer. 2 Removal of polyA+ RNA. Add 20 @. of RNaseH reaction mix, and incubate at 37°C for 1 h. Remove the buffer. Add 50 pL of 1 mM EDTA, and heat the mix- ture at 75OC for 5 mm. Remove the EDTA solution. 3 Addition of polyA tall to first-strand cDNA (see Note 8): Add 20 pL of terminal transferase mix, incubate the beads at 37“C for 15 mm, and then stop the reactlon with 2 p.L of 500 mA4EDTA. Remove the buffer. 4. Second-strand cDNA synthesis: Add 50 pL, of Taq polymerase reactlon mix containing 29 pmol of T-primer. Extend the primer at 30°C for 3 mm, 40°C for 3 mm, and then 72°C for 5 min (Note 7). Bind the beads, and discard the supematant 5 cDNA ampllficatiorr Add 50 pL of fresh Taq polymerase reaction mix contam- ing 50 pmol L-primer and 1 pmol T-primer. Heat the reaction at 95°C for 2 mm to release the second-strand cDNA. Save the beads for future use (Note 6) Trans- fer the supematant to a new tube, and add 50 $ of mineral oil. Incubate at 30°C for 15 min, 40°C for 15 mm, and at 72°C for 15 mm to extend the T-primer and synthesize a new first-strand cDNA. Heat at 95% for 2 mm, and amplify the cDNA for 15 cycles (95°C for 1 min and 72°C for 5 min) and then incubate at 72’C for 30 mm 6. Assessing amplification (see Section 3.2., step 7). 3.4. Cloning Amplified cDNA Vector and insert ends are modified for efficient ligation (Fig. 3). A 5’-TT overhang is produced on each end of the msert by the 3’ to 5’-exonuclease activity of T4 DNA polymerase (20). 5’-AA overhangs are produced on the vector by digesting with EcoRI and partially filling in the 5’-overhang using T4 DNA polymerase (21). 1. Digest 5 s of vector to completion with EcoRI. Add ‘/IO vol3M sodium acetate and 2.5 vol cold 100% ethanol, and then precipitate at -20°C Spin in a microcentrifuge, and decant the supematant. Wash the pellet with 70% ethanol, decant, and vacuum dry. Resuspend the EcoRI-digested vector in 50 JJL of T4 DNA polymerase reaction mix lacking dTTP, and incubate at 16°C for 1 h. Heat the reaction to 65°C for 15 min to inactivate the enzyme. Gel-purify the cut plas- mid to remove traces of uncut vector DNA. 2. Separate the 50 pL of PCR-amplified cDNA from unused primers and small cDNAs on a Chromaspm-100 spin column as recommended by manufacturer. Dilute the size-selected cDNA to 1 mL with TE, and measure the AzbO on a UV Paramagnetic Beads and PCR vector end insert end . . . . . . . G 3' 5'TTGCATTGACGTCGACTATCCAGG . . . . . . . CTTAA 5' 3'AACGTAACTGCAGCTGATAGGTCC . . . . 9 1 T4 DNA polymerase dATP. dGTP, dCTP 1 T4 DNA polymerase dTTP, dGTP, dCTP GAA 3' S*TTGCATTGACGTCGACTATCCAGG CTTAA 5' 3' CGTAACTGCAGCTGATAGGTCC Y ligate . GAATTGCATTGACGTCGACTATCCAGG CTTAACGTAACTGCAGCTGATAGGTCC Fig. 3. Cloning the cDNA. Generation and legation of 2-nucleotide 5’-tarls at vector and insert ends. This figure is from Lambert and Williamson (IS) by permission of Oxford Umversrty Press spectrophotometer. Ethanol-precipitate 400 ng of amplified cDNA, wash with 70% ethanol, and vacuum dry Resuspend m 50 pL of T4 DNA polymerase reaction mix lacking dATP, and Incubate at 16°C for 1 h and then at 75°C for 10 min (see Note 9). 3. Add 1 pL (100 ng) of EcoRI-digested vector to 400 ng of amplified cDNA, and concentrate usmg GeneClean as recommended by the manufacturer, elute in 10 pL of TE. Add 10 pL of ligation mix, and incubate at 16’C overnight. Transform competent E. cob cells with the ligated DNA. 4. Assessing the library* Blue/white color selection will determine the percentage of insert-containing clones. In our hands, the fraction of clones that contain inserts falls between 50 and 90%. The average cDNA size can be measured by PCR amplification of mdivrdual clones with L-primer. In our hands, the average insert size was approx 600 bp 4. Notes 1. Addition of TMAC (221, a chemical that causes an oligonucleotide to hybrid- ize based on length and not GC content, results in an improvement in the quality of the PCR products (23). TMAC is included in all PCR amplifica- tions of cDNA Its effectiveness should be determined empirically for each new primer set. 2. The total amount of nucleic acid used should not contain more than 200 ng of polyA+ RNA, which is the carrying capacity of the beads. The amount of beads can be scaled up proportionally, but should not be reduced because there is some nonspecific binding of beads to the prpet tips and microcentrifuge tubes. The nonspecific sticking of the beads can be reduced by using srlicomzed mlcro- centrifuge tubes and pipet tips. The lower limit of mRNA is not known, but we have used as little as 5 ng of polyA+ RNA to construct libraries. Karrer et al. (24) used a similar protocol to construct a cDNA library from the contents of a single 10 Lambert and Williamson plant cell. The method of nucleic acid extraction is dependent on the biological system under study. We found that a stamless-steel tissue pulverizer (Fisher Scientific, Pittsburgh, PA) cooled in hquid nitrogen was particularly useful for reducing small amounts of frozen tissue to a fine powder. A number of nuclerc acid extraction protocols should be satisfactory We used a simple phenol/chlo- roform extraction method (25) 3. The AL adapter (Table 1) is made up of a 1% and a 24-mer The blunt end of the adapter lacks a S-phosphate and the 5’-overhang is nonpalandromrc, so that adapters cannot form concatemers (26,27) and the 12-mer cannot form a covalent bond with the cDNA This adapter design maximizes the effi- ciency of ligation by minimizing competing ligation reacttons (6, II). A SalI site IS included In the primer to give an alternative cDNA library construc- tion method. 4. To obtain efficient ligation of the adapter, the cDNA must have a 5’-phosphate. The polynucleotide kmase step is included to ensure all cDNAs are phosphory- lated (27,28). However, this may be an unnecessary step, since many protocols for adapter hgation do not include a kmase step 5. The second strand 1s resynthesized to increase the likelihood that rt is full length RNaseH partially degrades the polyA+ RNA m the RNA/DNA hybrid, whereas E coEz DNA polymerase I extends and removes the RNA primers and E. co11 DNA ligase seals the nicks. However, some nicks or gaps may remain m the second-strand cDNA owing to mcomplete action of DNA polymerase I or DNA hgase. This will result in incomplete second-stand cDNA, which will not amplify during PCR. Small RNAs will be less likely to have nicks, and thus, may skew the library toward small inserts. Resynthesis of the second-strand cDNA using only L-primer elirnmates the nickmg problem and results m the formation of full- length second-strand cDNA 6. Beads with the first strand attached can be saved to generate addmonal hbrarres. We have also found them to be useful for obtaining full-length cDNAs (4). 7. The first cycle annealing is started at 30°C and slowly increased to the 72°C extension temperature, so the (T)rs-tail of the T-primer can anneal to the polyA-tail to prime a new first-strand cDNA. In subsequent amplificatron cycles m which primer annealing and extensions are carrted out at 72”C, only the L-primer contributes to the amplification. 8 The first-strand cDNA IS A-tailed by terminal transferase using conditions that should produce a tail of >500 residues. The absolute tail length is not critical, because in the next step, a large excess of the T,s-tailed primer is used to synthe- size the second-strand cDNA. The excess primer causes the final A-tall of the second-strand cDNA to be about 15-20 residues. 9 Reaction temperatures of 1 l-16°C will ensure that a large fraction of the cDNAs have the correct overhang. Higher temperatures can partly denature the ends of the DNA and allow the polymerase to remove more than the terminal two bases (29). [...]... 81,295-306 7 Welsh, J., Liu, J.-P., and Efstratiadis, A (1990) Cloning of PCR-amplified total cDNA: construction of a mouse oocyte library Genet Anal Technol Appl 7,5-l 7 8 Domec, C., Garbay, B., Foumier, M , and Bonnet, J (1990) cDNA library construction from small amounts of unfractionated RNA: association of cDNA synthesis with polymerase chain reaction amplification Anal Bzochem 188, 422-426 9 Jepson,... lo-fold excess with target cDNA RNA-DNA hybrids representing sequences present m both cell types can be removed (3-5), and the remaining unhybridized cDNA can be used to generate a subtracted library (or be used as a subtracted cell type-specific probe to identify clones of interest) An alternative means of enriching the proportton of specific low-abundance cDNAs cloned in a given library is based on hybridization... doublestranded (ds) cDNAs of varying abundance reanneal m solution Smglestranded (ss) cDNAs (corresponding to sequencesof relatively lower abundance) can be cloned, following separation from abundant cDNAs, which reanneal more rapidly to form double-stranded molecules (9) Utilizing a refinement of this procedure (la), the range of abundance of mRNAs represented m a human infant brain cDNA library (constructed... the essentially unique noncoding 3’-ends of cDNA inserts cloned m the ss circles Hybridization-based approaches to reducing the complexity of cDNA hbrartes are, however, beset by a common problem Repetitive sequences (e.g., Alu repeats) shared by nonhomologous cDNAs may be responsible for the elimination of low-abundance cDNAs, and/or the selection of abundant cDNAs A further problem associated with solution-phase... air-dry, andresuspend cDNA in 30 pL of sterile distilled water Storethe the cDNA at -20°C until required 3.3 Restriction Digestion of cDNA This section describesthe restriction of cDNA with F&I In prmciple, any typeIIS restriction enzymewhose cutting site 1sdisplacedfrom its recogmtlon sequence and that generates nonidentical 4-base cohesive overhangs may be utilized 1 Mix 30 Ils, of cDNA (prepared from... Low-Abundance cDNAs 25 2 Purify the cDNA fragments by two successrve IOO-pL phenol/chloroform extractions, and by gel filtration through a SizeSep 400 column (equilibrated m 1X T, DNA hgase buffer) (see Section 3 2.) Store the cDNA at -20°C until required 3.4 Sorting of cDNA Restriction Fragments 3.4.1 Sequence-Specific Ligation of Adapters This section details the ligatton of adapters to cDNA fragments... subdividing complex cDNA mixtures into distinct subpopulations In concept, a given cDNA restriction fragment can only be sorted mto a single subset Since an individual subpopulation is of relatively low complexity (as compared to the original population), the concentration of any given cDNA will be higher than m the original population The subpopulations combined represent the entire original cDNA population... ends produced cDNA fragments can be sorted into different subsets by successive basespecific adaptering and base-specific PCR cDNA fragments separated mto different subsetsare amplified by PCR This serves to enrich further the abundance of rare mRNAs, since although the relative proportion of different cDNAs within a given subset remains constant, the absolute abundance of a particular cDNA in a subset... PCR, employing a primer with a specified base Low-Abundance cDNAs 17 cDNAs Restriction endonuclease eg FokI Ligation of adaptors Bind to streptavidin-coated magnetic beads Fig 2 Base-specific selectionof cDNA restrictionfragments(continuedon nextpage) at its 3’-terminus, will theoretically discriminate in favor of solid-phase captured ss cDNAs containing a complementary base at position four of the... particular cell or tissue Utilizing an unmodified cDNA library, well-resourced laboratories are forced to employ approaches incorporating a lo- to 1OO-fold redundancy in screening in order to isolate rare mRNAs However, such approaches are not an option available to the majority of investigators “Normalization” is a means of reducing the number of clones in a cDNA library that must be screened in order to . (17). A library constructton procedure is presented that overcomes these problems. This cDNA library construction approach should be suitable for generating plasmid or phage vector cDNA libraries. PCR-amplified total cDNA: construction of a mouse oocyte library. Genet. Anal Technol. Appl. 7,5-l 7. 8. Domec, C., Garbay, B., Foumier, M , and Bonnet, J. (1990) cDNA library con- struction. the number of clones in a cDNA library that must be screened in order to detect rare transcripts. This is achieved From Methods m Molecular Biology, Vol 69 oDNA Library Protocols Edlted by I