Thông tin tài liệu
THAI NGUYEN UNIVERSITY UNIVERSITY OF AGRICULTURAL AND FORESTRY DO THI THANH TRA TOPIC TITLE: DEVELOPMENT OF ORAL VACCINE FOR COCCIDIOSIS PROTECTION IN CHICKEN: CLONING OF GAPDH GENE FROM COCCIDIA SPECIES INTERNSHIP DIARY Study Mode : Full-time Major : Biotechnology Faculty : Biotechnology and Food Technology Batch : 2014 – 2018 Thai Nguyen, 6/2018 Luan van THAI NGUYEN UNIVERSITY UNIVERSITY OF AGRICULTURAL AND FORESTRY DO THI THANH TRA TOPIC TITLE: DEVELOPMENT OF ORAL VACCINE FOR COCCIDIOSIS PROTECTION IN CHICKEN: CLONING OF GAPDH GENE FROM COCCIDIA SPECIES BACHELOR THESIS Study Mode : Full-time Major : Biotechnology Faculty : Biotechnology and Food Technology Batch : 2014 – 2018 Thai Nguyen, 6/2018 Luan van DOCUMENTATION PAGE WITH ABSTRACT Thai Nguyen University of Agriculture and Forestry Major Biotechnology Student name Tra Thi Thanh Do Student ID DTN1453150027 Thesis title Supervisors Development of oral vaccine for Coccidiosis protection in chicken: cloning of GAPDH gene from coccidia species Asst Prof Dr Kanokwan Poomputsa Assoc Prof Dr Duong Van Cuong Abstract: Coccidiosis is one of the most important diseases in poultry and often causes by simultaneous infections of several Eimeria species Every chicken in a production systemis considered to be infected with one or more Eimeria species and economic losses are estimated to be over billion dollars annually Control of avian coccidiosis is currently accomplished by either medication of feed with anti-coccidial drugs or administration of live vaccines composed of low doses of Eimeria oocysts The increasing incidence of drug-resistance and cost of live vaccines is prompting alternative control strategies, such as immunization of chickens with recombinant Eimeria proteins GAPDH is one of the immunogenic common antigens among Eimeria tenella, E acervulina, and E.maxima and a key glycolytic enzyme in the process of metabolism of coccidian, as several pathogenic protozoa entirely depend on glycolysis as the source of ATP in the host Thus, protozoan GAPDHs are considered potential targets for antiprotozoan drugs The genes of GAPDH cloned from E.acervulina and E.maxima were named as EaGAPDH and EmGAPDH, respectively Total RNA from Coccidian oocyst were extracted by using three method to compare RNA concentration cDNAs were synthesized by reverse transcription reaction with primers specific to EaGAPDH and EmGAPDH The first strand cDNA synthesis was amplified by PCR The PCR product will be ligated into pGEM-TA vector Keywords Coccidia – oocyst- Eimeria – GAPDH Number of pages 35 i Luan van ACKNOWLEDGMENTS Firstly, I would like to express my sincere gratitude to my main advisor Asst Prof Dr Kanokwan Poomputsa for the continuous support of my internship and related research, for her patience, motivation, and immense knowledge Her guidance helped me in all the time of research and writing of this thesis I am also gratefully thank to Assoc Prof Dr Duong Van Cuong, my co-advisor who always providing useful advice for the improvement of this work I thank my fellow labmates at Animal Cell Culture (ACC) laboratory, for their advises, kind motivation, and warm friendship during my internship I would also like to acknowledge my teachers at TUAF, Assoc Prof Dr Duong Van Cuong, MSc Trinh Thi Chung, Dr Nguyen Xuan Vu that contributed to making this work and had an enjoyable and fulfilling experience Last but not the least, I would like to thank my family: my parents and to my brothers and sister for supporting me spiritually throughout writing this thesis and my life in general Many thank you and best regards Student Do Thi Thanh Tra ii Luan van CONTENTS ACKNOWLEDGMENTS ii CONTENTS iii LIST OF TABLE v LIST OF FIGURES vi LIST OF ABBREVIATION .vii CHAPTER INTRODUCTION 1.1 Research rationale 1.1.1 Chicken coccidiosis 1.1.2 Characteristic of chickens coccidia 1.1.3 Life cycle of Eimeria 1.1.4 Coccidian oocyst wall 1.1.5 Glyceraldehyde 3-Phosphate dehydrogenase (GAPDH) 1.2 Objectives 12 1.3 Scope of work 12 CHAPTER 14 MATERIALS AND METHODS 14 2.1 Instruments and materials 14 2.1.1 Types of instruments 14 2.1.2 Chemicals and materials 15 2.2 Methods 15 2.2.1 Preparation of Coccidia oocysts 15 iii Luan van 2.2.2 Preparation total RNA from Coccidian oocysts 17 2.2.3 First strand cDNA Synthesis and PCR Amplification 21 CHAPTER 24 RESULTS AND DISCUSSIONS 24 3.1 Coccidian oocysts isolation 24 3.2 Breaking Coccidian oocysts 26 3.3 Total RNA isolation 27 3.4 cDNA synthesis and RT-PCR 29 CHAPTER 32 CONCLUSION 32 4.1 Isolation Coccidian oocysts from coccivac®- D 32 4.2 Isolating and cloning GAPDH gene 32 4.3 Recommendations 32 REFERENCES 33 APPENDIX 35 iv Luan van LIST OF TABLE Table 1.1 Site of development, relative pathogenicity and relative immunogenicity of the seven species of Eimeria parasitic in chickens Table 1.2 Scientific classification of E.acervulina Table 1.3 Scientific classification of E.maxima Table 2.1 The instruments are used in study 14 Table 2.2 Chemicals are used in study 15 Table 2.3 The specific primer of E.acervulina and E.maxima 23 Table 3.1Evaluation of quality and quantity parameters of RNA samples extracted from Coccidian oocysts by Nanodrop 28 v Luan van LIST OF FIGURES Figure 1.1 Life cycle of coccidia (Eimeria spp.) Figure 1.2 Sequence of EaGAPDH Figure 1.3 Sequence of EmGAPDH 10 Figure 1.4 Amino acid similarities of GAPDH between Eimeria acervulina, E maxima, E tenella, E necatrix and E brunetti 11 Figure 2.1 Coccivac®-D 16 Figure 2.2 Step of oocysts purification 16 Figure 2.3 Extraction RNA using TRIzol method 17 Figure 2.4 Principle of MagListoTM5M Tissue Total RNA Extraction Kit 20 Figure 3.1 Steps of oocysts isolation from coccivac using density of sucrose: 24 Figure 3.2 Isolation Coccidian oocysts from Coccivac D under microscope 25 Figure 3.3 Breaking Coccidian oocysts 27 Figure 3.4 RNA concentrations from different RNA isolation 29 Figure 3.5 PCR product from cDNA synthesis using oligodT with taq polymerase on 1% agarose gel………………………………………………………………………………30 Figure 3.6 PCR product using normal taq polymerase on 1% agarose gel 31 vi Luan van LIST OF ABBREVIATION ºC Degree Celsius µg microgram µL microliter ATP Adenosine triphosphate BLP Bacteria- like- Particles dNTP deoxynucleoside triphosphates E.acervulina Eimeria acervulina E.maxima Eimeria maxima E.tenella Eimeria tenella EaGAPDH Eimeria acervulina Glyceraldehyde 3-Phosphate dehydrogenase EmGAPDH Eimeria maxima Glyceraldehyde 3-Phosphate dehydrogenase FDA Food and Drug Administration GAPDH Glyceraldehyde 3-Phosphate dehydrogenase GEM Gram-positive enhancer matrix GRAS Generally Regarded As Safe LysM Lysin Motif minute mL mililiter mm milimeter mM miliMolar ng Nanogram PBS Phosphate buffered saline pH Potential of hydrogen rpm Revolutions per minute RT-PCR Reverse transcription polymerase chain reaction sec second U Unit vii Luan van CHAPTER INTRODUCTION 1.1 Research rationale Coccidiosis is one of the most important diseases in poultry and often causes by simultaneous infections of several Eimeria species Coccidiosis inflicts the birds in both clinical and sub-clinical forms The clinical form of the disease are recorded through some remarkable signs like mortality, morbidity, diarrhea or bloody feces, and subclinical coccidiosis manifests mainly by poor weight gain and reduced efficiency of feed conversion and gives rise to highest proportion of the total economic losses [1] Nowday the methods for control of coccidiosis are incorporation of anticoccidial agent into feed or water, and use of live vaccines [2] The first commercial live anticoccidial vaccine, CocciVac, was introduced to the US market in 1952 It comprised a mixture of wild-type strains of E tenella oocysts, and conferred a homologous protection against those strains included in the mixture Therefore, the vaccine went through a number of reformulations over the past decades and variants of the original product, CocciVac-B®, CocciVacD® and Immucox®, are still in use today in more than 40 countries [3, 4] In parallel live oocysts vaccines proved to be efficient in turkeys[5] However, drawbacks of live vaccines include safety concern, short shelf-life and difficulties of large-scale production Since the live vaccines against coccidia are costly to produce given further that these vaccines are strain- and species-specific, a cocktail of antigens may be requires in order to raise protective immunity effectively Therefore, there is continued interest in devising new vaccines using defined recombinant antigens Despite that oral vaccines are safe and easy to use and convenient for all ages, all objects Induction of mucosal immunity is essential to stop person-to-person transmission of pathogenic microorganisms and to limit their multiplication within the mucosal tissue Vaccination through a mucosal route is shown to offer advantages for enhanced mucosal immune responses that result in better local protection [6] Mucosal immunization with Luan van (EmGAPDH) (see Table 2.3) and using The Thermo ScientificTMRevertAidTMFirst Strand cDNA Synthesis Kit For RT-PCR applications, template RNA must be free of DNA contamination Using Dnase I (#AMPD1; Sigma-Aldrich®) to remove trace amounts of DNA a Removal of genomic DNA from RNA preparations • Step 1: Add to an Rnase-free tube: RNA 17.7 µL 10X Reaction Buffer (200mM TrisHCl, pH 8.3, 20mM MgCl2) Dnase I, Amplification Grade, unit/µL Rnase-free water 2µL 0.3µL To 20àL ã Step 2: Mix gently, and incubate for 15 minutes at room temperature • Step 3: Add 0.3 µL Stop Solution (50mM EDTA) to bind calcium and magnesium ions and to inactivate the Dnase I • Step 4: Heat at 70ºC for 10 to denature both the Dnase I and the RNA • Step 5: Chill on ice b cDNA synthesis • Step 1: Add the following reagents into a sterile, Rnase-free tube on ice in the indicated order: Template RNA Total RNA Primer Oligo (dT)18 primer Gene- Specific primer 0.1 ng-5µg 1µL 15-20 pmol Water, nuclease-free To 12àL Total volume 12àL 22 Luan van ã Step 2: Incubate at 65ºC for Chill on ice • Step 3: Add the following components in the indicated order: 5X Reaction Buffer 4µL RiboLock Rnase Inhibitor (20U/µL) 1µL 10mM dNTP Mix 2µL RevertAid M-MuLV RT (200U/µL) 1àL Total volume 20 àL ã Step 4: Mix gently and centrifuge briefly • Step 5: Using PCR machine to set conditions for incubating for 60 at 42ºC and terminating the reaction by heating at 70ºC for Hold at 4ºC 2.2.3.2 PCR Amplification of first strand cDNA The PCR step was carried out in a volume of 20 µL, including 10µl of RNA sample, 2µL of 10X PCR buffer, 0.4µL of 10 mM deoxynucleoside triphosphates mix (dNTPs mix), 0.6µL 25mM MgCl2, 0.5 µl of 10 mM each of the primers, and 0.1µL of 5U of Ampli Taq DNA polymerase The sequence of the specific primer for E.acervulina GAPDH (EaGAPDH) and E.maxima GAPDH (EmGAPDH) was shown at Table 2.4 The reaction mixtures were heated at 94ºC for and then subjected to 35 cycles at 94ºC for 45 seconds, 50ºC for 30 seconds, and 72ºC for 90 seconds, with an additional 10 minutes extension at 72ºC Hold on 4ºC Table 2.3 The specific primer of E.acervulina and E.maxima Gene EaGAPDH EmGAPDH Primer Forward: 5’- CGCGGATCCATGGTGTGCCGTATGGGAATCA -3’ Reverse: 5’-CCGCTCGAGTTAGTTGCCGTCCTTCTTAGACATGTAG-3’ Forward: 5’- CGCGGATCCATGGTTTGCCGCATGGGC -3’ Reverse: 5’- CCGCTCGAGTCAGTTGCCGTCCTTCTTGGAC -3’ 23 Luan van CHAPTER RESULTS AND DISCUSSIONS 3.1 Coccidian oocysts isolation The banding patterns of oocysts in discontinuous sucrose gradients is shown in Figure 3.1 Oocysts recovered from each step in the purification procedure are shown in Figure 3.2 In Coccivac D® oocysts are contaminated with feces, after using sucrose solution vortex with Coccivac D® and carefully add distilled water at top then centrifuge at 5,000 rpm for 5min, collect the floating phase In this floating phase still has feces and a lot of oocysts Continuing add more distilled water and centrifuging at 14,000 rpm for 20 Collecting pellet and checking under microscope a few of feces still be without oocysts The result is shown at Figure 3.2 A B C Water phase MSS phase with coccivac D Water phase contain oocysts MSS phase contain feces Figure 3.1 Steps of oocysts isolation from coccivac using density of sucrose: (A)Coccivac D®; (B) Add sucrose with coccivac D®;(C)Add distilled water at top phase before centrifuge 5000 rpm for min; (D) After centrifuge 5000 rpm for 24 Luan van A B C D E Figure 3.2 Isolation Coccidian oocysts from Coccivac D under microscope: (A) Oocysts and feces from Coccivac D – 20X; (B) Oocysts from floating phase after 5,000 rpm, 5min-20X; (C) Oocysts from pellet after 14,000 rpm, 20 min-20X; (D) Oocysts from pellet after washing PBS 1st time-20X; (E) Oocysts from pellet after washing PBS 2nd time -20X 25 Luan van 3.2 Breaking Coccidian oocysts Treatment of the oocysts only vortexed without glassbeads for (x3 times) caused approximately 20% oocysts release(Figure 3.3A) After freeze-thaw cycles and hours to incubate at 55ºC, near 40% Oocysts was broken (Figure 3.3B) while treatment for on and off on ice (x 10 times) mixing buffer with glassbeads caused the release of more than 90% of oocysts (Figure 3.3C-D-E) Release rates of oocysts using 0.5 mm glass beads were higher than those without glassbeads A B C D 26 Luan van E Figure 3.3 Breaking Coccidian oocysts (A) After adding RLT buffer and vortexing x times; (B) After adding RLT buffer then freeze-thaw cycles and incubating at 55ºC for hours;(C) After adding RLT buffer with glassbeads vortex on - off x 10 times; (D) Using TRIzol with glassbeads; (E) Oocysts after breaking mixing buffer ① and glassbeads 3.3 Total RNA isolation The RNA concentrations and A260/A280 ratios of each method using the TRI Reagent®, Rneasy protect mini kit, MagListoTM5M Tissue Total RNA Extraction Kit are given in Table 3.1 In all tested methods, the highest concentration was achieved with the TRIzol Reagentđ (2.67 5.9 àg àL1), while with Rneasy protect mini kit, it was much lower(0.2± 0.05 µg µL–1) The MagListoTM5M Tissue Total RNA showed a poor performance (0.03 µg µL–1) There is a clear difference in mean RNA concentrations between the TRIzol Reagent® method and the other two methods (Those obtained using the TRIzol Reagent® were noticeably higher) as shown at Figure 3.3 One of possible explanations for the highest yield of RNA obtained with TRIzol Reagent® could be the amount of the starting material, as well as the different biochemical mechanism of cell lysis 27 Luan van Table 3.1 Evaluation of quality and quantity parameters of RNA samples extracted from Coccidian oocysts by Nanodrop Method A260 A280 A260/A280 A260/A230 Concentration (ng/µL) Elution volume (µL) Yield (µg RNA) TRIzol reagent 2.951 1.939 1.52 0.31 53.4±118.1 50 2.67±5.9 0.105 0.035 2.96 0.01 4.2±1.0 50 0.2±0.05 0.090 0.068 1.32 0.02 3.6 50 0.03 Rneasy protect mini kit MagListoTM5M Tissue Total RNA Extraction Kit The A260/A280 ratios (Table 3.1) had values lower than 2.0 for most of the methods (just Rneasy protect mini kit had an A260/A280 ratio near 3.0) The Rneasy protect mini kit method resulted in the lowest values of A280, ranging 0.035, for the TRIzol Reagent® method, this value ranged 1.939 and the MagListoTM5M Tissue Total RNA Extraction Kit is 0.068 The highest purity of RNA obtained by the Rneasy protect mini kit method was expected due to high selective binding properties of the silica-based membrane, however both three methods has the poor yield of RNA, regardless of its purity, was not sufficient for further cDNA synthesis and expression analysis by qPCR During the isolation procedure with TRIzol Reagent®, the step ethanol washing of the RNA pellet may be the reason of losing total RNA In addition, the nanodrop method cannot indicate whether or not the RNA is in good conditions, not degraded RNA Thus, an extra step in running agarose gel electrophoresis to determine the full length intact RNA 28 Luan van Mean RNA concentration àg.àl-1 2.67 2.5 TRIzol Reagentđ 1.5 Rneasy protect mini kit MagListoTM5M Tissue Total RNA Extraction Kit 0.5 0.2 0.03 Figure 3.4 RNA concentrations from different RNA isolation 3.4 cDNA synthesis and RT-PCR As mentioned above, virtually all samples were the differences in yield and quality of RNA obtained by the methods and only using TRIzol Reagent, yield of RNA was the highest Running PCR product on 1% agarose gel electrophoresis for checking and the result was shown at Figure 3.5, 3.6 In Figure 3.5, cDNAs used oligodT for cDNA synthesis, were not amplificated by PCR because RNA concentration was not enough for cDNA synthesis In Figure 3.6, using both EaGAPDH, EmGAPDH primer and oligodT to cDNA synthesis Lane 1, 2, 6, have band with size about 1kb 29 Luan van L - + 3kb 1kb 0.5kb Figure 3.5 PCR product from cDNA synthesis using oligodT with taq polymerase on 1% agarose gel: Lane 1: 2-Log DNA Ladder; Lane 2: Negative control with EaGAPDH primers; Lane 3: product of Positive control ( using hGAPDH); Lane 4: PCR product with EaGAPDH primers 30 Luan van + A1 A2 A3 M1 M2 M3 L kb kb 0.5 kb Figure 3.6 PCR product using normal taq polymerase on 1% agarose gel: Lane 1: product of Positive control ( using hGAPDH); lane 2: product of cDNA (using specific reverse EaGAPDH primer) + Primer EaGAPDH; lane 3: cDNA (using specific reverse EmGAPDH primer) + Primer EaGAPDH; lane 4: cDNA (using oligo dT) + Primer EaGAPDH; lane 5: cDNA (using specific reverse EaGAPDH primer) + Primer EmGAPDH; lane 6: cDNA (using specific reverse EmGAPDH primer) + Primer EmGAPDH; lane 7: cDNA (using oligo dT) + Primer EmGAPDH; L: 2-Log DNA Ladder 31 Luan van CHAPTER CONCLUSION 4.1 Isolation Coccidian oocysts from coccivac®- D Purified Coccidia oocysts by Gradient and Floatation technique using Modified Sheather solution and add water at the top phase for separating oocysts from large quantities of fecal material 4.2 Isolating and cloning GAPDH gene After using three method to extract RNA, each method used different oocyst wall disruptions The best way for breaking oocyst is vortexing hight speed for on, off ( 10 times) with buffer and glassbeads In summary, higher yields were obtained from a small number of cells using the TRIzol method so the protocol using TRIzol Reagent for RNA extraction is suggested as the most suitable protocol for this specific gene expression analysis 4.3 Recommendations Coccidiosis is an intestinal disorder of poultry and GAPDH is common antigen for anti-protozoan drugs Therefore, I would like to develop some future work as: Futher study about RNA isolations to collect hight yield RNA then cloning GAPDH gene into vector The recombinanr plasmids will be identified by endonuclease disgestion and sequencing and finally preparation of GAPDH recombinant proteins and checking recombinant proteins 32 Luan van REFERENCES Williams R B., A compartmentalised model for the estimation of the cost of coccidiosis to the world's chicken production industry Int J Parasitol, 1999 29(8): p 1209-1229 Li G.Q K S., Xiang F.Y., Xiao S.M., , Responses of chickens vaccinated with a attenuated multi-valent ionophore-tolerant Eimeria vaccine Veterinary Parasitology, 2005 129: p 179-186 William R., Anticoccidial vaccines for broiler chickens: pathways to success Avian Pathology, 2002 31: p 317-353 Danforth H., Use of live oocyst vaccines in the control of avian coccidiosis: experimental studies and field trials Int J Parasitology, 1998 28: p 1099– 1109 Milbradt E.L., Ferreira J.G., Almeida Paz I., Martins M.B., Sanfelice C., et al., Use of live oocyst vaccine in the control of turkey coccidiosis: effect on performance and intestinal morphology J Appl Poult Res., 2014 24: p 204-211 Zhu Q and J A Berzofsky, Oral vaccines: directed safe passage to the front line of defense Gut Microbes, 2013 4(3): p 246-252 Bruno S., et al., Selectivity of 3-bromo-isoxazoline inhibitors between human and Plasmodium falciparum glyceraldehyde-3-phosphate dehydrogenases Bioorganic & Medicinal Chemistry, 2016 24(12): p 26542659 Rose M E., Vaccination against coccidiosis in chickens Vaccination against parasites Vol 18 1980, Blackwell Scientific, Oxford, UK 57-74 Joyner L P., The specific characters of the Eimeria, with special reference to the Coccidia of the fowl Avian Pathology, 1974 3(3): p 145-157 10 Witcombe D M and Smith N C., Strategies for anti-coccidial prophylaxis Parasitology, 2014 141(11): p 1379-1389 11 Hammond D M., Long P L., The Coccidia: Eimeria, Isospora, Toxoplasma, and related genera The Quarterly Review of Biology 1974, University Park Press, Baltimore, MD 33 Luan van 12 Kennedy M J., Coccidiosis in chickens Agri-fact, Practical information for alberla's Agriculture industry, 2001 13 Current W L., Upton, S J., Long, P L., Coccidiosis of Man and Domestic Animal: Taxonomy and life cycles 1990, Boca Raton, Florida: CRC Press, Inc 14 Dubey J.P., Frenkel J.K., The Toxoplasma gondii oocyst from cat faeces J Exp Med, 1970 132: p 636-662 15 Monné L H G., On the properties of the shells of coccidian oocysts Arkiv för Zoologi, 1954 7: p 251-256 16 Belli S.I., Ferguson D.J.P., The coccidian oocyst: a tough nut to crack! Trends Parasitol, 2006 22(416-423) 17 Viscogliosi E., Phylogenetic relationships of the glycolytic enzyme, glyceraldehyde-3-phosphatedehydrogenase, fromparabasalid flagellates J Mol , 1998 47: p 190-199 18 Robbins A R., Ward R D and Oliver C., A mutation in glyceraldehydes-3phosphate dehydrogenase alters endocytosis in CHO cells J Cel Biol., 1995 130(5): p 1093-1094 19 Sirover M A., New insights into an old protein: the functional diversity of mammalian glyceraldehyde-3-phosphate dehydrogenase Bioehlm Biophys., 1999 1432(2): p 159-l184 20 Tian L L W., Huang X., Tian D., Liu J., Yang X., Protective Efficacy of Coccidial Common Antigen Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH) against Challenge with three Eimeria Species Microbiol 2017 8(1245): p 145-159 21 Staggs S E et al, Obtaining Highly Purified Toxoplasma gondii Oocysts by a Discontinuous Cesium Chloride Gradient JoVE 33: p 1420 34 Luan van APPENDIX A Comparison of yield and quality from three methods of RNA isolation RNA isolation methods Sample TRIzol Reagent® MagListoTM5M Tissue Total RNA Extraction Kit Rneasy Protect Mini Kit Luan van A260 A280 A260/A280 A260/A230 C (ng/µL) Total 50µL 1.336 0.851 1.57 0.33 53.4 0.099 0.065 1.52 0.21 4.0 2.951 1.939 1.52 0.31 118.1 0.123 0.080 1.54 0.22 4.9 1.648 1.053 1.57 0.34 65.9 0.105 0.035 2.96 0.01 4.2 0.907 0.587 1.55 0.29 36.3 0.403 0.256 1.58 0.15 16.1 0.639 0.415 1.54 0.25 25.6 8.838 4.640 1.90 1.42 353.5 A260 A280 A260/A280 A260/A230 C (ng/µL) Total 50µL A260 A280 A260/A280 A260/A230 C (ng/µL) Total 50µL 0.090 0.068 1.32 0.02 3.6 35 36 Luan van ... UNIVERSITY UNIVERSITY OF AGRICULTURAL AND FORESTRY DO THI THANH TRA TOPIC TITLE: DEVELOPMENT OF ORAL VACCINE FOR COCCIDIOSIS PROTECTION IN CHICKEN: CLONING OF GAPDH GENE FROM COCCIDIA SPECIES BACHELOR... changed to ? ?Cloning of GAPDH gene from Coccidia species for Coccidia oral vaccine production” which is the first important step for development oral vaccine 1.1.1 Chicken coccidiosis Coccidiosis... necatrix and E brunetti ChGAPDH =GAPDH of Chichken; EtGAPDH =GAPDH EbGAPDH =GAPDH of of E tenella; E.brunetti; EaGAPDH =GAPDH of EmGAPDH =GAPDH E acervulina; of E.maxima; EnGAPDH =GAPDH of E necatrix[20] BLAST
Ngày đăng: 17/02/2023, 06:33
Xem thêm: