In this study, we investigated the protection of EGCG for DNA single strand breaks in irradiated cells using primers for amplification of RNA polymerase, an enzyme responsible to synthesis of mRNA from the damaged DNA, through its down-regulated capacity.
Tiểu ban D3-D4: Ứng dụng kỹ thuật hạt nhân nông nghiệp, ứng dụng công nghệ xạ Section D3-D4: Application of nuclear techniques in agriculture, radiation technology application NGHIÊN CỨU KHẢ NĂNG BẢO VỆ TẾ BÀO KHỎI CÁC BỨC XẠ ION HÓA CỦA EPIGALLOCATECHIN GALLATE BẰNG PHẢN ỨNG CHUỖI POLYMERASE (PCR) RESEARH ON THE CAPABILITY OF EPIGALLOCATECHIN GALLATE IN PROTECTING THE CELLS AGAINST IONIZATION RADIATION BY USING THE POLYMERASE CHAIN REACTION (PCR) TRAN THI NHAN(1*), YOUICHIROU MATUO(2), VUONG THU BAC(3), DANG DUC NHAN(3), YOSHINOBU IZUMI(2) Electric Power University (EPU), 237 Hoang Quoc Viet, Bac TuLiem District, Ha Noi, Vietnam (2) Research Institute of Nuclear Engineering, University of Fukui, Chome-3-33 Kanawacho, Tsuruga, Fukui 914-0055, Japan (3) Institue for Nuclear Sciences and Technologies (INST), Vietnam Atomic Energy Institute, 179 Hoang Quoc Viet st., CauGiay District, Ha Noi, Vietnam Address of contact person: Tran Thi Nhan, Cell phone:0386686752; Email: nhantt@epu.edu.vn Tóm tắt: Mục đích nghiên cứu đánh giá khả bảo vệ tế bào epigallocatechin gallate (EGCG) chiết xuất từ chè xanh khỏi ảnh hưởng xạ ion hóa Để đạt mục tiêu đề nghiên cứu tiến hành thực nghiệm sau Tế bào nấm men nuôi cấy môi trường YDP lỏng chứa chiết xuất nấm men, peptone dextrose/glucose với có khơng có EGCG, chiếu xạ tia X tia gamma với liều xạ 50 100 Gy Ribonucleic acid (RNA) polymerase, enzyme xúc tác cho phản ứng tổng hợp RNA thông tin (mRNA) từ khuôn DNA, chiết xuất từ tế bào nấm men chiếu xạ Phản ứng chuỗi polymerase (PCR) áp dụng để tạo khuếch đại ngẫu nhiên RNA polymerase mẫu chiếu xạ Sử dụng kỹ thuật PCR, nhận thấy RNA thông tin cho việc tổng hợp protein từ DNA tổn thương đứt gẫy sợi đơn chiếu xạ tia X tia gamma với liều 50 kGy giảm từ 1,01 1,17 lần xuống 0,72 lần 0,57 lần bổ sung 500µM EGCG Đối với tế bào bị chiếu xạ với liều 100Gy, đại lượng giảm từ 1,07 1,90 lần xuống 0,79 lần 0,52 lần, tương ứng Kết chúng tơi chứng tỏ EGCG có hiệu việc bảo vệ chống lại tổn thương sợi đơn DNA gây xạ ion hóa Abstract: The aim of this study was to investigate into the capability of epigallocatechin gallate (EGCG) extracted from green tea in protecting the cells from ionization radiation For this purpose, yeast cells were cultured in YDP broth, a liquid medium containing yeast extract, peptone, and dextrose/glucose in the presence and absence of EGCG, then irradiated by X-rays and gamma rays at doses of 50 and 100 Gy Ribonucleic acid (RNA) polymerase, an enzyme responsible for synthesizes messenger RNA molecules (mRNA) from a template of DNA, were extracted from the irradiated samples Polymerase chain reaction (PCR) was applied to make a random amplification of the RNA polymerase of the irradiated cells Using the quantitative real time PCR technique, we found mRNA synthesized from DNA single-strand breaks (SSB) of the cells iradiated by X- and gamma rays at 50Gy was down-regulated from 1,01 and 1,17 times to 0.72 and 0,57 times in the presence of 500µM EGCG For the cells irradiated at 100Gy, these values decreased from 1,07 and 1.90 times to 0.79 and 0.52 times, respectively Our results suggested that EGCG is an effective agent for providing good protection against the SSB of ionizing radiation Keywords: Yeast cell, radiation protection, free radical, EGCG, PCR INTRODUCTION Ionizing radiation comes from the decay process of unstable nuclei or by de-excitation of atoms and their nuclei in nuclear reactors, X-ray machines, cyclotrons, and other devices It is well known that ionizing irradiation can cause the structural and functional changes leads to cell damage or even cell death In general, ionizing radiation induce to form free radicals, which attack to biological macromolecules such as DNA, proteins, lipids and other molecules in the cell As generic material, DNA molecules are the critical targets of radiation, and irradiation may cause serious damages in the DNA molecules, leading to mutation or even cell death Radiation also causes a wide range of lesions in DNA such as single strand breaks (SSB) in the phosphodiester linkage, double strand breaks (DSB) on opposing sites or displaced, base damage, protein-DNA crosslinks, and protein-protein [1, 2, 3] There are two interaction mechanisms of ionizing radiation on DNA One involves ionization of atoms in the DNA (direct effect), while the other involves the attacks by free radicals produced by the radiolysis of surrounding water molecules (indirect effect) [1] Epigallocatechin 3-Gallate (EGCG) is a major component of green tea and is an ester of epigallocatechin and gallic acid, which belong to polyphenol and catechin groups The beneficial effect of EGCG has been reported in many liver disease models in animals such as ischemia/reperfusion injury, fatty 534 Tuyển tập báo cáo Hội nghị Khoa học Cơng nghệ hạt nhân tồn quốc lần thứ 14 Proceedings of Vietnam conference on nuclear science and technology VINANST-14 liver, alcoholic liver damage and cancer [4,5] EGCG, together with other green tea polyphenols also exhibits growth inhibitory properties in a variety of tumour cell lines [6] Several mechanisms have been proposed by which these compounds exert their anti-tumorigenic action: these include the blockade of growth factors binding to their receptors10, phosphorylation (activation) of mitogen-activated protein kinases (MAPKs)[7, 8] possibly resulting in the observed induction of Phase II drug-metabolizing enzymes[9, 10], and the generation of oxidative stress leading to apoptosis7,9 The advent of the polymerase chain reaction (PCR) radically transformed biological science from the time was first discovered by Mullis[3] PCR is a simple and widely used process in which minute amounts of DNA can be amplified into multiple copies In addition to the rapidity with which this assay works, it can quantitatively demonstrate how much of a particular sequence is present [3,4] Messenger ribonucleic acid (mRNA) is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene and is read by a ribosome in the process of synthesizing a protein The PCR mehtod was also used in screening for deletion mutations in the hprt gene by Aghamohammadi el al.[11] In this study, we investigated the protection of EGCG for DNA single strand breaks in irradiated cells using primers for amplification of RNA polymerase, an enzyme responsible to synthesis of mRNA from the damaged DNA, through its down-regulated capacity MATERIALS AND METHODS 2.1 Samples preparation Yeast cells from Takara Bio Company (Shinga, Japan) were cultured in yeast extract-peptonedextrose (YPD) media with or without EGCG (500 μM), which was added in ml YPD culture broth for cells growing Cells were cultured for 24 h at 30 °C with shaking Saturated cultures were used to inoculate fresh media, and the new cultures were incubated for a further h at 30 °C to reach exponential phase (2 − × 107cells/ml) prior to initiating experiments EGCG was purchased from Nacalai Tesque, Inc, Japan with a purity ≥ 99.5% 2.2 Irradiation In this study two experiments were conducted separately with X-ray and gamma-ray irradiation The X-ray irradation was carried out on a LINAC of the Research Institute of Nuclear Engineering (University of Fukui, Japan) with the yeast samples at a total dose of 0, 50 and 100 Gy and dose rate of 15 kGy/h The gamma-ray irradiation was conducted with the same dose (50 and 100 Gy) but at a lower dose rate (5 kGy/h) of 60Co source of the Radiation Laboratory of the Institute of Scientific and Industrial Research (ISIR, Osaka University, Japan) 2.3 Gene expression Total cellular RNA was purified using the RNeasy Mini Kit (Qiagen, Valencia, CA) Two micrograms of RNA were reverse-transcribed using the Superscript First Strand synthesis system for conversion to cDNA (Invitrogen, Carlsbad, CA) An aliquot from this reaction was used as the template for PCR amplification with Rad4 primer Rad4 primer is a DNA damage (Single strand break) recognition protein essential for global genomic nucleotide excision repair in Saccharomyces cerevisiae The structures of the primer were shown in Table Table Structures of Rad4 primer [4] Gene name Primer sequences Rad4 forward primer CGATGCTCAGGGCTTGTAATG Rad4-reverse primer TTGGTAAAATCTGGCGGTTGA PCR amplification was performed in a 50 μL reaction mixture The mixture consisted of 25 μL Standard Taq Reaction Buffer, μL primer (15 pmol), 1μL RNA, and 22 μL water The amplifications were carried out by using a thermal cycler programmed at 42 oC for 30 min, 95 0C for min, followed by 50 cycles of 95 oC for 10 s, 60 oC for 30 s, and 72 0C for 30 s, a final extension step at 72 oC for 10 s and 535 Tiểu ban D3-D4: Ứng dụng kỹ thuật hạt nhân nông nghiệp, ứng dụng công nghệ xạ Section D3-D4: Application of nuclear techniques in agriculture, radiation technology application stored at 10oC Fold change is a measure describing how much a quantity changes between an original and subsequent measurement Messenger ribonucleic acid (mRNA) is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene and is read by a ribosome in the process of synthesizing a protein[5] The mRNA fold change was determined by the formula below: mRNA fold change = Number of experimental gene (1) Number of a control gene RESULTS The mRNA fold change of DNA irradiated by X-rays in the presence and absence of EGCG was presented in Fig.1 Rad 4-SSB 1.5 mRNA Fold change Without EGCG 500µM EGCG 0.5 0 50 X- rays absorbed dose (Gy) 100 Figure The mRNA fold change of DNA in yeasts irradiated by X-rays in the presence and absence of 500µM EGCG As seen from Figure that EGCG can protect DNA from damage caused by ionizing radiation The DNA damage was clearly reduced in the presence of EGCG At 50 Gy of X-rays irradiation and in the presence of 500 µM EGCG, mRNA fold change decreases from 1,01 times to 0.72 times This number also decreased from 1,07 times to 0.79 times at 100 Gy of X-rays irradiation and in the presence of 500 M EGCG The results clearly demonstrated that the number of single strand breaks in DNA was reduced in the presence of 500 µM EGCG mRNA Fold Change 2.5 1.5 Rad4 -SSB Without EGCG 500µM EGCG 0.5 0 50 Gamma absorbed dose (Gy) 100 Figure The mRNA fold change of DNA `in yeasts irradiated by gamma-rays in the presence and absence of 500µM EGCG The protective role of EGCG for DNA from inonizing radiation is clearer at higher LET For the gamma irradiation, mRNA fold change decreased from 1,17 times to 0.57 times in the presence of 500 µM 536 Tuyển tập báo cáo Hội nghị Khoa học Công nghệ hạt nhân toàn quốc lần thứ 14 Proceedings of Vietnam conference on nuclear science and technology VINANST-14 EGCG at 50 Gy absorbed dose and it decreased from 1,09 times to 0.51 times at 100 Gy (Fig 2) Results of X-rays and gamma-ray irradiations showed that in the presence of EGCG the number of fold changes in mRNA was lower than that number in the control This means that in the presence of 500 M EGCG the number of single strand breaks in DNA is smaller than in the case without the reagent DISCUSSION The EGCG acts as an agent that can inhibit the molecular damage caused by ionizing radiation Bioflavonoids which contain EGCG have a protective effect on the DNA damage induced by the hydroxyl radicals One of the mechanisms that explain the protective effect of flavonoids on the DNA is the involvement of chelating metal ions, such as copper or iron (Fenton reaction) The flavonoids complexed with the copper or iron prevent the generation of reactive intermediate species, known to protect DNA from oxidative damage resulting from the attack of •OH, H2O2, and •O2 – on the DNA oligonucleotides The radical scavenging effect of EGCG on DNA is due to dual activities: reactive intermediate scavenging activity, and reducing power ion in the Fenton reaction [6,7] The flavonoids complexed with the copper or iron prevent the generation of the ROS In the Fenton reaction system, Fe2+ reacts with H2O2 and oxidized to Fe3+ and produce the hydroxyl radical, which lead to the DNA damage EGCG exhibited a great reducing power on iron ions, especially at high concentrations The radical scavenging effect of EGCG on DNA cause due to dual activities: ROS Scavenging activity, and reducing power ion in Fenton reaction [5] In the low concentration, EGCG protects DNA against oxidative damage and with the increase of concentration, EGCG reducing power on the iron ion, which accelerates the generation of hydroxyl radical from the Fenton reaction, it may gradually predominant over radical scavenging ability which effect on DNA damage REFERENCES [1] Radiation Biology: A Handbook for Teachers and Students, TCS (Training Course Series), No 42 (2010), International Atomic Energy Agency, Vienna [2] BEIR V (Biological Effects of Ionizing Radiation, V) (1990) Health Effects of Exposure to Low Levels of Ionizing Radiation,; Washington (DC): National Academies Press (US), 1990 ISBN-10: 0-309-03997-5; [3] Eric Hall (1994) Radiobiology for the Radiologist, 4th ed (Philadelphia: J B Lippincott, 1994), [4] Cheng Chen, Qian Liu, Lin Liu, Yi-yang Hu, and Qin Feng (2018) Potential Biological Effects of Epigallocatechin-3gallate on the Treatment of Nonalcoholic Fatty Liver Disease Mol Nutr Food Res 2018, 62, DOI: 10.1002/mnfr.201700483; [5] Ryuchiro Sakata, Takato Ueno, Toru Nakamura, Masaharu Sakamoto, Takuji Torimura, Michio Sata (2004) Green tea polyphenol epigallocatechin-3-gallate inhibits platelet-derived growth factor-induced proliferation of human hepatic stellate cell line LI90, Journal of Hepatology 40(1): 52-59 [6] Yang GY, Liao J, Kim K, Yurkow EJ, Yang CS (1998) Inhibition of growth and induction of apoptosis in human cancer cell lines by tea polyphenols Carcinogenesis 19:611–616 [7] Yang GY, Liao J, Li C, Chung J, Yurkow EJ, Ho CT, Yang CS (2000) Effect of black and green tea polyphenols on c-jun phosphorylation and H2O2 production in transformed and non-transformed human bronchial cell lines: possible mechanisms of cell growth inhibition and apoptosis induction Carcinogenesis 21:2035–2039 [8] Liang YC, Lin-Shiau SY, Chen CF, Lin JK (1997) Suppression of extracellular signals and cell proliferation through EGF receptor binding by ()-epigallocatechin gallate in human A431 epidermoid carcinoma cells J Cell Biochem 67:55–65 [9] Chen C, Yu R, Owuor ED, Kong AN (2000) Activation of antioxidant response element (ARE), mitogen-activated protein kinases (MAPKs) and caspases by major green tea polyphenol components during cell survival and death Arch Pharm Res 23:605–612 [10] Kong AN, Yu R, Chen C, Mandlekar S, Primiano T (2000) Signal transduction events elicited by natural products: role of MAPK and caspase pathways in homeostatic response and induction of apoptosis Arch Pharm Res 23:1–16 [11] Aghamohammadi SZ, David TM, Thacker LSJ (1992) Rapid screening for deletion mutations in the hprt gene under X-ray and -irradiation using the polymerase chain reaction: X-ray and α-particle mutant spectra Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis, 269(1): 1-7 537 ... Scavenging activity, and reducing power ion in Fenton reaction [5] In the low concentration, EGCG protects DNA against oxidative damage and with the increase of concentration, EGCG reducing power on. .. protective effect on the DNA damage induced by the hydroxyl radicals One of the mechanisms that explain the protective effect of flavonoids on the DNA is the involvement of chelating metal ions, such... breaks in DNA is smaller than in the case without the reagent DISCUSSION The EGCG acts as an agent that can inhibit the molecular damage caused by ionizing radiation Bioflavonoids which contain EGCG