( TẠP CHÍ KHOA HỌC Trường ĐHSP TPHCM ) ( Ton Thi Hoai Thuong et al ) ISSN 1859 3100 TẠP CHÍ KHOA HỌC KHOA HỌC TỰ NHIÊN VÀ CÔNG NGHỆ Tập 16, Số 3 (2019) 190 199 JOURNAL OF SCIENCE NATURAL SCIENCES AND[.]
TRƯỜNG ĐẠI HỌC HỌC SƯ PHẠM TP HỒ CHÍ MINH TẠP CHÍ KHOA HO CHI MINH JOURNAL CITY UNIVERSITY OFSCIENCE EDUCATION OF KHOA HỌC TỰ NHIÊN VÀ CÔNG NGHỆ Tập NATURAL SCIENCES AND TECHNOLOGY 16, Số (2019): 190-199 Vol 16, No (2019): 190-199 Email: tapchikhoahoc@hcmue.edu.vn; Website: http://tckh.hcmue.edu.vn ISSN: 1859-3100 NEW DISTRIBUTION RECORDS OF Rothmannia wittii (RUBIACEAE) IN VIETNAM AND IDENTIFICATION OF DNA BARCODE SEQUENCE FOR R wittii Ton Thi Hoai Thuong1, Nguyen Tai Thu1, Dinh Thi Kim Truc1, Le Van Son2, Tran Gia Buu1, Van Hong Thien1 Institute of Biotechnology and Food Technology, Industrial University of Ho Chi Minh City, Vietnam Binh Chau – Phuoc Buu Nature Reserve, Bung Rieng ward, Xuyen Moc District, Ba Ria – Vung Tau province, Vietnam Corresponding author: Van Hong Thien – Email: vanhongthien@iuh.edu.vn Received: 29/10/2018; Revised: 24/12/2018; Accepted: 25/3/2019 ABSTRACT Using morphological comparison method, the authors identified that the specimens collected in Binh Chau-Phuoc Buu Nature Reserve is Rothmannia wittii Information on the distribution of this species in Vietnam was also reported Moreover, based on molecular biology techniques, the matK and trnL-F regions of R wittii were successfully amplified and sequenced Also, the results showed that there were differences in matK and trnL-F sequences between R wittii and R daweishanensis that were similar in morphological characteristics Keywords: Rothmannia wittii, matK, trnL-F, DNA barcode Introduction Rothmannia Thunb of the Rubiaceae is a genus of around 35 species occurring primarily in temperate regions of Asia, Africa, but with species also in the Asian tropics, especially in Southeast Asia (Bui & Nguyen, 2015) In Vietnam, the genus was known to include five species: R daweishanensis, R eucodon, R kampuchiana, R vietnamensis, and R wittii (Pham-hoang, 2000; Bui & Nguyen, 2015) Rothmannia wittii (Craib) Bremek was first described by Grab (1911), which the specimens were collected in Thailand Newman et al (2007) in the "A checklist of the Vascular Plant of Lao PDR" provided the information on the distribution of species in Laos Recently, Bui & Nguyen (2015) recorded R wittii for the flora of Vietnam, whose distribution was identified in Ninh Hoa district, Khanh Hoa province In 2018, the authors conducted some field trips to the Binh Chau-Phuoc Buu Nature Reserve, Bung Rieng ward, Xuyen Moc district, Ba Ria – Vung Tau province and encountered a flowering population of Rothmannia species By comparison between its morphological attributes and those of reference species, it can be indicated that the Rothmannia species is R wittii This study reported additional information on the distribution of this species in the southern region of Vietnam The regions of matK and trnL-F were previously used as TẠP CHÍ KHOA HỌC - Trường ĐHSP TPHCM Ton Thi Hoai Thuong et al molecular markers for DNA barcoding of considerable number of species belonging to the family Rubiaceae and genus Rothmannia (Kainulainen & Bremer, 2014; Mouly et al., 2014) There is no information on DNA barcoding of R wittii In the present study, matK and trnL-F were used for DNA barcoding and phylogenetic tree construction Materials and methods 2.1 Plant samples Samples of R wittii were collected from Binh Chau – Phuoc Buu Nature Reserve, Bung Rieng ward, Xuyen Moc district, Ba Ria – Vung Tau province, location of about 10°21'01"N; 103°06'52"E, 33 m in elevation Besides, trnL-F and matK regions of some species of Rothmannia genus from GenBank were also used in phylogenetic analysis (Table 1) Table Sequences from GenBank database used in this study Taxa R venalis R schoemannii R merrillii R daweishanensis R macrosiphon R anna Accession number (matK/trnL-F) Taxa KJ815792/ KJ815494 KJ815780/ KJ815483 KJ815788/ KJ815490 KJ815778/ KJ815481 KJ815786/ KJ815488 KJ815777/ KJ815480 R urcelliformis R fischeri R capensis R manganjae Alberta magna Accession number (matK/trnL-F) KJ815791/ KJ815493 KJ815781/ KJ815484 KJ136897/ AM117384 KJ815787/ KJ815489 KJ136865/ FM207110 2.2 Methods 2.2.1 Taxonomic method Specimen was sampled and processed using conventional methods guided by the Royal Botanic Gardens, Kew (Bridson & Forman, 1999) Species identification was done using morphological vegetative and reproductive characteristics (Pham-hoang, 2000; Newman et al., 2007; Bui & Nguyen, 2015) 2.2.2 PCR amplification Total genomic DNA was extracted from fresh leaf tissues using CTAB DNA extraction protocol (Huynh et al., 2018) The target matK and trnL-F regions were amplified by polymerase chain reaction (PCR) using following barcoding primers (Table 2) The PCR reactions were performed in an Eppendorf Mastercycler Gradient using a volume of 25µl reaction mixture: 12.5µl Go-Taq green master mix (Promega, USA), 1.25µl of each forward and reverse primers (10 µM), 9.5µl nuclease-free water and 0.5µl DNA template (25µg/ml) PCR cycles consisted of an initial denaturation for at 95°C; 35 cycles of denaturation (1 at 94°C), annealing (1 at 55 oC) and extension (90 sec at 72°C); and a final extension at 72°C for 10 The PCR products were purified and sequencing by Nam Khoa Biotek Ltd Company (Vietnam) using ABI 3130 XL Sequencer TẠP CHÍ KHOA HỌC - Trường ĐHSP TPHCM Tập 16, Số (2019): 190199 For multiple alignments, the ClustalW software (Thompson et al., 1994) was used to recognise the homology between sequences Phylogenetic analysis was carried out with MrBayes (Ronquist & Huelsenbeck, 2003) using Bayesian methods with Alberta magna as the outgroup (Kainulainen & Bremer, 2014) Bootstrap values of 50% or higher were performed to obtain cluster supports Besides, the Bioedit software was used to pairwise alignment using global alignment method between the DNA sequences of R wittii and R daweishanensis Table Primers used in the present study (Taberlet et al., 1991) Primers (*)/Region trnL-F (F) trnL-F (R) matK (F) matK (R) Sequence (5’-3’) CGAAATCGGTAGACGCTACG ATTTGAACTGGTGACACGAG ACCCAGTCCATCTGGAAATCTTGGTTC CGTACAGTACTTTTGTGTTTACGAG (*) direction of primer F= forward, R= reverse Results and discussion 3.1 Taxonomic treatment Rothmannia wittii (Craib) Bremek Bremek 1957 Proc Kon Ned Akad Wetensch., C 60: 7; Puangsomlee 2001 Nordic J Bot 21(2): 165-175; Bui & Nguyen 2015 Jour Bio 37(4): 458-462 - Randia wittii Craib 1911 Bull Misc Inform Kew 392 (Figure 1) Tree 10–15m, glabrous throughout; gray-shaded; young twigs dichotomous Leaf blade chartaceous, ovate, dark green above, pale green under side, midrib impressed adaxially and prominent abaxially, lateral veins diverging from the midrib and toward margin Inflorescence uniflorous, protruding from a very reduced branch above a pair of leaves; pedicels 2–4 cm long, ca mm in diameter, green; Calyx lobes linear-oblong, 2–4 mm long, calyx tube cylindrical ca mm long; corolla tube glabrous, campanulate, white outside, purple inside, 3–5 cm long, ca cm wide; corolla lobes 5, glabrous, white outside, purple inside, 1.5 -2 cm long, ca 1.5 cm wide Fruit elongate to sub globose, 3–4 cm in diameter, dark green when young and black at maturity Studied specimens: H.T Van 203, August 2018, Binh Chau-Phuoc Buu Nature Reserve, Bung Rieng ward, Xuyen Moc District, Ba Ria-Vung Tau province, location of about 10°32'13"N; 107°26'55"E, 33 m in elevation Habitat: R wittii grows on the low forest (about 30-40 meters in elevation), flowering from May to August and fruiting from July to December Distribution: R wittii was formerly recorded in Thailand and Laos In Vietnam, the species has been only recorded in Ninh Hoa district, Khanh Hoa province (Bui & Nguyen, 2015) This paper reported on R wittii in Binh Chau – Phuoc Buu Nature Reserve, Bung Rieng ward, Xuyen Moc district, Ba Ria – Vung Tau province TẠP CHÍ KHOA HỌC - Trường ĐHSP TPHCM Ton Thi Hoai Thuong et al Figure Rothmannia wittii A Habitat, B Flower and leaf blade (above side), C Leaf blade (under side), D Fruits, E Longitudinal section of Fruit 3.2 PCR amplification of trnL-F and matK PCR products of trnL-F and matK regions of the studied sample were clearly visualized on agarose gel in Figure as sharp and big band with length about 900 bp and 800 bp, respectively The results were consistent with expected sizes of PCR products amplified by primers by Taberlet et al (1991) TẠP CHÍ KHOA HỌC - Trường ĐHSP TPHCM Tập 16, Số (2019): 190199 Figure PCR amplification result of trnL-F (1) and matK (2) regions of studied sample M: ladder 3.3 Phylogenetic tree The final lengths of the trnL-F and matK sequences of studied sample were 804 and 760 bp, respectively The average A+T content in the trnL-F and matK regions were 65% and 66%, respectively Figure Bayesian tree of 11 Rothmania species based on the trnL-F (A) region, matK region (B) and combination of trnL-F and matK regions (C) The bootstrap values of 50% or higher are shown above the nodes TẠP CHÍ KHOA HỌC - Trường ĐHSP TPHCM Ton Thi Hoai Thuong et al By using trnL-F and matK sequences in GenBank, the phylogenetic trees showed that relationship among Rothmannia species were established (Figure 3) Accordingly, the studied species (R wittii) was group with R daweishanensis with bootstrap value of 100%, 56% and 100% in trnL-F (Figure 3A), matK (figure 3B) and combination of trnL-F and matK regions (Figure 3C), respectively As mentioned above, R wittii has not been classified via molecular markers yet Moreover, there are only some studies which are used molecular markers to establish the phylogenic tree of Rubiaceae family whereas it is still lacking the study used molecular markers to establish the phylogenic tree of Romania genus In previous study, Kainulainen and Bremer (2014) used some sequences of cpDNA (matK, rps16, rpl32, trnT-F), rDNA (ETS), and nDNA (Xdh) to build the phylogenic tree of Rubiaceae family Additionally, Mouly et al (2014) also used molecular markers such as trnT-trnL, trnL-F, and rps16 to build the phylogenic tree of Rubiaceae family The results showed that the distance between R wittii and R daweishanensis in the phylogenic trees (Figure 3A, B, C) are quite close Note that, the arrangement of R wittii and R daweishanensis analyzed by molecular markers is similar that used by morphological analysis Two species shared many of the same morphological characteristics: chartaceous, ovate leaf blade, uniflorous inflorescence, protruding from a very reduced branch above a pair of leaves, cylindrical calyx tube whereas the studied species was only distinguished from R daweishanensis by 2-4 mm calys lobe (14-16 mm in R daweishanensis) Therefore, the application of molecular markers is essential to distinguish these two species In this paper, Bioedit software was used to compare sequence data of two molecular markers (trnL-trnF and matK) of the studied species to those of closely related species in GenBank These results were shown in Figures and TẠP CHÍ KHOA HỌC - Trường ĐHSP TPHCM Tập 16, Số (2019): 190199 Figure The pairwise alignment of matK region between R daweishanensis and R wittii using Bioedit software Note: the homologous positions (match) between sequences are shown by the dots (.) The pairwise alignment of matK region between R daweishanensis and R wittii (Figure 4) showed that the entire aligned length of matK region of two specis is 760 bp Two sequences have 757 homologous positions (match) and non-homologous positions (mismatch) which located in positions 274, 540, 594, these mismatch positions were Cytosine, Adenine and Guanine in the sequence of R wittii while Thymine, Guanine and Adenine were in the sequence of R daweishanensis, respectively TẠP CHÍ KHOA HỌC - Trường ĐHSP TPHCM Ton Thi Hoai Thuong et al Figure The pairwise alignment of trnL-F region between R daweishanensis and R wittii using Bioedit software Note: The homologous positions were presented as the dots (.), and the gap position was presented as the hyphen (-) The length of trnL-F region of R daweishanensis was 803 bp There was a gap at position 27 in the sequence of R daweishanensi pairwise aligned with the studied species R wittii In addition, there were mismatch positions (23, 29, and 608) between the sequences of R daweishanensis and R witty (Figure 5) Recent reports have shown the importance of using the DNA barcodes to assist classification as well as establishment of the evolution of plant In previous study, Ha & Nguyen (2015) used matK region to DNA barcode of Camellia tamdaoensis, and the authors proved that there were differences in matK region between Camellia tamdaoensis and Camellia petelotii whose morphological characteristics were identical Moreover, TẠP CHÍ KHOA HỌC - Trường ĐHSP TPHCM Tập 16, Số (2019): 190199 Nguyen et al (2018) used ITS and psbA-trnH regions to DNA barcode of Paris vietnamensis in Vietnam, and the authors could distinguish this species from other species of Paris genus In this study, based on comparison of matK and trnL-F regions, the authors could identify the difference of genetic characteristics between R wittii and R daweishanensis which had similar morphological characteristics Conclusions It was identified that the specimens of H.T Van 203 collected from Binh ChauPhuoc Buu Nature Reserve, Bung Rieng ward, Xuyen Moc District, Ba Ria-Vung Tau Province belonged to R wittii These results provided the additional information about its distribution in Vietnam Moreover, the matK and trnL-F regions of R wittii were successfully amplified and sequenced It was also proved that there were differences in matK and trnL-F sequences between R wittii and R daweishanensis that had similar morphological characteristics Conflict of Interest: Authors have no conflict of interest to declare REFERENCES Bridson, D., & Forman, L (1999) The Herbarium Handbook (Third Edition) Royal Botanic Gardens, Kew, UK Bui, H.Q., & Nguyen, T.C (2015) A new record species Rothmannia wittii (Craib) Bremek (Rubiaceae) for the flora of Vietnam Journal of Biology, 37(4), 458-462 Graib, W.G (1911) Contributions to the Flora of Siam II List of Siamese Plants, with Descriptions of New Species Bulletin of Miscellaneous Information Royal Gardens, Kew, 10, 392-448 Ha, V.H., & Nguyen, V.P (2015) Identification of DNA barcode sequence for Tam Dao yellow tea (Camellia tamdaoensis): an endemic plant species of Vietnam Journal of Agriculture and rural development, 5, 123-130 Huynh, N.B.T., Nguyen, A.D., Trinh, T.H., Vo, T.D., & Van, H.T (2018) Taxonomic identity of limnocharitaceae based on molecular data from a rapid DNA extraction protocol Journal of Science and Technology Devolopment, Communist Youth Union of Ho Chi Ming City, 4(1), 78-82 Kainulainen, K., & Bremer, B (2014) Phylogeny of Euclinia and allied genera of Gardenieae (Rubiaceae), and description of Melanoxerus, an endemic genus of Madagascar Taxon, 63(4), 819-830 Mouly, A., Kainulainen, K., Persson, C., Davis, A.P., Wong, K.M., Razafimandimbison, S.G., & Bremer, B (2014) Phylogenetic structure and clade circumscriptions in the Gardenieae complex (Rubiaceae) Taxon, 63(4), 801–818 TẠP CHÍ KHOA HỌC - Trường ĐHSP TPHCM Ton Thi Hoai Thuong et al Newman, M., Ketphanh, S., Svengsuksa, B., Thomas, P., Sengdala, K., Lamxay, V., & Armstrong A (2007) A checklist of the Vascular Plant of Lao PDR, Royal Botanic Garden Edinburgh Scotland, UK, 314-315 Nguyen, T.D., Nguyen, Q.N., Tran, N.L., Nguyen, T.T., Ninh, T.P., Đoan, T.T.N., Le, T.T.H., & Nguyen, N.L (2018) Morphological Characteristics and DNA Barcodes of Paris vietnamensis (Takht.) H.Li in Vietnam Vietnam J Agri Sci., 16(4), 282-289 Pham-hoang, H (2000) Araceae In: Pham-hoang H (ed.), Cây cỏ Việt Nam: An Illustrated Flora of Vietnam, 3, Youth Publishing House, Ho Chi Minh City, Vietnam Ronquist, F., & Huelsenbeck, J P (2003) MrBayes 3: bayesian phylogenetic inference under mixed models Bioinformatics, 19, 1572-1574 Taberlet, P., Gielly, M.L., & Patou, G (1991) Bouvet, Universal primers for amplification of three non-coding regions of chloroplast DNA Plant molecular Biology, 17, 1105-1109 Thompson, D.J., Higgins, D.G., & Gibson, T.J (1994) Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice Nucleic Acids Res, 22, 4673-4680 GHI NHẬN VÙNG PHÂN BỐ MỚI Ở VIỆT NAM VÀ XÁC ĐỊNH MÃ VẠCH DNA CHO LỒI Rothmannia wittii (HỌ RUBIACEAE) Tơn Thị Hoài Thương1, Nguyễn Tài Thu1, Đinh Thị Kim Trúc1, Lê Văn Sơn2, Trần Gia Bửu1, Văn Hồng Thiện1 Viện Công nghệ Sinh học & Thực phẩm – Trường Đại học Công nghiệp TPHCM Khu Bảo tồn Thiên nhiên Bình Châu – Phước Bửu Tác giả liên hệ: Văn Hồng Thiện – Email: vanhongthien@iuh.edu.vn Ngày nhận bài: 29-10-2018; ngày nhận sửa: 24-12-2018; ngày duyệt đăng: 21-3-2019 TÓM TẮT Bằng phương pháp hình thái so sánh, báo xác định mẫu nghiên cứu thu Khu bảo tồn thiên nhiên Bình Châu – Phước Bửu lồi Rothmannia wittii, từ cung cấp thêm thơng tin vị trí phân bố cho lồi Việt Nam Ngoài ra, phương nghiên cứu sinh học phân tử, nghiên cứu nhân giải trình tự thành cơng vùng trình tự matK trnL-F lồi R wittii Thơng qua việc phân tích trình tự DNA, kết nghiên cứu cho thấy khác biệt trình tự vùng matK trnL-F lồi có đặc điểm hình thái tương tự R wittii R daweishanensis Từ khóa: Rothmannia wittii, matK, trnL-F, mã vạch DNA barcode 10 ... side, midrib impressed adaxially and prominent abaxially, lateral veins diverging from the midrib and toward margin In? ??orescence uniflorous, protruding from a very reduced branch above a pair of leaves;... target matK and trnL-F regions were amplified by polymerase chain reaction (PCR) using following barcoding primers (Table 2) The PCR reactions were performed in an Eppendorf Mastercycler Gradient... the low forest (about 30-40 meters in elevation), flowering from May to August and fruiting from July to December Distribution: R wittii was formerly recorded in Thailand and Laos In Vietnam,